Modulating Heterologous Gene Expression with Portable mRNA

Subscriber access provided by Kaohsiung Medical University

Article

Modulating heterologous gene expression with portable mRNA-stabilizing 5’-UTR sequences Sandra C. Viegas, Patrícia Apura, Esteban Martinez-García, Victor de Lorenzo, and Cecília Maria Arraiano ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.8b00191 • Publication Date (Web): 31 Jul 2018 Downloaded from http://pubs.acs.org on August 1, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29

ACS Synthetic Biology

1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1 2

Modulating heterologous gene expression with

3

portable mRNA-stabilizing 5’-UTR sequences

4

by

5 6 7

Sandra C. Viegas1*¤, Patrícia Apura1*, Esteban Martínez-García2, Víctor de Lorenzo2,¤ and Cecília M.

8

Arraiano1,

9 10 11

1Instituto

12

República, EAN, 2780-157 Oeiras,Portugal.

13

Biotecnologia, CSIC, C/ Darwin, 3 (Campus de Cantoblanco), Madrid 28049, Spain

de Tecnologia Química e Biológica António Xavier, Universidade Nova de Lisboa, Av. da 2Systems

Biology Program, Centro Nacional de

14 15 16

Running Title: Boosting gene expression flow with 5’-UTRs

17

Keywords:

mRNA decay, heterologous expression, 5’-UTRs, pSEVA, sfGFP

18 19 20

¤ Correspondence

to:

21 22

Sandra Cristina Viegas

Víctor de Lorenzo

23

Tel: +351 214469548

Tel: +34 91 585 4536

24

E-mail: [email protected]

Fax: +34 91 585 4506 E-mail: [email protected]

25 26 27 28

_________________________________________________________________________________

29

* These authors contributed equally to this work.

30

ACS Paragon Plus Environment


2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

Abstract

2 3

RNA half-lives are frequently perceived as depending on too many variables and transcript stability is

4

generally missed as a checkpoint amenable to manipulation in synthetic designs. In this work, the

5

contribution of mRNA stability to heterologous protein production levels in E. coli has been inspected.

6

To this end, we capitalized on the wealth of information available on intrinsic mRNA stability

7

determinants, four of which were formatted as portable modules consisting of 5’-untranslated regions

8

(UTRs). The cognate DNA sequences were then assembled in a genetic frame in which mRNA stability

9

endowed by the UTRs was the only variable to run expression of sfGFP. Reporter output and Northern

10

blot-based measurements of absolute mRNA half-lives, revealed that such UTRs were found to keep

11

intact their ability to modulate transcript stability when excised from their natural context and placed as

12

the upstream region of the reporter gene. By keeping transcription fixed and combining different UTRs

13

with a constant ribosomal binding site we showed that mRNA decay can be made the limiting

14

constituent of the overall gene expression flow. Moreover, the data indicated that manipulating mRNA

15

stability had little effect on expression noise in the corresponding population. Finally, augmented

16

heterologous expression brought about by mRNA stability did not make cells more vulnerable to

17

resource-consuming stresses. The tangible result of this work was a collection of well-characterized

18

mRNA-stabilizing sequences that can be composed along with other expression signals in any

19

construct following the assembly rules of the Standard European Vector Architecture (SEVA) format.

20

___________________________________________________________________

21 22

The succession of molecular events that operate on a coding DNA sequence all the way to production

23

of an active protein is punctuated by a number of bottlenecks that check the outcome of the gene

24

expression flow. Beyond the coding region, genes are accompanied also of sequences required to

25

direct both transcription and translation initiation. The promoter defines the beginning of the mRNA

26

sequence and its strength defines the transcription rate. The architecture of RNAs provides additional

27

levels of gene control beyond the regulation of transcription initiation1. Moreover, gene expression can

28

also be regulated at the level of mRNA stability2 and the frequency of translation initiation3.

29 30

Prokaryotic mRNAs are unstable, with half-lives in the minute range. This is consistent with the need of

31

rapid adaptation of the pattern of protein synthesis of bacterial cells in response to changes in the


Page 2 of 29

Page 3 of 29


3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

environment. In E. coli, mRNA degradation involves the combined actions of endonucleases and 3’5’

2

exonucleases. While much progress has been made in identifying the multiple protein factors that

3

govern mRNA degradation in this bacterium4,5, it is not clear what determines the widely different

4

lifetimes of bacterial transcripts. The relatively short 3’-untranslated regions of bacterial mRNAs usually

5

harbor stem-loop structures that can serve as barriers against 3’5’ exonucleases and the transcript

6

ends hardly become a target of mRNA stability control devices2,4. In contrast, the 5’-untranslated region

7

(UTR) of prokaryotic mRNAs can be (very) long and extremely diverse. Moving towards the 5'-end, the

8

UTR comprises the initiation codon, the Shine-Dalgarno (SD) sequence and a suite of optional

9

translation enhancer signals, which can extend far upstream from the coding region. In E. coli, 5’-

10

leader segments of long-lived transcripts often function as mRNA stabilizers, namely when fused to

11

otherwise labile messages6. The apparent lack of a 5’3’ exonuclease activity in E. coli, places control

12

of stability on recognition of features in mRNA sequence or structure. At the same time, translating

13

ribosomes sterically protect mRNA from otherwise rapid ribonuclease attack7. Ribosome binding to

14

cognate SD sequences also protects mRNA, and mutations that reduce translation initiation efficiency

15

can accelerate mRNA decay8-11. These considerations have importance in the design of predictable

16

and robust gene expression devices, in particular those for manufacturing heterologous proteins. One

17

of the obvious consequences of the gene flow organization in bacteria is that the same levels of protein

18

making could be theoretically brought about by either high rates of transcription of an unstable mRNA

19

or low production of a very stable transcript2. While the first scenario allows rapid adaptation to shifts in

20

environmental conditions, it is also far more costly to the cell’s economy than the second: control of

21

stability provides a means of globally regulate RNA expression and turnover with high specificity and

22

economy12.

23 24

In this work, we have explored the manipulation of mRNA stability as an approach to optimize

25

heterologous gene expression devices. In particular, we revisit the role of the mRNA 5’-UTR as a way

26

to increase protein production, through the use of mRNA stabilizing elements. To this end, we

27

document below the effect of inserting a suite of stabilizer sequences in the 5’-UTR of an mRNA

28

encoding a superfolder GFP (sfGFP) reporter assembled in a low copy plasmid vector. These were

29

then tested and thorough parameterized, and the outcome inspected in single cells and complete

30

populations. As shown below, analysis of the half-lives of the different constructs allowed a direct

31

correlation between transcript stability and protein expression. This is the first detailed study about



Page 4 of 29

4 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

sfGFP mRNA stability, and will be certainly valuable for the scientific community given its broad use as

2

a reporter in transcriptional and translational fusions. Once integrated in the Standard European Vector

3

Architecture (SEVA), the set of secondary structures described herein become useful genetic cargoes

4

for optimizing heterologous protein expression with a reduced physiological cost to the cell as it could

5

be then incorporated into different expression systems at users’ will.

6 7

Results and Discussion

8 9

Benchmarking an mRNA stability parameterization system. Figure 1A sketches the minimum

10

genetic device for determining the steady state levels of any translatable mRNA. The components

11

include [i] the promoter (i.e. the binding site of RNAP at the -10/-35 motifs), [ii] the 5'-untranslated

12

region (5'-UTR) encompassing the ribosome binding site (RBS) along with any possible

13

upstream/downstream sequences and [iii] the protein reading frame, generally starting with an ATG

14

codon located at 5-7 nts downstream of the proper RBS. The 5'-UTR might include just the RBS

15

accompanied by either a short 5'-leader or a longer sequence capable of adopting secondary structures

16

that may have an effect on overall transcript stability by either promoting or inhibiting degradation at the

17

5'-end. On this background, we set out to fix a reliable test system in which the effect of the mRNA-

18

stabilizing sequences which are the subject of this work could be accurately parameterized. To this end

19

we chose plasmid pSEVA121 from the Standard European Vector Architecture (SEVA) database13, as

20

the frame for assembling all different constructs (Figure 1B). The pSEVA121 plasmid grants a low copy

21

number (4-7 copies due to a RK2 replication origin)14 and stability, making it a suitable choice for the

22

required experimental workflow15,16. In addition, the SEVA standard places transcriptional terminators

23

upstream and downstream of the default cloning cargo. The second fixed component of the test system

24

is the reporter adopted as a proxy of any Gene of Interest (GOI). In our case, we chose the superfolder

25

variant of the green fluorescent protein (sfGFP) owing to its high signal intensity and increased folding

26

efficiency17. As indicated in Figure 1B, the standardized cargo for the measurements reported in this

27

work consists of an array of functional parts that starts downstream of a T1 terminator and is followed by

28

a constitutive promoter (see below), after which the 5'-UTRs under inspection are placed. Then, a

29

default,

30

http://parts.igem.org/Part:BBa_B0034:Design) is added to provide an RBS for the sfGFP, which is then

31

completed with the standardized termination sequence B0015 (http://parts.igem.org/Part:BBa_B0015)

well-characterized

Shine-Dalgarno


sequence

(B0034,

Page 5 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5

1

and an additional vector-borne terminator (T0). This design altogether isolates the functional block of

2

each plasmid construct and ensures that the only source of variation in sfGFP readout and mRNA

3 4

stability stems from the variable 5'-UTR.

5 6 7 8 9 10 11 12 13 14 15 16 17

Figure 1. Organization of plasmid constructs. (A) Functional block of the reporter plasmids. The functional segment includes a promoter, a 5'-UTR which might include the hairpin loops and inhibit degradation by RNases, a Shine-Dalgarno (SD) sequence that acts as a ribosomal binding site (RBS) and a gene of interest, by default the sfGFP. Activity stemming from such plasmid insert can be monitored through fluorescence emission of the corresponding cells by fluorimetry or cell cytometry and quantification of mRNA stability with a Northern blot (an example of a plate with visible versus blue light and a RNA decay experiment are sketched). (B) The functional elements of the transcript stability reporter system. Constructs are assembled in the pSEVA121 backbone vector bearing an ampicillin marker (AmpR), the RK2 origin of replication, the terminators T1 and T0 and the origin of transfer oriT. All constructs have the organization shown in the blown-up module on top of the vector, including the promoter (PRM), the variable 5’-UTR region, the RBS (B0034), the reporter gene (sfGFP) and the transcriptional terminator (B0015).

18



6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

Figure 2 sets the reference conditions for the ensuing experiments. The genetic frame of the constructs

2

assembled in pSEVA121 (Figure 2A) is identical in all cases. For the negative control (zero baseline: no

3

mRNA production) we constructed plasmid pSP1 in which the cargo lacks both the promoter and any

4

inserted UTR, although it does carry a translatable reporter gene (Figure 2B). For the positive control

5

the PRM promoter was added to plasmid pSP1 resulting in pSP2, which carries construct 2 (PRMRBS-

6

sfGFP; Figure 2C). PRM sequence, that originates in phage λ, differs 4 nucleotide positions out of 12

7

from the consensus σ70 promoter, including changes in the -35 region that make its activity to remain

8

low and constant in virtually all physiological conditions18. However, construct 2 of pSP2 still lacks any

9

5’UTR and thus it represents the default activity of the constructs in the absence of any mRNA

10

stabilizing sequence.

11 12

For setting the parameters of reference, plasmids pSP1 and pSP2 were transformed into E. coli

13

MG1655 cells and grown in M9 medium supplemented with 0.4% (w/v) glycerol as carbon source and

14

0.2% (w/v) casamino acids, to early exponential phase (OD600 = 0.5). At that point, samples were taken

15

and subject to [i] quantitative fluorometry (Figure 2D), [ii] cell cytometry (Figure 2E) and [iii] treated with

16

rifampicin + nalidixic acid, RNA samples extracted at time intervals and submitted to Northern blot

17

analysis for quantitative determination of sfGFP’s mRNA stability (Figure 2F). The data associated to

18

such reference conditions are shown in Figure 2 (bottom). While E. coli MG1655 (pSP1) gave no

19

detectable fluorescence signal, expression of sfGFP of E. coli MG1655 (pSP2) was noticeable to the

20

naked eye (Figure 2D). Cytometry of single cells indicated a virtually complete mono-modal expression

21

of the reporter (Figure 2E). This confirmed the stability of the plasmid and the fundamentally even

22

expression of the PRM promoter in single cells. The merged fluorescence of this strain under the

23

conditions indicated is taken as the quantitative value of reporter output at the population level. Finally,

24

using a riboprobe specific for sfGFP gene, the mRNA of the reporter could be detected in Northern

25

blots as a single transcript, with a half-life estimated ~ 3.1 minutes (Figure 2F).

26 27 28 29


Page 6 of 29

Page 7 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

Figure 2. Setting a parameterization system for mRNA stability. (A) Modular organization of the reference constructs with all functional segments. (B) Control construct 1 assembled in plasmid pSP1 includes a sfGFP reporter gene, preceded by the default RBS B0034 and followed by the transcriptional terminator B0015—but no promoter. (C) Control construct 2 of pSP2 includes a constitutive PRM promoter upstream of the same sequence elements, but no secondary structure element inserted at the 5'-UTR. (D) Fluorescence of E. coli MG1655 strains bearing each of the two plasmid constructs pSP1 (negative control) and pSP2 (positive control), grown overnight at 37ºC in M9 agar medium (E) Single cell analysis of E. coli MG1655 transformants harboring each of the two different control constructs as indicated. Cells grown overnight in M9 medium were diluted to an OD600 of 0.1 in PBS 1x and analyzed by flow cytometry. For each assay, 80,000 cells were analyzed, the peak height indicating the normalized cell count in each case. (F) Northern blot analysis of the stability of the sfGFP transcript. RNA was extracted from bacteria grown in M9 medium at 37 °C, till OD600 0.5. At this time, a mixture of rifampicin and nalidixic acid was added to the cultures and samples were taken at the indicated times. Total RNA was extracted and 20 µg of RNA (each lane) was separated in a 1.5% (w/v) agarose MOPS/formaldehyde gel. The RNA was transferred to a Hybond-N+ membrane and hybridized with a sfGFP riboprobe. The band corresponding to the full-length transcript was quantified and plotted versus time of extraction (in minutes) to calculate the half-life of the mRNA (further details on Methods section). As an internal control, the membrane was stripped and then probed for 16S rRNA as loading control using a radioactive antisense oligonucleotide. A representative membrane is shown. The half-life value indicated corresponds to the average of different Northern blot experiments with RNAs from at least two independent extractions.

24



8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

Appraisal of mRNA stability determinants for heterologous gene expression. On the baseline

2

expression of sfGFP produced by construct 2 (Figure 2), we wondered whether well-documented,

3

naturally occurring 5'-UTRs found in other E. coli genes could be repurposed as stand-alone transcript

4

stability determinants. One conspicuous case of long-lived mRNA is that of the abundant outer

5

membrane protein OmpA, which can be traced to a long 5’-UTR (133 nt) that precedes the structural

6

gene sequence (Supporting Figure S1). Such untranslated sequence acquires conformations that

7

protects the transcript from endoribonuclease attack8,19,20, thereby prolonging the lifetime of the native

8

message—and others to which it was fused6. The region starts with an imperfect stem-loop structure

9

(designated hp1) that begins 2-4 nts from the 5’-terminus of ompA transcript21 tailed by a short single-

10

stranded stretch (ss1), which is followed by a second, shorter stem-loop (hp2). The segment between

11

the end of hp2 and the start ATG codon of the structural ompA gene involves a longer single-stranded

12

RNA sequence called ss2. This A/U-rich segment embodies an example of translational enhancers i.e.

13

standby sites for small ribosomal subunits in the vicinity of the SD and start codon22, which increase the

14

local concentration of the initiation complexes23. To various degrees, each of these sequences seems

15

to play a role in the final performance of the corresponding mRNA to express the gene at stake.

16

However, the rule that emerged from the studies of J. Belasco and co-workers21 is that having a leading

17

5'-end stem-loop with sufficient thermal stability (∆G folding)8 — but regardless of the specific

18

sequence— followed by the ss2 sequence, endowed the same durability in vivo to the mRNA as the

19

naturally occurring UTR.

20 21

To test whether these observations could be translated into useful transcript-stabilizing parts of general

22

application we built plasmids pSP2a-pSP2b (Table 2; Figure 3A). Downstream of the default PRM

23

promoter, the functional block of the first of the series (pSP2a) has a synthetic stem-loop of 32 nts that

24

we have termed sl1 with a predicted thermal stability of ~-33 kcal/mol8 and is equivalent to the hairpin

25

structure designated in21 as hp* (Supporting Figure S2 and S3). As shown in Figure 3, when cells

26

carrying this construct were inspected for emission of fluorescence, the signal was in fact significantly

27

lower than the control cells with pSP2 (fluorescence values of Figure 3C are represented as fold-

28

change relative to the signal of reference construct 2). The next plasmid (pSP2b) was similar to pSP2a,

29

but instead of carrying a synthetic hairpin loop, bore the original, imperfect stem-loop that leads the E.

30

coli's UTR of ompA mRNA (hp1; Supporting Figure S1), which was renamed in our context sl2

31

(Supporting Figure S3). As evidenced from the data of Figure 3, the new UTR did not change the state


Page 8 of 29

Page 9 of 29


9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

of affairs and the fluorescence emitted by cells transformed with pSP2b was well below the control

2

bacteria with pSP2. In order to compare the changes in signal output observed at a population level

3

(Figure 3B and 3C) with the behaviour of single cells bearing the different plasmids, the same strains

4

were passed through a flow cytometer set for detection of fluorescent green emission—so that

5

uniformity of heterologous gene expression, noise and intensity of the sfGFP signal could be rigorously

6

quantified. The results shown in Figure 4A indicate that changes in population-wide fluorescence in

7

each of the constructs revealed in a fluorimeter (Figure 3B and 3C) have a virtually perfect match with

8

those of cell cytometry (Figure 4A), thus verifying the fluorimetric data of Figure 3.

9 10

These results with constructs born by pSP2a and pSP2b were unexpected, as both stem-loops sl1 and

11

sl2 have been reported to increase stability of transcripts led by the corresponding UTRs21,24 and thus

12

predicted to result in increased GFP readout—not the contrary. To clarify this, we measured sfGFP

13

mRNA half-lives in each of the strains under examination. The results of Figure 4B show that indeed,

14

addition of sl1 and sl2 increased very significantly stability of the mRNAs attached to them (from ~ 3

15

min to ~ 5 min and ~ 6 min, respectively). But then how come that such extended half-lives resulted in

16

less GFP signal, not the contrary? Inspection of the sequences between the transcription start and the

17

leading structural ATG of the reporter in construct 2 (pSP2, control), 2a (pSP2a, sl1) and 2b (pSP2b,

18

sl2) indicated that there was little space between the end of the predicted stem-loop structure and the

19

SD region. This could have prevented an efficient loading of ribosomes to the translation start section of

20

the mRNA. To test this hypothesis, the same sl1 and sl2 structures were added in plasmids pSP2c and

21

pSP2d with a downstream 5'-CGUAUUUUGGAUGA-3' motif. As shown in Supporting Figure S1 this

22

sequence is part of the single-stranded 30 nts segment of the ompA's UTR ss2 located between hp2

23

and the first structural ATG (see above)21. In plasmids pSP2c and pSP2d, the original ss2 sequence

24

was shortened to only 14 nts (and renamed sse: single-stranded element) in order to respect in its

25

entirety, the default heterologous RBS (B0034) engineered upstream of the first ATG of the sfGFP

26

gene (Figures S2 and S3). When cells with plasmid pSP2c (sl1•sse; construct 2c) were inspected for

27

fluorescent output, a significant recovery of signal, in respect to the equivalent but sse-less counterpart,

28

could be easily detected with the naked eye in culture plates (Figure 3B), which was quantified through

29

total fluorescence measurement. Finally, when the sse motif was added to sl2 in plasmid pSP2d

30

(sl2•sse, construct 2d; Fig, 3A), GFP readout was 4-fold higher than the control without any inserted


ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

10

1

UTR (plasmid pSP2; construct 2) and 8-fold stronger than the equivalent construct without sse (plasmid

2 3

pSP2b and construct 2b, Figure 3).

4 5 6 7 8 9 10 11 12 13 14 15 16 17

Figure 3. Modulation of reporter expression with different motifs recruited from the ompA 5'UTR. (A) Functional elements present in each construct. Segments include the upstream PRM promoter, stem-loops sl1 and sl2, the default ribosome binding site (SD, B0034), the single-stranded element (sse) element and the sfGFP gene as indicated for each case. The code for the constructs numbers is designated to the left and the corresponding plasmid, to the right. (B and C) Fluorescence emission of E. coli MG1655 transformed with plasmids pSP2-pSP2d (and pSP1 control) and thus expressing the constructs indicated on (A). (B) The E. coli strains were platted on ampicillin M9 agar medium, in a 24well plate, and grown overnight at 37ºC. Plates were directly photographed, either under visible light mode or fluorescence mode (blue) (C) Total fluorescence of strains grown till early exponential phase (OD600 ~0.5) in M9 liquid medium was measured in a FLUOstar OPTIMA machine (BMG Labtech). Fluorescence values in arbitrary units were corrected to the values of the negative control construct 1 (from pSP1 plasmid) and represented as fold change in reference to the basal fluorescence of the control construct 2 (borne by pSP2).

18


Page 10 of 29

Page 11 of 29


11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

The same samples with pSP2c and pSP2d were taken to cell cytometry, with the results shown in

2

Figure 4A, which match well the measures with the fluorometer (Figure 3). To determine whether the

3

positive effect of adding the sse motif to constructs 2c (pSP2c) and 2d (pSP2d) was the result of

4

increased mRNA stability, improved translation or both, we measured the corresponding transcripts

5

half-lives with the same method as before. The results of Figure 4B suggested a different scenario for

6

each of the comparisons. Addition of sse to sl1 (construct 2c, pSP2c) kept mRNA stability (4.8 + 05

7

min) virtually identical to the sse-less counterpart (construct 2a, pSP2a: 4.9 + 07 min). In this case, the

8

higher GFP readout can be attributed to a better translation efficiency—perhaps by simply allowing an

9

improved entry of ribosomes to the SD regions. The situation turned out quite differently when the effect

10

of the UTR with sl2•sse on mRNA stability of construct 2d (pSP2d) was measured. In this case (Figure

11

4B), the transcript half-life doubled from 5.9 + 06 min (construct 2b, pSP2b) to the 12.9 + 1.5 min of the

12

sl2•sse variant. Why did the addition of sse increased stability of mRNA when combined with sl2 but not

13

when added to sl1? In the natural context of ompA, the ss2 region (Supporting Figure S1) from which

14

the sse sequence is derived is reported to promote stabilization not by increasing translation efficiency

15

but by acting as a sort of standby site for binding of the 30S subunit in the vicinity of the RBS— and

16

wait for formation of a productive SD:aSD interaction. Depending on the specific setting, the occurrence

17

of A/U rich motifs in segments like sse can contribute also to maintain an unstructured translation

18

initiation region, thereby facilitating ribosome binding22,25. Differences in mRNA stability and GFP

19

readout among the different constructs shown in Figure 3 and Figure 4 can thus be explained in terms

20

of context-dependent interplay between 5'-leading hairpin loops with intrinsic life-prolonging effect, the

21

availability of SD motif to the translation machinery and the protective effect of ribosomal subunits

22

bound to A/U-rich sequences right upstream of the initiation site. The ensuing question is whether this

23

information can be translated into useful biological parts for engineering enhanced mRNA stability or

24

the outcome is bound to be unavoidably context-dependent and thus impractical for designing

25

heterologous expression devices.

26 27

The effect of synthetic stem-loops and adjacent single stranded sequences on mRNA decay.

28

The (limited number of) cases inspected above on constructs that altered transcript decay suggested

29

that [i] having a leading stem-loop structure right after transcription initiation, [ii] some space between

30

the end of the hairpin loop and the RBS of the structural gene, and [iii] short single stranded A/U



12

1

segment in between all contributed to linearly translate a longer mRNA lifespan to a higher level of

2

reporter gene expression.

3 4

5 6 7 8 9 10 11 12 13 14 15

Figure 4. Characterization of heterologous gene expression ruled by different 5'-UTR segments. (A) Single cell analysis of E. coli MG1655 bearing plasmids pSP2-pSP2d. Cells were grown overnight in M9 casamino acids/glycerol, diluted to an OD600 of 0.1 in filtered PBS 1x and 80,000 cells analyzed by flow cytometry as indicated in Methods. Construct 1 (pSP1; Figure 2) was used as negative control. The code number for the constructs is marked to the left and the corresponding plasmid, to the right. (B) Northern blot analysis of sfGFP transcript stability. Cells were grown, and RNA extracted and processed as specified in Figure 2 (further details in Methods section). The code for the constructs and the corresponding plasmids is indicated on top of the Northern blots. Half-life values are indicated in the bottom of the picture.

16


Page 12 of 29

Page 13 of 29


13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

To see whether this rule could hold in an entirely different context, we resorted to two of the synthetic

2

hairpins (pHP4 and pHP17, Supporting Figure S4) reported by26 to deliver an mRNA half-life of 8.3 min

3

(moderate) and 19.8 min (very high) respectively. Interestingly, these two motifs have a very similar ∆G

4

folding (~ -16 kcal/mol26) and their paired stems and 3’-single-stranded extensions are identical—their

5

only difference being in the size and sequence of their non-paired loops. At the same time, their

6

nucleotide sequences are entirely different from the ones tested from ompA (sl1 and sl2). Furthermore,

7

as in the case off sl1 and sl2 (Figure 3A), the corresponding hairpins are followed by a short (12 nts)

8

A/U extension that allows some room before the RBS and may also facilitate ribosome docking

9

(Supporting Figure S3 and S4).

10 11

In order to examine the effect of these synthetic structures in mRNA stability and eventual reporter

12

expression in our test system and compare them with those derived from the ompA UTR, the

13

corresponding sequences were inserted in test plasmid pSP2, originating derivatives pSP2e (construct

14

2e) and pSP2f (construct 2f) as shown in Figure 5. The cognate secondary structures in the thereby

15

generated transcripts were named sl3 and sl4, respectively (Figure 5A and Supporting Figures S2 and

16

S3). E. coli cells transformed with pSP2e and pSP2f were passed through the same tests of merged

17

fluorescence levels, population behaviour and measurement of the half-lives of the corresponding

18

mRNAs. As shown in Figure 5B, insertion of both sl3 and sl4 at the 5’-UTR of constructs 2e (pSP2e)

19

and 2f (pSP2f) immediately resulted in a conspicuous rise of GFP expression that could be detected

20

with the naked eye. Its quantification in the fluorimeter revealed an increase of reported output of 2-3

21

fold in respect to the UTR-less control of pSP2. These data matched well the cytometry data shown in

22

Figure 6A and the mRNA stability results: transcript half-lives went from ~ 3 min of the UTR-less

23

construct 2 (pSP2; Figure 4B) to ~7.5 min of constructs 2e (pSP2e) and 2f (pSP2f) shown in Figure 6.

24

In these cases we could indeed match rigorously the measured mRNA stability with the readout of the

25

reporter gene—although we could not find the very long-lived mRNA attributed to sl4 (same as pHP17;

26

Supporting Figure S3 and S4).

27 28 29 30 31 32



14

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Figure 5. Control of reporter gene expression with synthetic 5'-UTRs. (A) Functional elements present in each construct: the PRM promoter, stem-loops sl3 and sl4, the standardized SD sequence (B0034), the sse element and the sfGFP gene as indicated for each case. Constructs code numbers are shown to the left and plasmids to the right. (B and C) Fluorescence emission of E. coli MG1655 transformed with plasmids pSP2e-pSP2h expressing the constructs indicated on panel (A) (and controls pSP1 and pSP2). (B) The E. coli strains were platted on ampicillin M9 agar medium, in a 24well plate, and grown overnight at 37ºC. Plates were directly photographed either under visible light mode or fluorescence mode in a FUJI TLA-5100 scanner to compare bacterial growth and color intensity/fluorescence, respectively (C) Total fluorescence of strains grown till early exponential phase (OD600 ~0.5) in M9 liquid medium was measured in a FLUOstar OPTIMA machine (BMG Labtech). Fluorescence values in arbitrary units were corrected to the values of the negative control construct 1 (from pSP1 plasmid) and represented as fold change in reference to the basal fluorescence of the control construct 2 (borne by pSP2).

17

We next explored whether a further A/U rich extension of the non-paired UTR RNA right upstream of

18

the SD sequence could add stability or ribosome accessibility resulting in further changes in reporter

19

expression (as was the case with the ompA-derived stem-loops). For this we just added the 14 nts sse


Page 14 of 29

Page 15 of 29


15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

element right after the 3’-ends of sl3 and sl4, resulting in constructs 2g (sl3•sse; pSP2g) and 2h

2

(sl4•sse; pSP2h), the sequences and the predicted structures of which are shown in Supporting Figure

3

S3. Once more, cells carrying pSP2g and pSP2h were passed through the standardized tests of GFP

4

levels, cell cytometry and measurement of mRNA half-lives of each construct. The results indicated that

5

the relatively modest increase in the stability of the sse-added constructs (25-30%; Figure 6) was

6

converted in either case into rises in GFP levels, both in the cultures (Figure 5C) and in cell cytometry.

7

mRNA stability data in the constructs shown in Figure 5 and 6 could therefore be fairly paired with those

8

of the corresponding reporter outputs. This was unlike the situation of the ompA-derived parts (Figs. 3

9

and 4) whose composition in plasmids pSP2a-pSP2d did not deliver the expected match between

10

mRNA stability and gene expression levels. Also, when compared to the set of constructs derived from

11

the ompA UTR (Figure 3), the correlation was hardly quantitative. For instance, the mRNA half-life

12

brought about by construct 2d (pSP2d; Figure 4B) is ~ 13 min and its fold-expression in respect to the

13

pSP2-containing control is ~ 4-fold (Figure 3C). In contrast, the shorter-lived mRNA of construct 2h (~ 9

14

min; pSP2h of Figure 6B) delivered a >5-fold expression level. In view of these discrepancies, what

15

lessons can we draw from comparing the ompA-derived series of UTRs vs. the synthetic collection of

16

mRNA stabilizing motifs?

17 18

Physiological burden of altered mRNA stability. Transcript decay is generally considered the result

19

of intrinsic qualities of the RNA sequence that makes it amenable to a suite of RNases4. Yet, having

20

more or less durable mRNA has also an impact on the general physiology of the cell in terms of

21

resources for the gene expression flow. Given the same promoter strength and ribosome-RNA affinity

22

to the SD sequence, a longer transcript lifetime is expected to recruit more ribosomes to the same

23

messenger, a circumstance that can be exacerbated if the UTR contains extra A/U rich-translational

24

enhancers. Likewise, the call for more ribosomes may also lessen their availability for other growth

25

functions and eventually retroact on the expression device as well27,28. But note that —as suggested by

26

the results of Figure 3 and 4— ribosome recruitment depends also on the specific 5’ sequences and the

27

resulting secondary structures and distances, so longer mRNA duration does not automatically render a

28

higher translation rate. Given the considerable dispersion in the stability values of mRNAs vs reporter

29

readout of constructs borne by plasmids pSP2-pSP2h we inspected the growth rates of the

30

corresponding transformants in E. coli cultured in M9/casamino acids/glycerol medium. As shown in



16

1

Figure S5, the constructs didn’t affect significantly the cell growth, all having the same growth profile

2 3

and reaching the same OD600 (and therefore roughly the same biomass) at terminus by 12 hours.

4 5 6 7 8 9 10 11 12 13 14

Figure 6. Heterologous gene expression and mRNA half-lives ruled by synthetic 5'-UTR segments. (A) Single cell analysis of E. coli MG1655 bearing plasmids pSP2e-pSP2h (along with controls pSP1 and pSP2). Cells of each strain were processed as indicated in the legend to Figure 4. Code numbers for the 5'-UTR constructs and matching plasmids are marked to the left and the right, respectively. (B) Northern blot analysis of sfGFP transcript stability. Cells were grown and RNA extracted and processed as specified in Figure 2 (further details in Methods section). The codes for constructs and plasmids are labeled on the top of the Northern blots. Half-life values are indicated in the bottom of the picture. The controls used in this experiment are the same used on Figure 4.

15 16

Competition for resources in a cell may involve not only ribosomes, but also metabolites that feed the

17

gene expression flow and counteract stress, in particular ATP and NADPH. One way to assign the


Page 16 of 29

Page 17 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


17

1

shares of such competition to various types of cell’s assets is to examine the vulnerability of the device-

2

carrying strains to stressors that deplete bacteria of specific metabolic currencies. Figure 7 and Figure

3

S6 show a semi-quantitative test to inspect the response of E. coli transformed with each of the

4

plasmids pSP1-pSP2h to a panel of 6 typical stressors, including antibiotics, oxidants and membrane

5

stability disruptors. The measures of the corresponding inhibition haloes are shown in Figure 7. Despite

6

the limited quantitative value of the test, the tendency clearly suggests the effect of the expression

7

devices on cells growth shown in Figure S5 was not changed by any of the stressors tested: all

8

constructs brought about the same sensitivity to the chemical insults added to the plates. Taken

9

together, the results point predominantly towards an absence of metabolic currencies that affect growth

10 11

12 13 14 15 16 17 18 19 20 21

rates between the isogenic strains bearing constructs with distinct UTRs.

Figure 7. Vulnerability of construct-bearing strains to metabolic stresses. Quantification of halo diameter. The OD600 of overnight cultures grown on M9 minimal liquid media supplemented with 0.4% (w/v) glycerol and 0.2% (w/v) casaminoacids was adjusted to 1 in 1 ml of fresh stock. Thus, 100 µl of this suspension was added into 2.9 ml of molten soft 0.7% (w/v) agar, maintained at 42 ºC and poured onto tempered M9 minimal media agar plates and let it solidify. Then, sterile filter disks were laid onto the surface of plates and soaked with 5 µl of the different stressors (50 µg/ml kanamycin; 30 µg/ml chloramphenicol; 1M diamide; 100 mM paraquat; 30% (v/v) H2O2; 0.5M EDTA). Plates were incubated at 37 ºC for 24h and photographed. The diameter of the halo was measured (cm) and the average with the standard deviation plotted (Experiments were done in duplicate).



18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1 2

A separate physiological issue is the gene expression noise (i.e. phenotypic diversification) that each

3

construct originates in individual cells. Although all cells bearing plasmids pSP2-pSP2h give a

4

fluorescent signal above the background (e.g. control construct 1; pSP1 of Figure 2), in a mono-modal

5

fashion a subpopulation of bacteria that express the reporter gene significantly less than the average is

6

noticeable in virtually all cases, specially in clones with constructs 2d (pSP2d; Figure 4A) and 2h

7

(pSP2h, Figure 6A). Yet, this seems to reflect more a sort of tailing effect than any bimodal or

8

multimodal expression of the reporter. Moreover, although the overall expression pattern changed

9

among the cells with the different UTRs, the total noise observed in each strain appeared to moderately

10

increase with enhanced sfGFP expression. This became, again, more noticeable in samples 2d

11

(pSP2d; Figure 4A) and 2h (pSP2h, Figure 6A), as plausibly noise reflects the titration of the cell's

12

translation machinery owing to a higher demand of ribosomes to the corresponding, longer-lived RNAs.

13

Theoretical and experimental data indicate that a high transcription level along with low translation

14

decreases noise as compared to efficient translation and low transcription levels23.

15 16

Conclusion: The choice of parts for manipulating mRNA stability. Understanding the rules of

17

mRNA decay in bacteria is an issue of considerable conceptual and practical relevance that has been

18

the subject of a large body in literature. The prevailing view is that virtually all important determinants of

19

transcript stability reside at the UTR of the mRNA that precedes the structural gene in question. In

20

particular, the presence of hairpin loops at the very 5’-end of the transcript acts to block the binding of

21

ribonucleases and somehow shields mRNA from decay. This has turned out to be true in all constructs

22

tested in this work, whether the loops were completely synthetic (sl1, sl3, sl4) or drafted from a naturally

23

occurring long lived mRNA (sl2 from ompA). However, there is not an evident rule that links the

24

sequence of the secondary structures or the folding energy of each of the hairpin loops to specific

25

decay parameters8,24. This may be due to the action of RNase III, an enzyme that cleaves double-

26

stranded mRNA in a fashion that depends on both structure and sequence, making every case a

27

different one. However, besides the leading hairpin loop, there is a considerable effect of the sequence

28

between the end of the stem and the SD site for translation initiation. If there is little or no room, then

29

the ribosome might be unable to bind the RBS. But if there is a too long single-stranded segment

30

between the two elements, then the mRNA might become amenable to RNase E attack. On the other

31

hand, if the intervening single-stranded sequence is A/U rich, it can also act as a translational enhancer


Page 18 of 29

Page 19 of 29


19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

by docking standby ribosomes in the proximity of the RBS, so that a high occupancy of the segment

2

could prevent ribonucleases from binding and cleaving. In the examples addressed in this work,

3

introduction of an AU rich sse region increased to various degrees (and possibly through different

4

mechanisms) reporter expression levels. In the case of the sl2•sse (Figure 4B) and sl3•sse/sl4•sse

5

elements (Figure 6) there was a genuine rise of mRNA stability, perhaps due to an increase of

6

ribosome binding to a high degree of occupancy of the 5’-UTR region by bound ribosomes22,25. Yet,

7

note that other factors (RNase G, RppH, PNPase/exonuclease) are likely to influence also the outcome

8

of transcript durability and eventual gene expression.

9 10

In sum, there are still too many variables for making robust predictions on whether given 5'-UTRs can

11

promote mRNA stability within pre-specified parameters. However, we argue that the motifs inserted

12

e.g. in constructs 2d (pPS2d, Figure 3) and 2h (pSP2h, Figure 5) are instrumental to enhance

13

heterologous gene expression within one order of magnitude due to increase mRNA stability without

14

modifying transcription rates. Although we have not inspected a large number of combinations of

15

promoters and RBSs with the 5-UTRs described here, the few instances when we did (Supporting Fig

16

S6 and S7) accredit a fair maintenance of the effects on eventual gene expression caused by these

17

mRNA stabilizing motifs. We thus propose incorporation of these two functional parts (sl2•sse and

18

sl4•sse) as components of expression cargoes of the SEVA collection13 aimed at deploying phenotypes

19

of interest but based on a less physiologically costly expression device27,29.

20 21 22

Methods

23 24

Bacterial strains and plasmids. The biological materials used in this work are listed in Table 1 and

25

Table 2, respectively. E. coli DH5α was used as the default strain for transformation and plasmid

26

propagation during all cloning procedures. The very low copy number, ampicillin (AmpR) vector

27

pSEVA12113 was used in all experiments as the genetic frame for all constructs (Figure 1). The default

28

ribosome binding site (RBS) was the one coded B0034 in the repository of biological parts

29

(http://parts.igem.org/Part:BBa_B0034:Design). Similarly, the transcriptional terminator placed at the

30

end of the functional cargo of each plasmid was retrieved from the parts' repository as well (B0015;

31

http://parts.igem.org/Part:BBa_B0015:Design). For the reporter system, the superfolder GFP (sfGFP17)



20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

was adopted in all instances. The standardized cargoes built in pSEVA121 had all the organization

2

[Promoter][5’-UTR]•[RBS]•[GOI] [terminator]. Assembly of functional components in the different

3

constructs was done by means of consecutive PCR reactions. The sequences of the corresponding

4

primers are listed in Supporting Table S1. All primers were phosphorylated at the 5’-terminus in order to

5

ease insertion of the resulting PCR products in the receiving plasmids. To obtain construct 2 (pSP2

6

plasmid) we performed several PCR steps, as follows. The sfGFP gene was obtained from the

7

BBa_I746908 plasmid (http://parts.igem.org/Part:BBa_I746908)17 by PCR amplification using a forward

8

primer, svpa2, containing B0034 sequence, and a reverse primer, svpa4, that inserts the SpeI nicking

9

site. The product obtained from the previous primer pair, svpa2/svpa4, was then used for a second

10

PCR round using a forward primer, svpa3, responsible for the insertion of the PRM promoter18 sequence

11

and again the same reverse primer, svpa4. This fragment was digested with SpeI restriction enzyme

12

and used as an insert into the SmaI(blunt end)/SpeI-digested pSEVA121 vector. The resulting plasmid

13

was then used as template in a final PCR step, using a forward primer, svpa5, harboring the B0034

14

sequence, and a reverse primer, svpa6, that together exclude the lambda sequence present in the

15

original PRM promoter sequence, to generate construct 2 (in pSP2 plasmid). As such, construct 2

16

contains the PRM promoter, followed by the RBS and GOI, both constant sequence elements. The

17

plasmid for the promoterless construct 1 (pSP1) was derived from the plasmid of construct 2 by PCR

18

using a forward primer svpa1 that introduces an EcoRI restriction site and a reverse primer svpa6, that

19

together remove the PRM promoter sequence. The product obtained was digested with EcoRI restriction

20

enzyme and ligated with T4 DNA ligase from Thermo Scientific, resulting in construct 1 (pSP1 plasmid).

21

Construct 2c (pSP2c plasmid) was obtained from the same template utilized for construct 2 design but

22

using the primer pair svpa9/svpa10. The resulting product contained the same sequence elements

23

present in construct 2 but it also harbors the synthetic stem-loop sl1 (GAUCGCCCA

24

CCGGCAGCUGCCGGUGGGCGAUC, designated in21 as hp*) in its 5'-UTR, followed by the 11

25

nucleotide sequence named sse (CGUAUUUUGGAUGA), a portion of the segment designated in21 as

26

ss2. Plasmid pSP2 containing construct 2 was amplified with PCR primers svpa7/svpa8,

27

svpa13/svpa14, svpa15/svpa16, svpa17/svpa16, svpa15/svpa18 and svpa17/svpa18. Each of these

28

DNA segments was circularized in order to originate the plasmids corresponding to the constructs 2a

29

(pSP2a), 2d (pSP2d), 2e (pSP2e), 2f (pSP2f), 2g (pSP2g), and 2h (pSP2h), respectively. These

30

constructs contained the sequence elements previously described for 2 but have different secondary

31

structure elements at their 5’-UTR, which were introduced by the sequence of the respective primers,


Page 20 of 29

Page 21 of 29


21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

as follows. Construct 2a: the synthetic stem-loop sl1 (see sequence above). Construct 2c: same as 2a

2

but followed by the sse sequence. Construct 2d: the hp1 stem-loop of OmpA mRNA (sl2:

3

GCCAGGGGUGCUCGGCAUAAGCCGAAGAUAUCGGUAGAGUUAAUAUUGAGCAGAUCCCCCGG)

4

21

5

(ACGTCGACTTATCTCGAGTGAGATATTGTTGACGGTACCGTATTTT) described in26 as pHP4.

6

Construct 2f: the synthetic stem-loop sl4

7

(ACGTCGACTTATCTCGAGACTGCAGTTCAATAGAGATATTGTTGACGGTACCGTATTTT) described

8

in26 as pHP17. Construct 2g: same as 2e but followed by the sse sequence. Construct 2h: same as 2f

9

but followed by the sse sequence.

followed

by

the

sse

sequence.

Construct

2e:

the

synthetic

stem-loop

sl3

10

For assembling construct 2b (pSP2b plasmid), construct 2d was amplified with the primer pair

11

svpa11/svpa12, resulting in a construct harboring only the sl2 sequence at the 5’UTR. After completion,

12

each construct was verified first by colony-PCR and then confirmed by DNA sequencing using the

13

primers svpa26 and svpa27 (see Supporting Table S1). Verified plasmids were then transformed into

14 15

competent E. coli MG1655 cells and the corresponding transformants stored at -80 ºC for further use.

16 17

Table 1. Strains used in this work Strain

Relevant Markers / Genotype

Source/Reference

E. coli DH5α

recA1 endA1 gyrA96 thi-hsdR17 supE44 relA1 ∆lacZYA-arg FU169 f80lacZDM15

New England Biolabs

E. coli MG1655

MG1655 F- λ- rph-1

30

18 19 20



Page 22 of 29

22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1 2

Table 2. Plasmids used in this work

Plasmid

Comments

Origin/marker

Reference 13

pSEVA121

T0/T1 terminators; replication protein/trfA; betalactamase/bla

RK2/AmpR

BBa_I746908

araBAD promoter (pBAD); inducible plasmid expressing SuperFolder GFP Construct 1; promoterless-B0034-sfGFP-B0015 fusion Construct 2; PRM B0034-sfGFP-B0015 fusion

AmpR

17

RK2/AmpR

This study

RK2/AmpR

This study

RK2/AmpR

This study

RK2/AmpR

This study

RK2/AmpR

This study

RK2/AmpR

This study

RK2/AmpR

This study

RK2/AmpR

This study

RK2/AmpR

This study

RK2/AmpR

This study

pSP1 pSP2 pSP2a pSP2b pSP2c pSP2d pSP2e pSP2f pSP2g pSP2h

Construct 2a; PRMsl1-B0034-sfgfp-B0015 fusion Construct 2b; PRMsl2-B0034-sfGFP-B0015 fusion Construct 2c; PRMsl1;sse-B0034-sfGFP B0015 fusion Construct 2d; PRMsl2;sse-B0034-sfGFPB0015 fusion Construct 2e; PRMsl3-B0034-sfGFP-B0015 fusion Construct 2f; PRMsl4-B0034-sfGFP-B0015 fusion Construct 2g; PRMsl3;sse-B0034-sfGFPB0015 fusion Construct 2h; PRMsl4;sse-B0034-sfGFPB0015 fusion

3 4

Bacterial growth. Luria-Bertani (LB) broth, supplemented with ampicillin (150 µg/mL), was used for

5

pre-inoculation of strains grown overnight and for growth between genetic manipulations, at 37 ºC and

6

220 rpm. A heat-shock procedure was used for transformation of E. coli strains. To obtain growth

7

curves, cell cultures were diluted in M9 medium with 0.2% (w/v) of casamino acids and 0.4% (w/v) of

8

glycerol to an initial OD600 of 0.05. Absorbance of samples from shake-flask cultures in M9 was

9

measured in 96-well plates in a FLUOstar OPTIMA (BMG Labtech) automated reader, in triplicates, in a

10

200 µl volume. Cultures were grown for 24 h at 37 ºC with rapid shacking and repeated measurements

11

were performed at every 30 min. All microplate experiments were repeated at least twice starting from

12

independent overnight cultures.

13 14

Monitoring GFP expression. Background fluorescence of cultures was determined, in all cases,

15

against the control construct 1 previously described (pSP1). To quickly screen for the expression of


Page 23 of 29


23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

superfolder GFP (sfGFP), all the E. coli MG1655 strains with the respective constructs were platted on

2

ampicillin M9 agar medium, in a 24-well plate, and grown overnight at 37 ºC. The plates were then

3

directly photographed either under visible light mode or fluorescence mode in a FUJI TLA-5100

4

scanner in order to compare bacterial growth and color intensity/fluorescence, respectively. Total

5

fluorescence of samples grown in shake-flask cultures in M9 medium till OD600 of 0.5 was measured in

6

96-well plates in a FLUOstar OPTIMA machine (BMG Labtech). Each sample was measured in

7

triplicates with a volume of 200 µl. The excitation wavelength was set to λ = 485nm while fluorescence

8

emission was measured at λ = 520nm, and the gain was set to 1000. Total fluorescence was calculated

9

as described in31 and the results were analyzed with Microsoft Excel 2016 software. Briefly, the

10

absorbance of the cultures was corrected (Absc) for the background absorbance (i.e., the optical

11

density of the wells containing the same volume of growth medium, without bacteria). The fluorescence

12

background value was given by the fluorescence of a strain carrying the control construct 1 (plasmid

13

pSP1) with a promoterless sfGFP reporter gene.

14

The average fluorescence intensity per cell (Afc) was calculated for both the samples and the control

15

(the fluorescence value divided by the respective absorbance value (Absc)). The Afc of the control was

16

then subtracted from the Afc of the sample. The final value was multiplied by the population size (Absc)

17

to obtain the corrected fluorescence intensity of the total sample.

18

To measure GFP output in individual cells (flow cytometry), overnight MG1655 cultures grown in M9

19

were centrifuged, washed and diluted in filtered PBS 1x to an OD600 of 0.1. Single-cell fluorescence was

20

analyzed with a MACSQuantTM VYB cytometer (Miltenyi Biotec, Bergisch Gladbach, Germany). sfGFP

21

was excited at 495 nm, and the fluorescence signal was recovered with a 525(40) BP filter. The data

22

processing was performed using FlowJo v.10.1 software (FlowJo LLC, Ashland, OR, USA).

23 24

RNA extraction, Northern Blot analysis and Half-life determination. Overnight cultures of the

25

strains under study were diluted 1/100 in M9 medium and grown to a cell density of 0.5 at OD600. 10 ml

26

of culture samples were collected and mixed with 1 volume of stop solution (10 mM Tris pH 7.2, 25 mM

27

NaNO3, 5 mM MgCl2, 500 µg/ml chloramphenicol), and harvested by centrifugation (10 min, 6000 g, at

28

4 ºC). For stability experiments, rifampicin (500 µg/ml) and nalidixic acid (20 µg/ml) were added to cells

29

grown in M9 at 37 ºC, at an OD600 of 0.5. Incubation was continued and culture aliquots were withdrawn

30

at the time-points indicated in the respective figures. RNA was isolated using the phenol/chlorophorm

31

extraction method (as previously described32) precipitated in ethanol, resuspended in water, and



24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

quantified on a Nanodrop 1000 machine (NanoDrop Technologies). RNA integrity was checked on an

2

agarose gel. For Northern blot analysis, 20 µg of total RNA was separated under denaturing conditions

3

in a 1.5% (w/v) agarose MOPS/formaldehyde gel. RNA was transferred to Hybond-N+ membranes (GE

4

Healthcare) by capillarity using 20XSSC as transfer buffer. RNA was UV-crosslinked to the membrane

5

immediately after transfer. Membranes were then hybridized in PerfectHyb Buffer (Sigma) at 68°C for

6

riboprobes and 43°C in the case of oligoprobes. After hybridization, membranes were washed

7

according to the method previously described33. Signals were visualized in FUJI TLA-5100 scanner and

8

analyzed using the ImageQuant software (GE Healthcare). The band corresponding to the full-length

9

gfp transcript was quantified, and this value normalized for loading variations with the 16S rRNA

10

control. The concentration of the RNA over time was represented in a semi-logarithmic plot and the

11

slope of a best-fit line determined the value of the rate constant for the mRNA decay (kdecay). The half-

12

life value was then obtained from the equation t1/2 =ln(2)/Kdecay34. Half-life values indicated correspond

13

to the average of several Northern blot experiments with RNAs from at least two independent

14

extractions.

15

Primers for probes’ template amplification are listed in Supporting Table S1. sfGFP riboprobe template

16

was generated by standard PCR with primers svpa23 and svpa24, encompassing 458 nucleotides in

17

the middle of sfGFP gene, and carried out on plasmid DNA BBa_I746908. The in vitro transcription

18

reaction was performed in the presence of an excess of [32P]-α-UTP over unlabelled UTP, using the T7

19

polymerase from Promega (a T7 RNA polymerase promoter sequence was added by the antisense

20

primer). DNA oligonucleotide for 16S rRNA (primer svpa25) detection was labelled with [32P]-γ-ATP

21

using T4 polynucleotide kinase (Fermentas) and used as probe. The riboprobe was purified with a G50

22

column (GE Healthcare) and the oligoprobe with a G25 column (GE Healthcare) to remove

23

unincorporated nucleotides prior to hybridization (see primer used for probes design on Supporting

24

Table S1).

25 26

Supporting Information

27 28

The Supporting Information contains supporting figures S1-S7, supporting methods and results, Table S1 with primer sequences used for plasmid constructs, and respective references.

29 30 31 32

Fig. S1-S4: details on the secondary structure and sequences of the 5’ UTR stabilizing elements; Fig. S5: Growth curve of the MG1655 harboring the different constructs; Fig. S6: Plate sensitivity test for various stressors (corresponding to results of Figure 7 on main manuscript); Fig. S7-S8: results regarding the maintenance of stabilization effects of 5’UTRs with different promoters.

33


Page 24 of 29

Page 25 of 29


25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1 2

Acknowledgements

3

Work at ITQB NOVA was financially supported by Project LISBOA-01-0145-FEDER-007660

4

(Microbiologia Molecular, Estrutural e Celular) funded by FEDER funds through COMPETE2020 -

5

Programa Operacional Competitividade e Internacionalização (POCI) and contract of the European Unit

6

EmPowerPutida (EU-H2020-BIOTEC-2014-2015-6335536). SCV was financed by program IF of

7

“Fundação para a Ciência e a Tecnologia, Portugal” [ref. IF/00217/2015]; PA is recipient of a FCT-PhD

8

fellowship [ref. PD/BD/128034/2016] in frame of the Doctoral Program in Applied and Environmental

9

Microbiology.

10

VdL's work was funded by Projects HELIOS (BIO2015-66960-C3-2-R; MINECO/FEDER) and contracts

11

of the European Union ARISYS (ERC-2012-ADG-322797), EmPowerPutida (EU-H2020-BIOTEC-2014-

12

2015-6335536), MADONNA (H2020-FET-OPEN-RIA-2017-1 (766975) as well as the InGEMICS-CM

13

(B2017/BMD-3691) contract of the Comunidad de Madrid (FSE, FECER).

14 15

Author Contribution

16

SCV, VdL and CMA planned and designed the work; PA, SCV and EMG performed the experiments;

17

CMA supervised the work; PA, SCV and VdL wrote the manuscript; all the authors revised the final

18

version of the manuscript.

19 20 21 22 23 24 25 26



26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50

References: 1. 2.

3.

4.

5. 6.

7. 8.

9. 10. 11.

12. 13.

14. 15. 16.

17. 18.

Miao, Z., and Westhof, E. (2017) RNA Structure: Advances and Assessment of 3D Structure Prediction, Annu Rev Biophys 46, 483-503. Silva, I. J., Saramago, M., Dressaire, C., Domingues, S., Viegas, S. C., and Arraiano, C. M. (2011) Importance and key events of prokaryotic RNA decay: the ultimate fate of an RNA molecule, Wiley Interdiscip Rev RNA 2, 818-836. Duval, M., Simonetti, A., Caldelari, I., and Marzi, S. (2015) Multiple ways to regulate translation initiation in bacteria: Mechanisms, regulatory circuits, dynamics, Biochimie 114, 18-29. Arraiano, C. M., Andrade, J. M., Domingues, S., Guinote, I. B., Malecki, M., Matos, R. G., Moreira, R. N., Pobre, V., Reis, F. P., Saramago, M., Silva, I. J., and Viegas, S. C. (2010) The critical role of RNA processing and degradation in the control of gene expression, FEMS Microbiol Rev 34, 883-923. Rauhut, R., and Klug, G. (1999) mRNA degradation in bacteria, FEMS Microbiol Rev 23, 353370. Belasco, J. G., Nilsson, G., von Gabain, A., and Cohen, S. N. (1986) The stability of E. coli gene transcripts is dependent on determinants localized to specific mRNA segments, Cell 46, 245251. Deana, A., and Belasco, J. G. (2005) Lost in translation: the influence of ribosomes on bacterial mRNA decay, Genes Dev 19, 2526-2533. Arnold, T. E., Yu, J., and Belasco, J. G. (1998) mRNA stabilization by the ompA 5' untranslated region: two protective elements hinder distinct pathways for mRNA degradation, RNA 4, 319-330. Iost, I., and Dreyfus, M. (1995) The stability of Escherichia coli lacZ mRNA depends upon the simultaneity of its synthesis and translation, EMBO J 14, 3252-3261. Moll, I., Grill, S., Gualerzi, C. O., and Blasi, U. (2002) Leaderless mRNAs in bacteria: surprises in ribosomal recruitment and translational control, Mol Microbiol 43, 239-246. Wagner, L. A., Gesteland, R. F., Dayhuff, T. J., and Weiss, R. B. (1994) An efficient ShineDalgarno sequence but not translation is necessary for lacZ mRNA stability in Escherichia coli, J Bacteriol 176, 1683-1688. Russell, J. B. (2007) The energy spilling reactions of bacteria and other organisms, J Mol Microbiol Biotechnol 13, 1-11. Silva-Rocha, R., Martinez-Garcia, E., Calles, B., Chavarria, M., Arce-Rodriguez, A., de Las Heras, A., Paez-Espino, A. D., Durante-Rodriguez, G., Kim, J., Nikel, P. I., Platero, R., and de Lorenzo, V. (2013) The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes, Nucleic Acids Res 41, D666-675. Kues, U., and Stahl, U. (1989) Replication of plasmids in gram-negative bacteria, Microbiol Rev 53, 491-516. Meyer, R., Figurski, D., and Helinski, D. R. (1975) Molecular vehicle properties of the broad host range plasmid RK2, Science 190, 1226-1228. Thomas, C. M., Cross, M. A., Hussain, A. A., and Smith, C. A. (1984) Analysis of copy number control elements in the region of the vegetative replication origin of the broad host range plasmid RK2, EMBO J 3, 57-63. Pedelacq, J. D., Cabantous, S., Tran, T., Terwilliger, T. C., and Waldo, G. S. (2006) Engineering and characterization of a superfolder green fluorescent protein, Nat Biotechnol 24, 79-88. Berthoumieux, S., de Jong, H., Baptist, G., Pinel, C., Ranquet, C., Ropers, D., and Geiselmann, J. (2013) Shared control of gene expression in bacteria by transcription factors and global physiology of the cell, Mol Syst Biol 9, 634.


Page 26 of 29

Page 27 of 29


27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51

19. 20.

21. 22.

23. 24.

25. 26. 27. 28.

29.

30. 31.

32.

33.

34.

Mackie, G. A. (2013) RNase E: at the interface of bacterial RNA processing and decay, Nat Rev Microbiol 11, 45-57. Vytvytska, O., Moll, I., Kaberdin, V. R., von Gabain, A., and Blasi, U. (2000) Hfq (HF1) stimulates ompA mRNA decay by interfering with ribosome binding, Genes Dev 14, 11091118. Emory, S. A., Bouvet, P., and Belasco, J. G. (1992) A 5'-terminal stem-loop structure can stabilize mRNA in Escherichia coli, Genes Dev 6, 135-148. Qing, G., Xia, B., and Inouye, M. (2003) Enhancement of translation initiation by A/T-rich sequences downstream of the initiation codon in Escherichia coli, J Mol Microbiol Biotechnol 6, 133-144. Vimberg, V., Tats, A., Remm, M., and Tenson, T. (2007) Translation initiation region sequence preferences in Escherichia coli, BMC Mol Biol 8, 100. Emory, S. A., and Belasco, J. G. (1990) The ompA 5' untranslated RNA segment functions in Escherichia coli as a growth-rate-regulated mRNA stabilizer whose activity is unrelated to translational efficiency, J Bacteriol 172, 4472-4481. Dreyfus, M. (1988) What constitutes the signal for the initiation of protein synthesis on Escherichia coli mRNAs?, J Mol Biol 204, 79-94. Carrier, T. A., and Keasling, J. D. (1999) Library of synthetic 5' secondary structures to manipulate mRNA stability in Escherichia coli, Biotechnol Prog 15, 58-64. Borkowski, O., Ceroni, F., Stan, G. B., and Ellis, T. (2016) Overloaded and stressed: whole-cell considerations for bacterial synthetic biology, Curr Opin Microbiol 33, 123-130. Komarova, A. V., Tchufistova, L. S., Dreyfus, M., and Boni, I. V. (2005) AU-rich sequences within 5' untranslated leaders enhance translation and stabilize mRNA in Escherichia coli, J Bacteriol 187, 1344-1349. Gyorgy, A., Jimenez, J. I., Yazbek, J., Huang, H. H., Chung, H., Weiss, R., and Del Vecchio, D. (2015) Isocost Lines Describe the Cellular Economy of Genetic Circuits, Biophys J 109, 639646. Guyer, M. S., Reed, R. R., Steitz, J. A., and Low, K. B. (1981) Identification of a sex-factoraffinity site in E. coli as gamma delta, Cold Spring Harb Symp Quant Biol 45 Pt 1, 135-140. de Jong, H., Ranquet, C., Ropers, D., Pinel, C., and Geiselmann, J. (2010) Experimental and computational validation of models of fluorescent and luminescent reporter genes in bacteria, BMC Syst Biol 4, 55. Arraiano, C. M., Yancey, S. D., and Kushner, S. R. (1988) Stabilization of discrete mRNA breakdown products in ams pnp rnb multiple mutants of Escherichia coli K-12, J Bacteriol 170, 4625-4633. Viegas, S. C., Pfeiffer, V., Sittka, A., Silva, I. J., Vogel, J., and Arraiano, C. M. (2007) Characterization of the role of ribonucleases in Salmonella small RNA decay, Nucleic Acids Res 35, 7651-7664. Dressaire, C., Picard, F., Redon, E., Loubiere, P., Queinnec, I., Girbal, L., and CocaignBousquet, M. (2013) Role of mRNA stability during bacterial adaptation, PLoS One 8, e59059.



28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1


Page 28 of 29

Page 29 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


29

For Table of Contents Only

1 2 3

Modulating heterologous gene expression with

4

portable mRNA-stabilizing 5’-UTR sequences

5 6 7

Sandra C. Viegas1*¤, Patrícia Apura1*, Esteban Martínez-García2, Víctor de Lorenzo2,¤ and Cecília M.

8

Arraiano1,

9 10 11

1Instituto

12

República, EAN, 2780-157 Oeiras,Portugal.

13

Biotecnologia, CSIC, C/ Darwin, 3 (Campus de Cantoblanco), Madrid 28049, Spain

de Tecnologia Química e Biológica António Xavier, Universidade Nova de Lisboa, Av. da 2Systems

Biology Program, Centro Nacional de

14 15 16

Running Title: Boosting gene expression flow with 5’-UTRs

17

Keywords:

mRNA decay, heterologous expression, 5’-UTRs, pSEVA, sfGFP

18 19 20 21 22 23 24 25

* These authors contributed equally to this work. ¤ Correspondence to: [email protected]; [email protected]

26 27 28 29 30


Modulating Heterologous Gene Expression with Portable mRNA

Recommend Documents