Chem. Res. Toxicol. 1990, 3, 262-261
262
Mode of Action of Saframycin Antitumor Antibiotics: Sequence Selectivities in the Covalent Binding of Saframycins A and S to Deoxyribonucleic Acidt K. Ekambareswara Rao and J. William Lown* Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 Received January I O , 1990
The sequence-preferential reversible covalent binding of certain saframycin antitumor antibiotics from Streptomyces lavendulae has been examined by complementary-strand methidium propyl-EDTA (MPE) footprinting on an EcoRI/HindIII restriction fragment of pBR322 DNA under several experimental conditions. A buffer at pH 7.4 and in the presence of 9.5 mM dithiothreitol at 37 “C was found t o be optimum for the interaction of these antibiotics with DNA. At r’ = 0.6 both saframycins A and S exhibited footprints in the regions 4244-4257 (CAAATAGGGTTCC) and 4265-4286 (TTCCCCAAAAGTGCCACCTG) and a weak footprint in the region 4297-4302 (AACCAT). The binding locations identified that are common t o saframycins A and S are (all 5’43’) G E G (4250-4253), C E C (4268-4271), and GCC (4279-42811, and weak interaction locations are ACC (4282-4284 and 4298-4300) (underlined bases are shared by two adjacent binding sites). Both the antibiotic saframycins A and S show preference for 5’-GGG or 5’-GGC sequences. It appears that saframycin A has no affinity for 5’-CGG while saframycin S shows a strong footprint at this sequence. Neither of the saframycins recognizes alternating CG sequences. Saframycin S also binds to 5’-CTA, which suggests that molecular recognition processes involving the parent antibiotics are also important, and not only recognition by, and covalent binding of, the common iminium species to the DNA. The protection sites a t 5’-GCC and 5’-ACC suggest that saframycins A and S recognize 5’-GGPy sequences. However, between the two pyrimidine bases, C is preferred to T. Enhancement of cleavage by both saframycins is observed in the AT-rich region of 4301-4318. The complementary-strand analysis of the MPE.Fe(I1) footprinting showed typical asymmetric shift of the footprints with both saframycins A and S toward the 3’-end. Minor groove binding of the antibiotics is indicated by binding to T 4 DNA. Neither saframycin B nor saframycin C, both of which lack the key leaving group, gives footprints under the above experimental conditions, nor, unlike saframycins A and S, do they exhibit antitumor properties.
The saframycins comprise a family of antitumor antibiotics isolated from the streptothricin-producing strain of Streptomyces lavendulae (1-6). The saframycins (Figure 1) are heterocyclic quinones structurally related to other quinone antibiotics including the safracins (7), renieramycins (8, 9 ) , mimosamycin ( 2 ) , naphthyridinomycin ( l o ) ,mitomycins (111,streptonigrin (121, and cyanocycline A (13). The saframycins contain two heterocyclic quinone moieties, and these microbial metabolites appear to be derived biosynthetically from two “monomeric” w i t s of mimosamycin or renierone (14, 15) via the shikimate chlorismate prophenate tyrosine pathway ( 3 , 15). While the saframycins generally exhibit wide spectrum antibiotic activity, saframycins A and S [a possible precursor of many saframycins (1-3)] are of particular interest in that they show antitumor activity against several experimental tumors including leukemias L1210 and P388, B16 melanoma, and Ehrlich carcinoma, in both ascites and solid forms, as well as human tumor xenografts in nude mice (14, 16, 17). Selected saframycins are undergoing
-
-
-
‘This investigation was supported by a grant (to .J.W.L) from the National Cancer Institute of Canada and the Medical Research Council of Canada. * Address correspondence to this author.
0893-228~/90/2703-0262$02.50/0
clinical trials as anticancer agents. Evidence from biochemical pharmacology indicates that cellular DNA is among the principal cell targets of the saframycins (17). Our previous studies (18)revealed three distinct modes of binding of the saframycins with DNA: (i) a reversible noncovalent binding, (ii) a reversible covalent binding within the minor groove which is acid promoted, and (iii) a major mode consisting of reversible covalent binding within the minor groove which is promoted by reducing cofactors such as dithiothreitol. There exists in addition to these processes a pathway involving redox cycling of the quinone moieties of the antibiotic leading to reactive oxygen species mediated single strand scission of DNA (18). This latter process has been implicated in the antibiotic action of those saframycins (including B and C) that are incapable of covalent attachment to DNA (1-3). Further investigation of the major reductant-promoted reversible covalent binding to both native DNAs of different G+C content as well as appropriate synthetic oligodeoxyribonucleotides showed a preference for binding to GC base sequences (28). However, there are no reports discussing the sequence specificity of the saframycins. Accordingly, in our continued efforts to understand the molecular aspects of the 1990 American Chemical Society
Saframycin-DNA Interaction
Chem. Res. Toxicol., Vol. 3, No. 3, 1990 263 1
2
3
4
5
6
7
8
910
4240 ___-
G--G C-
C---
-T
I
C- C--
CH3 A-
B C S
R, = H, R1 =OH,
R 2 = OCH3 R2=
A. A-.
__ -
A-
-GAA
=$
G -
Rl = CN, R2 = H R1 = H, R 2 = H
Saframycin A
._
CC- T -
111
H
[
-C A --
zT CC
-GT C -
-T
OCHi C -
3; 9 CC
CA- TT-
N- -CH3 H3
CH3@
-ATC
A- AA- GAA--
CHBO OH
LNHCN
CH3
1 4319
~
Saframycin R
Figure 1. Structures of saframycin antitumor antibiotics.
interaction of the saframycins with cellular targets and their anticancer and antibacterial properies, we report studies employing footprinting procedures of the sequence preferential binding of certain saframycins to restriction fragments of plasmid DNA and the structural implications of the molecular recognition processes involved.
Materials and Methods Biochemicals. The pBR322 and sonicated calf thymus (ct) DNAs and restriction enzymes HindIII and EcoRI were obtained from Pharmacia P-L Biochemicals. All were used without further purification. The T4 polynucleotide kinase, Klenow fragment (large fragment of DNA polymerase I), and urea were from Bethesda Research Labs. Dithiothreitol (D'IT) and calf intestine phosphatase (CAP) were obtained from Calbiochem. Acrylamide, bromophenol blue, and xylene cyano1 were from Serva. [y32P]ATPand [ c x - ~ ~ P I ~ A were T P purchased from New England Nuclear. All other reagents were of analytical grade. Methidiumpropyl-EDTA (MPE) was a gift from Professor P. B. Dervan (California Institute of Technology). Footprinting Procedure. EcoRI-digested pBR322 DNA was either 5'-32P-labeled (using [Y-~VIATP, CAP, and T4 kinase) or 3'-3T-labeled (using [a-?]dATP and Klenow fragment) and then digested with HindIII. The resulting 4332 and 31 base pair fragments were not separated prior to the cleavage reactions. The footprinting reactions were performed in the presence of sonicated calf thymus DNA, labeled DNA, DTT, and the saframycin (not present in control) in 10 mM Tris and 20 mM NACl buffer, pH 7.4. After the antibiotic-DNA mixtures were equilibrated for 40 min at 37 "C, MPEeFe(I1) (made freshly) was added to each reaction tube. The final reaction mixtures contained 100 pM DNA, 10 mM Tris, 20 mM NaC1,lO pM MPE*Fe(II),9.5 mM DTT, and 8,16, or 78 pM antibiotic. Reactions were run a t room temperature for 15 min and then stopped by freezing a t -70 "C. The solutions were then lyophilized and resuspended in formamide loading buffer for gel electrophoresis. After electrophoresis (0.4 mm thick, 55 cm long, 6% polyacrylamide, 7 M urea, 1900 V, 55 "C), the gels were dried (Bio-Rad Model 483 slab dryer) and autoradiographed a t -70 "C by using Kodak X-Omat AR film.
Figure 2. A portion of a footprinting autoradiogram from MPE-Fe(11) cleavage of 3'-32P-end-labeled restriction fragment. Lane 1 contains intact DNA fragment. Lane 2 is control MPE-Fe(I1) cleavage in the presence of excess DTT. Lane 3 is also control MPEgFe(I1) cleavage in the presence of a normal concentration of DTT. Lanes 4 and 6 contain saf A and saf S, respectively, a t r' = 0.78. Lanes 5,7, and 9 contain saf A, saf S, and distamycin, respectively, a t r'= 0.6. Lane 10 is the Maxam-Gilbert sequencing "G" reaction. Disregard lane 8. Note appearance of no bands with saf A a t r' = 0.78. Sites I-V are the footprint regions, and site E is the MPEoFe(I1) cleavage enhancement region. The resulting autoradiograms were scanned on a LKB Ultroscan XL laser densitometer. The densitometric data were corrected for the background absorbance of the film ( 0.8 no individual bands are seen with saf A. However, at r' = 0.6 saf A and saf S show footprints in the regions 4244-4257 (CAAATAGGGGTTCC) and 4265-4286 (mCCCCGAAAAGTGCCACCTG) and weak footprints in the regions 4289-4295 (GTCTAAG) (saf S) and 4297-4302 (AACCAT). Distamycin, a known nonintercalative (noncovalent interaction) ligand, gives clear footprints in the region 4289-4325
5
6
?!
4321
4249
1
A GAG
G GG -TC y T - T C AC x G G -G Z G A CT C G
T A T
C
Figure 3. A portion of a footprinting autoradiogram from MPE*Fe(11) cleavage of 5'-32P-end-labeled restriction fragment. Lane 1 contains intact DNA fragment. Lane 2 is control MPEoFe(I1) cleavage in the presence of a normal concentration of DTT. Lane 3 contains saf A a t r' = 0.6. Lane 4 contains saf A at r' = 0.78. Lane 7 is the Maxam-Gilbert sequencing "G" reaction. Disregard lanes 5 and 6. Here also note appearance of no bands a t r' = 0.78 for saf A. Sites I-IV are the footprint regions, and site E is the MPE-Fe(I1)cleavage enhancement region.
4
T- TTTCC A G G- TG E C A -T G C- A-G-
C
4319
3
T-
T-
T TC =TT --.G
G-
4321 ~
Figure 4. A portion of a footprinting autoradiogram from MPE-Fe(11) cleavage of 5'-32P-end-labeled restriction fragment. Lane 1 contains intact DNA fragment. Lane 2 is control MPE-Fe(I1) cleavage in the presence of a normal concentration of DTT. Lane 5 contains saf S a t r' = 0.6. Lane 6 contains saf S a t r' = 0.3. Lane 9 is the Maxam-Gilbert sequencing "G" reaction. Disregard all other lanes. Sites I-VI are the footprint regions, and site E is the MPEFe(I1) cleavage enhancement region. Table I. Sequences Preferred in Covalent Binding of Saframycins A and S sequence (5'+3') antibiotic saframycin A
GGGG" CCCC" GCC," ACCb ACCAb
4250-4253 4268-427 1 4279-4204 4298-4301
saframycin S
GGGG" CCG" CCCC" GCC," ACCb CTAb ACCb ACCb
4250-4253 4257-4259 4268-4271 4279-4284 4291-4293 4298-4300 4319-4321
Strong or primary binding sites. Weak or secondary binding sites.
(GTCTAAGAAACCATTATTATCATGACATTAACCTATA). The binding locations measured for saframycins A and S are shown in Table I. The binding site size and location are measured on the basis of the position of maxima of the asymmetric inhibition patterns of the antibiotics on opposite DNA strands as proposed by Dervan (19). The binding sites of saf A are (all 5'-+3') G E G (4250-4253), CCCC J (4268-4271), and GCC (4279-4281), and the weak interaction locations are ACC (4282-4284 and 4298-4300)
Chem. Res. Toxicol., Vol. 3, No. 3, 1990 265
S aframycin-DNA I n t eruct ion A 4240
4260 I
I
4280
I
TAAACAAATA ATTTGTTTAT
I
I
4300 I
I
GCGCACATTT CGCGTGTAAA p
4320
............. ................... I
I
B
C 4240 I
4260 I
4280
I
........ ........
TAAACAAATAGGGGTTCCGCGCAC ATTTGTTTATCCCCAAGGGGCGTG
I
p
I
4300 I
.... a.......... ............
I
I
4320 I
TA AT
0..
Figure 5. Footprinting and cleavage enhancement of (A) saf A, (B) saf S, and (C) distamycin on EcoRIIHindIII-cut restriction fragment of pBR322 DNA a t r’ = 0.6 for the saframycins and 0.16 for distamycin. Histogram height is proportional to the protection from the cleavage a t each base pair relative to unprotected DNA (in the absence of compound). Upper and lower footprints are from 3’- and 5’-end-labeled DNA, respectively. ( 0 )indicates enhanced cleavage, and boxes indicate proposed binding sites.
(underlined bases are shared by two adjacent binding sequences). The binding locations of saframycin S are GGGG (4250-4253), CCG (4257-4259), C E C (4268-4271), anrGCC (4279-4281), and the weak interaction sites are ACC (4282-4284, 4298-4300, 4319-4321) and CTA (4291-4293). The binding sites of distamycin on the same sequence (at r’ = 0.16) are ATTT (4264-4267), AAAA (4273-4276), TAAGA (4292-4296), TTATTAT (4302-4308), and ATTTAA (4315-4319). Though several consecutive 5’-GC sequences are available on the restriction fragment used in this study, both the saframycins A and S show preference for 5’-GGG sequences or 5’-GGC. The MPEaFe(I1) protection sites at 5’-GCC and 5’-ACC suggest these saframycins recognize 5’-GGPy sequences. However, it is apparent from the study that, between the two pyrimidine bases, C is preferred to T. A unique sequence recognized by saframycin S is 5’-CCG or 5’-CGG for which saframycin A has no affinity. A substantial MPE-Fe(I1) cleavage enhancement due to binding of saframycins to the DNA fragment is observed on the sequence of bases 4300-4319, which is an AT-rich region. Complementary strand analysis of the MPEeFe(I1) footprinting shows the typical asymmetric shift of the footprints (33)with both saf A and saf S and distamycin toward the 3’-end, indicating the minor groove is the site of interaction for both the ligands (34),in accord with conclusions drawn from studies with T4 DNA (18).
Discussion There is growing evidence that many clinical anticancer agents, which function primarily by interacting with cellular DNA, exhibit specificity or preference in molecular recognition of particular sequences. Examples of this phenomenon include netropsin (20-22), distamycin (20), CC-1065 and its analogues (23),the pyrrole[ 1,4]benzodiazepinones (24),bleomycin (25, 26), libliomycin (27), calcheamicin (28,29),nitrogen mustards (30),and chloroethylating anticancer agents (30-32). Thus, in this context, the observation of distinct sequence preferences
in the case of the potent antitumor agents saframycins A and S, contrasted with the lack of evidence of any covalent binding in the cases of saframycins B and C, which lack antitumor potency ( I , 2 ) , may well have significance for their biological properties. Both saframycins A and S recognize and bind primarily to GGG triplets on the DNA fragment analyzed. They also recognize and bind covalently to 5’-GGPy sequences where Py is C or T; however, C is much preferred over T in both the cases. Although saframycins A and S, which differ only in the nature of the key leaving group R1,give rise to a common electrophilic iminium intermediate (18) (Figure 6), they differ somewhat in their sequence preferences. Thus, while there are the primary triplet sequences in common, saframycin S also recognizes 5’-CCG and 5’-CTA sequences which saframycin A does not. This suggests that participation of discrete points of contact in the molecular recognition processes between the antibiotics and the template, prior to formation of a common electrophilic iminium ion, are important determinants of sequence specificity. Saframycin S is an a-carbinolamine. The fact that saframycin S gives rise to additional binding sequences compared with saframycin A also suggests that the a-carbinolamine is not the common reactive form of the saframycins as has been suggested (1-3). Whether these critical contacts take place with the parent antibiotics or with the reduced (and activated) saframycins prior to loss of the respective leaving groups cannot, as yet, be determined. Ongoing high-field NMR analysis of appropriate drug-oligodeoxyribonucleotide complexes, molecular modeling, and microcalorimetric determination of the thermodynamics of drug binding may contribute to this point. From the complementary strand analysis it is apparent that the footprints exhibited by the saframycins are asymmetric. At each site the footprint is shifted one or two base pairs toward the 3’-end and underprotected on the 5’-side of the DNA fragment. This behavior is characteristic of minor groove binding (33,34)and confirms
Rao and Lown
266 Chem. Res. Toxicol., Vol. 3, No. 3, 1990
Base Sequence
Figure 7. Densitometric scans of autoradiogram of MPEeFe(I1) footprinting on 3'-end-labeled restriction fragment. (A) MPEFe(I1) control and in the presence of (B) saf R, (C)saf S, and (D) saf A. Footprinting regions are marked in panels C and D. No footprints are evident in panel B.
kN*
Figure 6. Reaction scheme showing the reduction of the quinone moiety with concomitant loss of leaving group, ring closure, and covalent binding of saframycin A via an aminal linkage to guanine-2NH2in the minor groove of DNA.
the earlier conclusion drawn from T4 DNA binding studies (18).
Application of the earlier proposed model for the analysis of footprinting data for ligand-DNA binding (19) permitted assignment of the binding site size as well as location. The measured binding site size for both the antibiotics is three base pairs. Although the active saframycins bind avidly to guanine-2NHz positions, isolated or two contiguous GC pairs are ignored, as are alternating GC sequences (e.g., 4257-4261). The strict requirement of three sequential G's (or the equivalent three C's) again argues for molecular recognition processes involving the antibiotoic molecule as a whole, rather than a sequence selectivity dictated exclusively by, for example, global electrostatic influences on the incoming iminium ion, although electrostatic effects may prove significant (35-38). With regard to the preferred sequences of GGG and CCC exhibited by both saframycins A and S, insufficient experimental evidence is available at present on the orientation(s) of the covalently bound antibiotics. The ongoing high-field NMR analysis may determine whether the distinction between 5'-GGG and 5'-CCC is real or whether they are equivalent by virtue of opposing orientations of the bound antibiotics. Both saframycins A and S show enhancement of cleavage on the AT-rich sequence of bases 4301-4318. The cleavage enhancement is seen most often proximate to the
binding sites and between binding sites (at least in the case of saframycin S). However, enhancement of cleavage is seen up to 16 base pairs from a given site. This is probably not attributable to the transmission of conformational changes in the DNA as a result of binding of the antibiotics in view of recent examination of this phenomenon (39). These workers showed that the pattern of cleavage enhancements in DNase I digests of a 139 base pair segment of pBR322 is most likely due to a redistribution of the cleavage agent as a result of drug binding. Saframycins A and S evidently bind with sequence selectivity at triplet sites consisting of GC base pairs whereas saframycins B, C, and R, which lack the ability under reductive activation to generate the electrophilic iminium intermediate, do not bind (Figure 7). The fact that dithiothreitol-inducible binding of saframycin A to DNA was blocked by the addition of excess cyanide ion (40) indicates that the iminium ion or a-carbinolamine is the actual species involved in the interaction with DNA. Additional supporting evidence is that chemical reduction at the C-21 position of the basic skeleton of saframycin A, Le., at the attachment site of the cyano group, which removes the nitrile, resulted in almost complete loss of biological activity (41). These results are consistent with covalent binding of the activated antibiotic to a guanine-2NH2site in the central position of the triplet recognition sequence as proposed earlier (18). Nucleophilic addition of the G-2NHz to the intermediate iminium ion will be subject to stereoelectronic control (42) such that the reaction pathway to the a m i d link formation is as shown in Figure 6. This represents another instance of several cases where the G-2NH2 group is an important carrier of biological information (43,441. The selective inhibition of pre-rRNA by actinomycin D, or other nucleic acid interactive agents, is often simply explained by their high affinity for GC pairs. This simple explanation cannot account for the action of saframycin A, since while the drug shows high affinity toward GC pairs in vitro (17,18), yet it does not show any selectivity toward rRNA synthesis in vivo (17). These data led the latter authors to state "Therefore, it seems likely that not only base composition but also base sequence might be involved in the determination of selectivity". The present results appear to support this view. In addition, the fact that saframycins A and S exhibit marked antitumor properties, whereas B and C do
Saframycin-DNA Interaction not, suggests that the sequence-specificreversible covalent binding is an important determinant of biological activity. Registry No. Saframycin A? 66082-27-7; saframycin B, 66082-28-8; saframycin C,66082-29-9; saframycin S, 75425-66-0.
References (1) Arai, T., Takahashi, K., and Kubo, A. (1977) New antibiotics, saframycins A, B, C, D and E. J. Antibiot. 30, 1015-1018. (2) Arai, T., Takahashi, K., Kubo, A., Nakahara, J., Sato, S., Aiba, K., and Tamura, C. (1979) The structures of novel antibiotics, saframycin B and C. Tetrahedron Lett. 25, 2355-2358. (3) Arai, T., Takahashi, K., Ishiguro, K., and Yazawa, K. (1980) Increased production of saframycin A and isolation of saframycin S. J. Antibiot. 33, 951-960. (4) Yazawa, K., Takahashi, K., Mikami, Y., Arai, T., Saito, N., and Kubo, A. (1986) Isolation and structural elucidation of new saframycins Y3, Yd-1, Yd-2, Ad-I, Y2b and Y2b-d. J. Antibiot. 39, 1639-1650. (5) Yazawa, K., Asaoka, T., Takahashi, K., Mikami, Y., and Arai, T. (1982) Bioconversion of saframycin A specific to some genera of actinomycetes. J. Antibiot. 35, 915-917. (6) Mikami, Y., Takahashi, K., Yazawa, K., Chen, H.-Y., Arai, T., Saito, N., and Kubo, A. (1988) Structural studies on minor components of saframycins F, G, and H. J. Antibiot. 41, 734-740. (7) Ikeda, Y., Matsuki, H., Ogawa, T., and Munakata, T. (1983) Saframycins, new antitumor antibiotics. 11. Physicochemical properties and chemical structures. J. Antibiot. 36, 1284-1289. (8) McIntyre, D. E., Faulkner, D. J., Van Engen, D., and Clardy, J. (1979) Renierone, an antimicrobial metabolite from a marine sponge. Tetrahedron Lett., 4163-4166. (9) Fincke, J. M., and Faulkner, D. J. (1982) Antimicrobial metabolites of the sponge Reniera sp. J . Am. Chem. SOC.104,265-269. (10) Kluepfel, D., Baken, H. S., Piottoni, G., Sehgal, S. N., Siderowicz, A,, Singh, K., and Vezina, C. J. (1975) Naphthyridinomycin, a new broad spectrum antibiotic. J. Antibiot. 28,497-502. (11) Szybalski, W., and Iyer, V. N. (1967) in The mitomycins and profiromycins in antibiotics. I. Mechanism of action (Gottlieb, D., and Shaw, P. D., Eds.) pp 211-245, Springer-Verlag, New York. (12) Rao, K. V., Biemann, K., and Woodward, R. B. (1963) The 85, 2532-2533. structure of streptonigrin. J. Am. Chem. SOC. (13) Hayashi, T., Noto, T., Nawata, Y., Okazaki, H., Sawada, M., and Ando, K. (1982) Cyanocycline A, a new antibiotic. Taxonomy of the producing organism, fermentation, isolation and characterization. J . Antibiot. 35, 771-777. (14) Arai, T., Mikami, Y., Okamoto, K., Tokita, H., and Teras, K. (1978) in Advances in cancer chemotherapy, pp 235-251, University Park Press, Baltimore. (15) Mikami, Y., Takahashi, K., Yazawa, K., Arai, T., Namikoshi, M., Iwasaki, S., and Okuda, S. (1985) Biosynthetic studies on saframycin A, a quinone antitumor antibiotic produced by Streptomyces ravendulae. J. Biol. Chem. 260, 344-348. (16) Arai, T., Takahashi, K., Ishiguro, K., and Mikami, Y. (1980) Some chemotherapeutic properties of two new antitumor antibiotics, saframycins A and C. Gann 71, 790-796. (17) Ishiguro, K., Sakiyami, H., Takahashi, K., and Arai, T. (1981) Mode of action of saframycin A, a novel heterocyclic quinone antibiotic. Inhibition of RNA synthesis in uiuo and in uitro. Biochemistry 17, 2545-2550. (18) Lown, J. W., Joshua, A. V., and Lee, L. S. (1982) Molecular mechanisms of binding and single strand scission of deoxyribonucleic acid by the antitumor antibiotics saframycins A and C. Biochemistry 21, 419-428. (19) Harshman, K. D., and Dervan, P. B. (1985) Molecular recognition of B-DNA by Hoechst 33258. Nucleic Acids Res. 13, 4815-4835. (20) Hahn, F. E. (1975) in Antibiotics. III. Mechanism of action of antimicrobial and antitumor agents (Concoran, J. W., and Hahn, F. E., Eds.) pp 79-100, Springer-Verlag, New York. (21) Zimmer, C., and Wahnert, U. (1986) Non-intercalative DNA binding ligands: Specificity of the interaction and their use as tools in biophysical, biochemical and biological investigations of genetic material. Prog. Biophys. Mol. Biol. 47, 31-112. (22) Zimmer, C., Luck, G., Burckhart, G., Krowicki, K., and Lown, J. W. (1986) in Molecular mechanisms of carcinogenic and an-
Chem. Res. Toxicol., Vol. 3, No. 3, 1990 267 titumor activity (Chargas, C., and Pullman, B., Eds.) pp 339-363, Academic Press, New York. (23) Reynolds, V. L., Molineus, L. J., Kaplan, D., Swenson, D. H., and Hurley, L. H. (1985) Reaction of the antitumor antibiotic CC-1065 with DNA. Location of the site of structurally induced strand breakage and analysis of DNA sequence specificity. Biochemistry 24, 6628-6637. (24) Hurley, L. H., Ruk, T., Thurston, D. E., Langley, D. R., Holden, K. G., Hertzberg, R. P., Hoover, J. R. E., Gallagher, G., Fancette, L. F., Wong, S. M., and Johnson, R. K. (1988) Pyrrole-[1,4]benzodiazepine antitumor antibiotics: Relationship of DNA alkylation and sequence specificity to the biological activity of natural and synthetic compounds. Chem. Res. Toxicol. 1, 258-268. (25) Hecht, S. M., Ed. (1979) Bleomycin, chemical, biochemical and biological aspects, Springer-Verlag, New York. (26) Stubbe, J., and Kozarich, J. W. (1987) Mechanism of bleomycin induced DNA degradation. Chem. Reu. 87, 1107-1136. (27) Wassermann, K., Zwelling, L. A., Lown, J. W., Hartley, J. A,, Nishikawa, K., Lin, J. R., and Newman, R. A. (1990) The DNA cleaving effect of libliomycin in human head and neck squamous carcinoma cells and on purified DNA. Cancer Res. 50,1732-1737. (28) Lee, M. D., Dunne, T. S., Chang, C. C., Ellestad, G. A., Seigel, M. M., Morton, G. O., McGahren, W. J., and Borders, D. B. (1987) Calicheamicins, a novel family of antitumor antibiotics chemistry and structure of calicheamicin yl. J. Am. Chem. SOC.109, 3466-3468. (29) Zein, N., Sinha, A. M., McGahren, W. J., and Ellestad, G. A. (1988) Calicheamicin yl. An antitumor antibiotic that cleaves double stranded DNA site specifically. Science 240, 1198-1201. (30) Mattes, W. B., Hartley, J. A,, and Kohn, K. W. (1986) DNA sequence selectivity of guanine N7 alkylation by nitrogen mustards. Nucleic Acids Res. 14, 2971-2987. (31) Hartley, J. A., Gibson, N. W., Kohn, K. W., and Mattes, W. B. (1986) DNA sequence selectivity of guanine-N7 alkylation by three antitumor chloroethylating agents. Cancer Res. 46, 1943-1947. (32) Hartley, J. A., Lown, J. W., Mattes, W. B., and Kohn, K. W. (1988) DNA sequence specificity of antitumor agents: Oncogenes as possible targets for cancer chemotherapy. Acta Oncol. 27, 503-510. (33) Van Dyke, M. W., and Dervan, P. B. (1982) Footprinting with MPE.Fe(I1). Complementary strand analysis of distamycin and actinomycin binding sites on heterogeneous DNA. Cold Spring Harbor Symp. Quant. Biol. 47, 347-353. (34) Lane, J. M., Vournakins, J. N., and Dabrowiak, J. C. (1985) Footprinting analysis as a means of quantitating antitumor drug-DNA interactions. Prog. Clin. Biol. Res. 172, 145-153. (35) Lavery, R., Pulman, A., and Pullman, B. (1982) The electrostatic field of B-DNA. Theor. Chim. Acta 62, 93-106. (36) Lavery, R., and Pullman, B. (1982) The electrostatic field of DNA: The role of the nucleic acid conformation. Nucleic Acids Res. 10, 4383-4395. (37) Pullman, A., and Pullman, B. (1981) Molecular electrostatic potential of the nucleic acids. Q. Rev. Biophys. 14, 289-380. (38) Pullman, B. (1989) Molecular mechanisms of specificity in DNA-antitumor drug interaction. Adu. Drug Res. 18, 1-113. (39) Ward, B., Rehfuss, R., Goodisman, J., and Dabrowiak, J. C. (1988) Rate enhancements in the DNase I footprinting experiments. Nucleic Acids Res. 16, 1359-1369. (40) Ishiguro, K., Takahashi, K., Yazawa, K., Sakiyama, S., and Arai, T. (1981) Binding of saframycin A, a heterocyclic quinone antitumor antibiotic, to DNA as revealed by the use of the antibiotic labeled with [14C]tyrosineor [14C]cyanide. J. Biol. Chem. 256, 2161-2167. (41) Tahahasi, K., Yazawa, K., Kishi, K., Mikami, Y., Arai, T., and Kubo, A. (1982) Microbial conversion of saframycin A to 25-dihydrosaframycin A and 21-decyano-25-dihydrosaframycinA (25dihydrosaframycin B) and their biological activities. J.Antibiot. 35, 196-202. (42) Deslongchamps, P. (1983) Stereoelectronic effects in organic chemistry, pp 211-221, Pergamon Press, New York. (43) Dickerson, R. E. (1983) The DNA helix and how it is read. Sci. Am. 249 (6), 94-111. (44) Warpehoski, M. A., and Hurley, L. H. (1988) Sequence selectivity of DNA covalent modification. Chem. Res. Toxicol. 1, 315-333.
