Modulating Supramolecular Peptide Hydrogel Viscoelasticity Using

Subscriber access provided by University of Glasgow Library

Article

Modulating Supramolecular Peptide Hydrogel Viscoelasticity Using Biomolecular Recognition John T. M. DiMaio, Todd M. Doran, Derek M. Ryan, Danielle M. Raymond, and Bradley L. Nilsson Biomacromolecules, Just Accepted Manuscript • DOI: 10.1021/acs.biomac.7b00925 • Publication Date (Web): 05 Sep 2017 Downloaded from http://pubs.acs.org on September 6, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biomacromolecules is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Modulating Supramolecular Peptide Hydrogel Viscoelasticity Using Biomolecular Recognition John T. M. DiMaio, Todd M. Doran,# Derek M. Ryan, Danielle M. Raymond, and Bradley L. Nilsson* University of Rochester, Department of Chemistry, Rochester, NY 14627 Email: [email protected]; Phone: 585-276-3053 #

Current address: Department of Medicinal Chemistry, University of Minnesota Twin Cities, 308 Harvard Street SE, Minneapolis, MN 55455

Abstract Self-assembled peptide-based hydrogels are emerging materials that have been exploited for wound healing, drug delivery, tissue engineering, and other applications. In comparison to synthetic polymer

hydrogels,

supramolecular peptide-based

gels

have

advantages

in

biocompatibility, biodegradability, and ease of synthesis and modification. Modification of the emergent viscoelasticity of peptide hydrogels in a stimulus responsive fashion is a longstanding goal in the development of next-generation materials. In an effort to selectively modulate hydrogel viscoelasticity, we report herein a method to enhance the elasticity of β-sheet peptide hydrogels using specific molecular recognition events between functionalized hydrogel fibrils and biomolecules. Two distinct biomolecular recognition strategies are demonstrated: oligonucleotide Watson-Crick duplex formation between peptide nucleic acid (PNA) modified fibrils with a bridging oligonucleotide and protein-ligand recognition between mannose modified fibrils with concanavalin A. These methods to modulate hydrogel elasticity should be broadly adaptable in the context of these materials to a wide variety of molecular recognition partners.

1

ACS Paragon Plus Environment

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Introduction Hydrogels are emerging materials for biomedical applications that include tissue engineering1, 2, wound healing3-5, drug delivery3,

6, 7

, and immunotherapy.8 Self-assembled

peptide based hydrogels are an attractive alternative to traditional polymer-based gels for applications requiring inherently softer materials due to advantages in biocompatibility and biodegradability.9-19 In addition, spontaneous self-assembly of peptide nanofibril networks from relatively simple peptide sequences provides opportunities for modifying the emergent hydrogel properties through alteration of the peptide sequence.20-23 The design of self-assembled hydrogels with varying emergent viscoelasticity that is correlated to peptide sequence is a long-standing goal for applications that involve interaction of the gel network with cells. The ability to tune hydrogel viscoelasticity can influence the utility of the gels for interactions with different cell types5, 24 and can potentially influence other physical characteristics, such as rate of release for drug delivery.7, 25-27 The viscoelasticity of noncovalent peptide gels relies primarily on the concentration and entanglement efficiency of the fibril network. This limits, to some extent, the ability to modify elasticity of the resulting hydrogels once the network has been established. Strategies to selectively tune the viscoelasticity of selfassembled peptide hydrogels, including covalent cross-linking of assembled peptide fibrils and alteration of environmental stimuli, are primarily useful to change the elasticity as the network initially forms.28-30 There are few examples of modification of hydrogel elasticity for supramolecular peptide hydrogels after network formation.31-33 Herein we describe the stimulus-responsive enhancement of self-assembled peptide hydrogel viscoelasticity by specific noncovalent cross-linking of peptide nanofibrils using a

2


Page 2 of 34

Page 3 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

biomolecular recognition strategy. The amphipathic Ac-(FKFE)2-NH2 peptide is a frequently studied example of self-assembling peptide that rapidly forms β-sheet bilayer nanofibrils at low µM concentrations; hydrogel networks of these nanofibrils are established at concentrations exceeding ~4 mM.9,

20, 34-40

At lower concentrations, the fibrils that assemble do not form a

sufficiently entangled network to elicit gelation of aqueous solvents. We hypothesized that hydrogels of Ac-(FKFE)2-NH2 nanofibrils could be rigidified by selective cross-linking of the fibrils via noncovalent interactions between biomolecular recognition motifs appended to the self-assembled nanofibrils and molecules that bind to these motifs (Figure 1). This specific crosslinking would rigidify the hydrogel by selectively reinforcing the fibril network. This strategy has previously been applied to gelation of synthetic polymer gels.41-43 Two strategies were explored to test this hypothesis: (1) cross-linking of peptide fibrils with appended oligonucleotide mimetics by complementary bridging DNA strands and (2) cross-linking of saccharide-modified peptide fibrils by lectins with multiple recognition sites for the nanofibrilappended carbohydrate. In both cases the viscoelasticity of peptide nanofibril hydrogels was enhanced upon introduction of the bridging biomolecules. This work demonstrates fundamental design principles for in situ stimulus-responsive modification of the emergent properties of noncovalent hydrogels.

3


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 34

Figure 1. Pictorial representation of hydrogel viscoelasticity enhancement through bridging of biomolecules appended to supramolecular peptide fibrils via specific interactions. These interactions reinforce the cross-linking density of the hydrogel network, thus increasing the elasticity of the bulk hydrogel.

Materials and Methods Peptide Synthesis. C-terminal amide peptides were synthesized on Rink amide resin (100–200 mesh, 0.2 mmol g-1 loading, Advanced ChemTech, Louisville, KY), and loaded manually

using

fluorenylmethoxycarbonyl

(Fmoc)

chemistry

and

standard

hydroxybenzotriazole/N,N,N,N-tetramethyl-O-(1H-benzotriazol-1-yl)uranium hexafluorophosphate (HOBt/HBTU) protocols. Peptides were synthesized using standard Fmoc protection with HBTU/HOBt activation on a microwave-equipped CEM Liberty Peptide Synthesizer (CEM, Matthews, NC). N-terminal acetylation was performed (where specified) with 20% acetic anhydride in dimethylformamide (DMF) for 40 min. Peptides were cleaved from the solid support using trifluoroacetic acid (TFA) cleavage cocktail, consisting of TFA, triisopropyl silane (TIS), and water (95:2.5:2.5, v/v/v) for 1 h at room temperature. The supernatant was collected, concentrated, and precipitated from cold diethyl ether (-78 ºC); the precipitated peptide was collected by centrifugation. The organic supernatant was decanted and the pellet was dissolved in dimethylsulfoxide (DMSO) for purification. Purification and 4


Page 5 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

characterization data are provided in the Supporting Information (Tables S1 and S2, Figures S1– S8). Peptide nucleic acid (PNA) synthesis. PNA sequences were synthesized using similar Fmoc deprotection methods. PNA sequences at the C-terminus of peptides were coupled iteratively onto Rink amide resin (100–200 mesh, 0.05 mmol/g-1 loading, Advanced ChemTech, Louisville, KY) preloaded with lysine. Fmoc deprotection was performed in 20% piperidine in DMF for 5 min. The resin was washed three times with DMF, and then three times with CH2Cl2. Couplings were then performed twice for 30 min using diisopropylcarbodiimide/1-hydroxy-7azabenzotriazole (DIC/HOAt) activation. N-terminal PNA sequences were prepared similarly, but following the initial synthesis of the full (FKFE)2 sequence. Acetylation was performed with 20% acetic anhydride in DMF for 40 min at room temperature. Peptide/PNA hybrids were cleaved from the solid support using trifluoroacetic acid (TFA) cleavage cocktail, consisting of TFA, triisopropyl silane (TIS), and water (95:2.5:2.5, v/v/v) for 1 h at room temperature. The supernatant was collected and concentrated. Peptides were precipitated from cold diethyl ether (78 ºC) and collected by centrifugation. The organic supernatant was decanted and the pellet was dissolved in DMSO for high performance liquid chromatography (HPLC) purification. Attachment of 2-(((2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydro2H-pyran-2-yl)oxy)acetic acid to (FKFE)2 peptides. The synthesis of the deprotected mannosyl carboxylic acid, 2-(((2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydro2H-pyran-2-yl)oxy)acetic acid, was carried out as described in the literature.44 This deprotected mannosyl

carboxylic

acid

(118

mg,

500

µmol)

was

activated

with

1-

[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) (190 mg, 500 µmol) in CH2Cl2/DMF (1 : 1, v/v) (5 mL). This mixture was allowed to

5


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

stand for 10 min. The solution was the added to N-terminally deprotected (FKFE)2 on the solid support. This mixture was allowed to stir for 6 h. The peptide on resin was washed, dried, and then cleaved using the procedure described supra. HPLC Purification of Peptides and Hybrid PNA or Mannose Peptides. Peptides were purified on a Shimadzu LC-6AD high performance liquid chromatograph (HPLC) (Shimadzu, Columbia, MD) equipped with a reverse-phase (RP) C18 column (BEH300, 10 µm, 19 x 250 mm, Waters, Milford, MA). A gradient of acetonitrile (0.1% TFA) and water (0.1%) at 10 mL min-1 was used to separate products. Eluent was monitored by UV absorbance at 215 and 254 nm. Purity was assessed by injection on an analytical Shimadzu LC-10ATVP HPLC instrument equipped with a RP-C18 column (Waters, Milford, MA). Peptides were characterized via MALDI-TOF analysis. Pure peptides were frozen and lyophilized to a powder for later use. See Supporting Information (Tables S1-S2 and Figures S1-S8 for purification and characterization data for all peptides). Peptide Self-Assembly. Lyophilized peptides were dissolved in 6:4 mixtures of water and acetonitrile (v/v). Concentration was determined via correlation to an HPLC calibration curve. The appropriate volumes of peptides were mixed (as appropriate) and lyophilized. The lyophilized material was then dissolved in unbuffered water at appropriate concentrations and vortexed for 1 min. Circular dichroism (CD) Analysis of Nanofibrils. Peptides were prepared as outlined above at a concentration of 500 µM in unbuffered water. CD spectra were then recorded on an AVIV 202 CD spectrometer (AVIV Biomedical, Lakewood, NJ). Spectra were obtained with a 0.1 mm quartz cuvette (Hellma, Concord, ON, CA) at 25 ºC from 260 to 190 nm with a 3 s average collecting time per step at a 1.0 nm step and 1.0 nm bandwidth. Background subtraction

6


Page 6 of 34

Page 7 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

was performed, followed by conversion to molar ellipticity. The resulting spectra were then smoothed using a least squares fit on the AVIV software. Negative-Stain Transmission Electron Spectroscopy (TEM). Peptides were prepared as outlined above at a total peptide concentration of 500 µM. 10 µL of the assembled peptide solution was applied to a 200-mesh carbon-coated copper grid. After standing for 1 min, excess fluid was removed by capillary action. 10 µL of filtered 5% uranyl acetate was placed on the grid and allowed to stand for 1 min. After standing, the uranyl acetate was removed by capillary action. Grids were then allowed to air dry for 5–15 min. TEM micrographs were obtained using an Hitachi 7650 transmission electron microscope with an accelerating voltage of 80 kV. Fibril dimensions determined using ImageJ (NIH, rsbweb.nih.gov/ij/). PPH/Ac-(FKFE)2-NH2 Hybrid Gel Formation. PNA-bearing fibril hydrogels were prepared as outlined above at a total peptide concentration of 4.2 mM (3 mM Ac-(FKFE)2-NH2, 0.6 mM PPH1, and 0.6 mM PPH2). The mixed peptides were vortexed for 1 min and allowed to stand for 1 day. The resulting gel was analyzed on an AR-G2 rheometer (TA Instruments). Hydrogels in the presence of bridging DNA were prepared as outlined above, except 100 nmol of DNA was added after dissolution of the peptides. Almost immediately upon addition of DNA, the solution visibly increased in viscosity. This material was vortexed for 1 min and allowed to stand for 1 day. The resulting gel was analyzed on an AR-G2 rheometer (TA Instruments). Man-(FKFE)2 Hydrogel Formation. Man-(FKFE)2-NH2 hydrogels were prepared as described above at a concentration of 3.5 mM peptide in unbuffered water. To test for conconavalin A (ConA) mediated cross-linking, 1 µL of ConA (5 g/L) was added to select gels ([ConA] = 2.4 µM). These hydrogels were assessed by oscillatory rheology.

7


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Rheological Analysis of Gels. Rheology was performed on an AR-G2 rheometer (TA Instruments) operating in oscillatory mode, using a 20 mm parallel plate geometry. Samples were prepared as outlined above and applied directly to the rheometer stage. Following gel application, a dynamic frequency sweep was performed for 0.1–40 rad s-1 with 0.2% strain at 25 ºC (this was found to be within the linear viscoelastic region for the gels as determined by a prior strain sweep experiment). All reported values for G´ and G˝ are the average of at least three runs. Data shown is representative data.

Results & Discussion Herein, we report a strategy to modify the viscoelasticity of self-assembled peptide hydrogels in situ by exploiting specific molecular recognition phenomena to noncovalently cross-link, and thereby rigidify, the hydrogel network. Our first approach to accomplish this objective exploits Watson-Crick base-pair formation between olignonucleotide mimetics appended to Ac-(FKFE)2-NH2 nanofibrils and a complementary oligonucleotide strand that acts as an interfibril bridge (Figure 2). For these studies, peptide nucleic acid (PNA) oligomers were exploited (Figure 3). PNA is a polyamide oligonucleotide mimetic that retains the ability to bind to complementary oligonucleotides (including DNA, RNA, and other PNA strands).45, 46 PNA is conveniently appended to peptides since they are synthesized using nearly identical solid-phase methods.47-50 PNA has been demonstrated to form duplexes with both DNA and RNA with high affinity (the average free energy of binding (∆Gº) is -6.5 ± 0.3 kJ mol-1 bp-1)51 and specificity.52, 53

The neutral, uncharged backbone of PNA also allows sequence-selective duplexes to be

formed even at low ionic strength, enabling the use of PNA in unbuffered aqueous solutions without added salts.48, 53

8


Page 8 of 34

Page 9 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 2. Conceptual illustration of Watson-Crick mediated fibril cross-linking of peptide nucleic acid (PNA) bearing self-assembled Ac-(FKFE)2-NH2 nanofibrils (PPH1/PPH2 nanofibrils) with a bridging oligonucleotide that is complementary to the PPH1 and PPH2 PNA sequences. The bridging oligonucleotide forms selective noncovalent cross-links between fibrils, which strengthens the hydrogel network thereby increasing the emergent hydrogel viscoelasticity.

Figure 3. Chemical structure of the peptide nucleic acid (PNA) aminoethyl glycine backbone and the appended nucleobases.

9


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 34

This strategy was explored using the peptide, PNA-peptide conjugate, and DNA oligonucleotide sequences shown in Table 1. Ac-(FKFE)2-NH2 was used as the fundamental selfassembling peptide motif that constitutes the assembled peptide nanofibrils. The PPH1 PNApeptide chimera has a PNA decamer appended to the N-terminus of an (FKFE)2-NH2 peptide, while the PPH2 chimera has a PNA decamer attached to the C-terminus of Ac-(FKFE)2. The PNA oligomers on PPH1 and PPH2 are non-complementary to each other. A bridging DNA oligonucleotide that is complementary to the PPH1 PNA oligomer at the 5' end and to the PPH2 PNA oligomer at the 3' end was designed. These DNA segments are connected via a linker sequence that has no complementarity to either PNA strand. Conceptually, PPH1 and PPH2 can be coassembled with Ac-(FKFE)2-NH2 at varying ratios to provide nanofibrils that display the PNA sequences at a density that is proportional to the coassembly ratio of PPH1:PPH2:Ac(FKFE)2-NH2. When these PPH1/PPH2 hybrid nanofibrils are mixed in the presence of the bridging DNA oligonucleotide, the fibrils will be cross-linked via Watson-Crick duplex formation, theoretically increasing the elasticity of the hydrogel network (Figure 2).

Table 1. Sequences of peptide, peptide/PNA hybrid, and DNA biopolymers. For peptides, upper case letters are amino acids and lower case letters are PNA residues; PEG is 8-amino-3,6dioxaoctonoic acid. For the DNA sequence, the underlined nucleotides are complementary to the underlined PNA residues in PPH1 and the bold faced nucleotides are complementary to the bold faced residues in PPH2. Biopolymer Sequence (FKFE)2 Ac-FKFEFKFE-NH2 PPH1 Ac-ttctctctga-PEG-FKFEFKFE-NH2 PPH2 Ac-FKFEFKFE-PEG-tttctaatgt-K-NH2 Bridging 5´- TCAGAGAGAATACCTCAACATTAGAAA - 3´ DNA

10


Page 11 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

The requisite peptides were prepared and the assembly properties of PPH1 and PPH2 coassembled with Ac-(FKFE)2-NH2 were characterized. The peptides were synthesized by standard Fmoc solid-phase methods. It was found that appending PNA analogs onto selfassembling (FKFE)2 peptides did not impede assembly of these peptides into nanofibrils. All nanofibrils described in this section were prepared in unbuffered water. Ac-(FKFE)2-NH2, PPH1, and PPH2 were mixed in a 5:1:1 ratio (500 µM total peptide) and the assemblies formed from this mixture were compared to assemblies of Ac-(FKFE)2-NH2 alone. Circular dichroism (CD) analysis of Ac-(FKFE)2-NH2 yielded the expected the minima at 218 and 205 nm, as have previously been observed for fibrils of this peptide. These minima correspond to characteristic βsheet secondary structure (218 nm) and π-π effects between Phe side chain groups in the hydrophobic core (205 nm) (Figure 4A). The CD spectrum of PPH1/PPH2/Ac-(FKFE)2-NH2 hybrid nanofibrils was dominated by strong absorbance at 220 nm by the PNA nucleobases, complicating assessment of secondary structure of these PNA-bearing fibrils. However, TEM images of the self-assembled Ac-(FKFE)2-NH2 and the coassembled PPH1/PPH2/Ac-(FKFE)2NH2 hybrid fibrils indicated the formation of similar nanotape fibril assemblies (Figure 4B and 4C). Fibrils formed from just Ac-(FKFE)2-NH2 were tape-like in appearance and 8.4 ± 0.4 nm in width, consistent with previous reports;54-56 the PPH1/PPH2/Ac-(FKFE)2-NH2 hybrid fibrils were a mixture of tapes and helical ribbons 8.1 ± 0.7 nm wide. Helical ribbons are also observed at earlier incubation times with Ac-(FKFE)2-NH2 fibrils, but these evolve into non-helical structures in time.39, 57 While the attachment of PNA does not appear to impede assembly (even PPH1 and PPH2 alone are capable of self-assembly without mixing with Ac-(FKFE)2-NH2, see Supporting Information, Figures S9 and S10), the evolution from initial helical morphologies to non-helical tapes is slightly slowed.

11


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 34

Figure 4. CD spectra and TEM micrographs of Ac-(FKFE)2-NH2 (black) and a combination of Ac-(FKFE)2-NH2, PPH1, and PPH2 (red). All concentrations are 500 µM (total peptide concentration). The combination of Ac-(FKFE)2-NH2, PPH1, and PPH2 is a total peptide concentration of 500 µM, but in a ratio of 5 : 1 : 1 (Ac-(FKFE)2-NH2 : PPH1 : PPH2). (A) CD spectra; (B) TEM Micrograph of Ac-(FKFE)2-NH2; and (C) TEM micrograph of a combination of Ac-(FKFE)2-NH2, PPH1, and PPH2. Next, the viscoelasticity of hydrogels composed of either Ac-(FKFE)2-NH2 fibrils or PPH1/PPH2/Ac-(FKFE)2-NH2 hybrid fibrils was characterized. These hydrogels were prepared in unbuffered water. Oscillatory rheology was used to measure viscoelasticity as a function of the storage modulus (G´) and the loss modulus (G˝) of the respective materials. Gels were formed in each case at peptide concentrations of 4.2 mM. Dynamic frequency sweeps from 0–40 rad s-1 at 0.2% strain (which falls in the linear viscoelastic region for these gels as determined by previous strain sweep experiments) were performed to measure the storage and loss moduli of these materials. Ac-(FKFE)2-NH2 hydrogels and PPH1/PPH2/Ac-(FKFE)2-NH2 hybrid hydrogels without any bridging oligonucleotide had similar rheological characteristics, with G´ values of 148.2 ± 10.4 Pa and a G˝ values of 20.7 ± 9.17 Pa (Figure 5). Consistent with previous experiments, these gels are soft materials.9, 10, 37 The gels formed in the presence of a bridging DNA oligonucleotide (added at a concentration of 0.6 mM, approximately equimolar to each appended PNA oligomer), exhibited

12


Page 13 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

increased G´ values of 245 ± 11.3 Pa and G˝ values of 23.08 ± 3.37 Pa. Again, the DNA-bridged hydrogels were also prepared in unbuffered water since salts are not required for the formation of duplexes between uncharged PNA oligomers with negatively charged DNA. The addition of DNA doubled the storage modulus of the resulting gels while leaving the loss modulus unchanged, indicating a significant rigidification of the hydrogel in the presence of a specific biomolecular recognition motif that forms fibril-fibril cross-links. While the bulk rheological properties of the hydrogel materials indicate enhancement of the cross-linked entangled state, extensive TEM imaging of the network failed to provide quantifiable measurements of the microscopic degree of additional cross-link formation. The addition of non-complementary DNA oligonucleotides resulted in no change of the observed storage and loss moduli. In addition, modifying the ratio of PNA displayed on the fibrils or altering the concentration of bridging DNA did not alter the degree of enhancement of elasticity in the gels. These experiments confirm that noncovalent cross-linking of self-assembled peptide nanofibrils with specific biomolecular recognition motifs can be used to modify the emergent viscoelasticity of the resulting hydrogels. Oligonucleotide cross-linking of the nanofibril network is an effective strategy to rigidify the network in situ.

13


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 34

Figure 5. Dynamic frequency sweep of Ac-(FKFE)2-NH2, PPH1, and PPH2 in the absence of DNA (red) and presence of bridging DNA (black). The combination of Ac-(FKFE)2-NH2, PPH1, and PPH2 is a total peptide concentration of 4.2 mM in a ratio of 5 : 1 : 1 (Ac-(FKFE)2-NH2 : PPH1 : PPH2).

The observation that modifying the ratio of PNA displayed on the fibrils or altering the concentration of bridging DNA has no significant effect on the elasticity in the resulting gels warrants some discussion. The biophysics of hydrogelation in this system is complicated and the degree of G' enhancement does not have a clean linear relationship with PNA concentration (or DNA concentration) because the network is influenced not only by PNA/DNA cross-linking of the fibrils, but also by the inherent entanglement of the fibrils that occurs at gelation concentrations. As such, there is no convenient method to estimate what ratio of the appended PNA is 1) available for interaction with cross-linking DNA and 2) is actually participating in a DNA bridged cross-link. It is possible that some of the appended PNA is inserted into the hydrophobic bilayer of the peptide nanofibrils and are thus unavailable to form DNA cross-links. It is also possible that the formation of DNA-bridged interfibril crosslinks perturbs the equilibrium between the assembled and disassembled states of the peptide nanofibrils by mechanically pulling the PNA-bearing peptides from the assembled nanofibrils. The data shows that the addition of bridging DNA does enhance hydrogel viscoelasticity in these materials, which does not, however, preclude the existence of these complicated states. Efforts to elicit sol-gel transformations of the PNA-decorated nanofibrils were also disappointing. We dissolved the peptide nanofibrils at concentrations below 4 mM where no selfsupporting hydrogels were formed and attempted to trigger gelation by addition of the bridging DNA. While the addition of DNA visually increased the viscosity of these solutions, we were unable to find conditions where self-supporting hydrogel formation was triggered. These

14


Page 15 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

observations reinforce the fundamental importance of nanofibril concentration, in addition to specific interfibril cross-linking interactions, in the formation of entangled hydrogel networks of self-assembled peptide materials. Despite these limitations, the data presented herein clearly indicates that specific noncovalent cross-linking interactions between the self-assembled fibrils can significantly alter the emergent viscoelasticity of these hydrogel materials. A second approach to affect specific fibril-fibril cross-linking of Ac-(FKFE)2-NH2 hydrogels was explored that exploits lectin recognition of carbohydrates appended to the fibril network. Concanavalin A (ConA) is a lectin protein that binds to mannose ligands (Ka of 6.8 × 103 M-1 for monovalent ConA,58 7.54 × 103 M-1 for divalent ConA,58 8.2 × 103 M-1 for tetrameric ConA).59 At neutral pH, ConA is a homotetramer (Figure 6B), while at pH 3–4 it is dimeric. Thus, ConA in an oligomeric form is capable of binding multiple mannose molecules. We hypothesized that ConA would therefore be an effective cross-linking agent for (FKFE)2 fibrils that bear mannose. Accordingly, we prepared the Man-(FKFE)2-NH2 peptide shown in Figure 6A to test this hypothesis.60, 61

15


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 34

Figure 6. Structures of the mannose-bearing peptides and tetrameric concanavalin A (ConA). (A) Structure of the mannose-bearing (FKFE)2 peptide (Man-(FKFE)2-NH2). (B) Structure of tetrameric ConA (PDB entry 1QDC).62

Man-(FKFE)2-NH2 effectively self-assembled into β-sheet nanofibrils in unbuffered water similarly to the parent Ac-(FKFE)2-NH2 peptide. As shown in Figure 7A, the CD spectrum of Man-(FKFE)2-NH2 fibrils is identical to that of Ac-(FKFE)2-NH2 (Figure 4A), with characteristic minima at 205 nm and 218 nm. TEM images also indicate that Man-(FKFE)2-NH2 readily self-assembled into nanofibrils in both the absence and presence of ConA (Figure 7B and 7C). These fibrils are 3.5 ± 0.6 nm in diameter, which is narrower than fibrils derived from Ac(FKFE)2-NH2 alone. These narrower dimensions are likely due to a steric effect of the Nterminal mannose, which likely precludes lateral β-sheet interactions that result in the wider fibrils observed for Ac-(FKFE)2-NH2.

16


Page 17 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 7. CD spectrum and TEM micrographs of Man-(FKFE)2-NH2. (A) CD spectrum of Man(FKFE)2-NH2; (B) TEM micrograph of Man-(FKFE)2-NH2 fibrils without ConA; and (C) TEM micrograph of Man-(FKFE)2-NH2 fibrils with ConA.

Oscillatory rheology confirms that ConA effectively cross-links the Man-(FKFE)2-NH2 nanofibril network (Figure 8). Hydrogels were again formed at 4.2 mM concentrations of Man(FKFE)2-NH2. These gels are formed in unbuffered water, with the pH of the gels measured at 5.6. This slightly acidic gel pH is presumably due to residual TFA from the purification of Man(FKFE)2-NH2. At this pH, ConA will likely be a mixture of dimers and tetramers. Without the addition of ConA, the resulting gels had an average G´ values of 148.3 ± 8.5 Pa and G˝ values of 14.9 ± 10.53 Pa, similar to Ac-(FKFE)2-NH2 gels at this same concentration. Upon the addition of ConA (2.4 µM), the resulting gels exhibited G´ values of 466.3 ± 60.8 Pa and G˝ values of 43.7 ± 5.2 Pa. This represents a significant enhancement of hydrogel elasticity affected by selective biomolecular cross-linking of the fibril network. Interestingly, the storage modulus displays slight non-linearity, with G´ increasing at higher frequencies in the measurement. This may be due to enhancement in ConA cross-linking at higher frequencies as a function of the relatively low binding affinity of ConA to mannose. This effect may also be due to perturbation of the multimeric state of ConA (dimer versus tetramer) as the rheological experiment

17


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 34

progresses. The addition of ConA to unmodified (non-mannose bearing) Ac-(FKFE)2-NH2 fibrils had no effect on hydrogel viscoelasticity.

Figure 8. Dynamic frequency sweep of Man-(FKFE)2-NH2 hydrogels (4.2 mM) in the absence of ConA (red) and presence of ConA (black).

As with the DNA-bridged system, the data presented from the lectin-bridged hydrogels raises some additional questions regarding the materials. It is not clear how the formation of ConA-bridged interfibril crosslinks influences the stability of the peptide nanofibrils. The possibility of mechanically disrupting the mannose-bearing peptides from the assembled nanofibrils exists and the data available does not clearly address the extent to which this may occur and what the consequences may be. In addition, the binding affinity of ConA to mannose is relatively weak. While a similar degree of enhancement is observed in the DNA-bridged and ConA-bridged hydrogels, ConA was added at a much higher concentration (2.4 µM) compared to the DNA bridge (100 nM) at a constant peptide concentration of ~4 mM. Thus, the lower binding affinity of ConA for its mannose ligand has a significant impact on the sensitivity of the emergent hydrogel properties to the presence of the cross-linking agent. Thus, the design of these

18


Page 19 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

types of materials for biological applications must carefully consider ligand binding affinity and the available concentration of the ligand in the environment in which the hydrogel is to be employed. These studies further confirm that bridging biomolecules can effectively cross-link peptide nanofibril hydrogels that display appropriate ligands for the biomolecule and that this strategy is effective for the in situ rigidification of the hydrogel network. The ConA/mannose strategy demonstrates that protein/ligand interactions are an effective cross-linking method for proteins that are multimeric and can bind multiple equivalents of the ligand. The ConA and oligonucleotide strategies also show some limitations of this strategy in terms of the degree of enhancement of hydrogel viscoelasticity. First, the enhancements observed in this study were significant, but fairly modest. Hydrogel formation of self-assembled peptide nanofibrils is highly concentration dependent. In the case of Ac-(FKFE)2-NH2, self-assembly occurs at µM concentrations, but hydrogelation of these self-assembled nanofibrils requires concentrations greater than ~ 4 mM. Attempts to elicit sol to gel state transitions by cross-linking with DNA or ConA at peptide concentrations below 4 mM where the peptides were self-assembled but not hydrogels were only modestly successful. Visually, these solutions became more viscous, but failed to meet the standard of self-supporting hydrogels by the inversion test. For these types of peptide hydrogels, self-supporting gel formation depends highly on peptide concentration, meaning this biomolecular cross-linking strategy is most valuable for in situ modification of hydrogel viscoelasticity and not for triggering gelation a priori. A second limitation that should be appreciated is that not all cross-linking events will be interfibril based on this design strategy. Intrafibril cross-links, which may not contribute as strongly to enhancement of hydrogel viscoelasticity, are also undoubtedly formed. Finally, the long-term stability of these gels will

19


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 34

undoubtedly influence the applications for which this strategy will be useful. Future studies will focus on the long-term stability of the cross-linked hydrogels as a function of ligand binding affinity and time. Despite these limitations, biomolecular cross-linking of ligands that are displayed on peptide nanofibrils in a multivalent fashion is an effective and simple strategy to modify hydrogel viscoelasticity in situ. The ease with which biomolecular ligands can be displayed on self-assembled peptide fibrils makes this a convenient strategy to enhance hydrogel rigidity that should be readily adaptable to a wide variety of biomolecule/ligand systems. This could be highly attractive for hydrogels in biological environments in which proteins or other biomolecules of interest are present. For example, overexpression of a protein of interest in cells in tissue culture experiments could result in in situ enhancement of hydrogel viscoelasticity, which could influence cell fate or other properties of the gel, such as rate of delivery of small molecule drugs packaged within the gel. This strategy could also be readily adapted to sensing applications. We anticipate future studies in which these types of applications are explored using biomolecular recognition to modify emergent properties of self-assembled peptide hydrogels.

Conclusion We have demonstrated that the emergent properties of hydrogels derived from selfassembled amphipathic peptides can be modified by cross-linking the fibril network via noncovalent bimolecular recognition phenomena. Specifically, Ac-(FKFE)2-NH2 nanofibril hydrogels have been rigidified using two noncovalent cross-linking strategies: (1) oligonucleotide-mediated cross-linking by complementary Watson-Crick base pair formation and

20


Page 21 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(2) lectin-mediated cross-linking of fibrils displaying mannose. These results are significant in that they establish proof of principle for the use of noncovalent cross-linking to modify the viscoelasticity of peptide hydrogels, soft materials for which the elastic properties are typically limited by the concentration of the fibril network. In addition, the noncovalent cross-link strategies are specific and selective, indicating that these or similar molecular recognition events can be used to strategically alter hydrogel rigidity in situ in response to biological microenvironments. This design strategy can be readily employed to tune the properties of selfassembled peptide hydrogels as a function of environment for a wide array of applications, including drug delivery and wound healing.

Supporting Information Purification and characterization data for all peptides and additional CD spectra and TEM micrographs are provided in the Supporting Information. Acknowledgements We acknowledge support from the National Science Foundation (DMR-1148836) for this research. We also thank Karen Bentley (URMC Electron Microscope Research Core) for assistance with TEM experiments. References 1. Thompson, C. B.; Korley, L. T. J., Harnessing Supramolecular and Peptidic SelfAssembly for the Construction of Reinforced Polymeric Tissue Scaffolds. Bioconjugate Chem. 2017, 28, 1325-1339. 2. Wang, H.; Yang, Z., Short-peptide-based molecular hydrogels: novel gelation strategies and applications for tissue engineering and drug delivery. Nanoscale 2012, 4, 5259-5267. 3. Moore, A. N.; Hartgerink, J. D., Self-Assembling Multidomain Peptide Nanofibers for Delivery of Bioactive Molecules and Tissue Regeneration. Acc. Chem. Res. 2017, 50, 714-722. 4. Hosseinkhani, H.; Hong, P. D.; Yu, D. S., Self-Assembled Proteins and Peptides for Regenerative Medicine. Chem. Rev. 2013, 113, 4837-4861.

21


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

5. Jung, J. P.; Nagaraj, A. K.; Fox, E. K.; Rudra, J. S.; Devgun, J. M.; Collier, J. H., Coassembling peptides as defined matrices for endothelial cells. Biomaterials 2009, 30, 2400-2410. 6. Eskandari, S.; Guerin, T.; Toth, I.; Stephenson, R. J., Recent advances in self-assembled peptides: Implications for targeted drug delivery and vaccine engineering. Adv. Drug Deliv. Rev. 2017, 110–111, 169-187. 7. Fung, S. Y.; Yang, H.; Bhola, P. T.; Sadatmousavi, P.; Muzar, E.; Liu, M.; Chen, P., SelfAssembling Peptide as a Potential Carrier for Hydrophobic Anticancer Drug Ellipticine: Complexation, Release and In Vitro Delivery. Adv. Funct. Mater. 2009, 19, 74-83. 8. Rudra, J. S.; Sun, T.; Bird, K. C.; Daniels, M. D.; Gasiorowski, J. Z.; Chong, A. S.; Collier, J. H., Modulating Adaptive Immune Responses to Peptide Self-Assemblies. ACS Nano 2012, 6, 1557-1564. 9. Bowerman, C. J.; Liyanage, W.; Federation, A. J.; Nilsson, B. L., Tuning β-Sheet Peptide Self-Assembly and Hydrogelation Behavior by Modification of Sequence Hydrophobicity and Aromaticity. Biomacromolecules 2011, 12, 2735-2745. 10. Bowerman, C. J.; Nilsson, B. L., A Reductive Trigger for Peptide Self-Assembly and Hydrogelation. J. Am. Chem. Soc. 2010, 132, 9526-9527. 11. Zhu, Z.; Wu, C.; Liu, H.; Zou, Y.; Zhang, X.; Kang, H.; Yang, C. J.; Tan, W., An Aptamer Cross-Linked Hydrogel as a Colorimetric Platform for Visual Detection. Angew. Chem. Int. Ed. 2010, 49, 1052-1056. 12. Rajagopal, K.; Lamm, M. S.; Haines-Butterick, L. A.; Pochan, D. J.; Schneider, J. P., Tuning the pH Responsiveness of β-Hairpin Peptide Folding, Self-Assembly, and Hydrogel Material Formation. Biomacromolecules 2009, 10, 2619-2625. 13. Carrick, L. M.; Aggeli, A.; Boden, N.; Fisher, J.; Ingham, E.; Waigh, T. A., Effect of ionic strength on the self-assembly, morphology and gelation of pH responsive β-sheet tapeforming peptides. Tetrahedron 2007, 63, 7457-7467. 14. Ozbas, B.; Kretsinger, J.; Rajagopal, K.; Schneider, J. P.; Pochan, D. J., Salt-Triggered Peptide Folding and Consequent Self-Assembly into Hydrogels with Tunable Modulus. Macromolecules 2004, 37, 7331-7337. 15. Aggeli, A.; Bell, M.; Carrick, L. M.; Fishwick, C. W. G.; Harding, R.; Mawer, P. J.; Radford, S. E.; Strong, A. E.; Boden, N., pH as a Trigger of Peptide β-Sheet Self-Assembly and Reversible Switching between Nematic and Isotropic Phases. J. Am. Chem. Soc. 2003, 125, 9619-9628. 16. Pochan, D. J.; Schneider, J. P.; Kretsinger, J.; Ozbas, B.; Rajagopal, K.; Haines, L., Thermally Reversible Hydrogels via Intramolecular Folding and Consequent Self-Assembly of a de Novo Designed Peptide. J. Am. Chem. Soc. 2003, 125, 11802-11803. 17. Collier, J. H.; Hu, B. H.; Ruberti, J. W.; Zhang, J.; Shum, P.; Thompson, D. H.; Messersmith, P. B., Thermally and Photochemically Triggered Self-Assembly of Peptide Hydrogels. J. Am. Chem. Soc. 2001, 123, 9463-9464. 18. Vacogne, C. D.; Brosnan, S. M.; Masic, A.; Schlaad, H., Fibrillar gels via the selfassembly of poly(l-glutamate)-based statistical copolymers. Polym. Chem. 2015, 6, 5040-5052. 19. Vacogne, C. D.; Schopferer, M.; Schlaad, H., Physical Gelation of α-Helical Copolypeptides. Biomacromolecules 2016, 17, 2384-2391. 20. Caplan, M. R.; Schwartzfarb, E. M.; Zhang, S.; Kamm, R. D.; Lauffenburger, D. A., Control of self-assembling oligopeptide matrix formation through systematic variation of amino acid sequence. Biomaterials 2002, 23, 219-227.

22


Page 22 of 34

Page 23 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

21. Medini, K.; Mansel, B. W.; Williams, M. A. K.; Brimble, M. A.; Williams, D. E.; Gerrard, J. A., Controlling gelation with sequence: Towards programmable peptide hydrogels. Acta. Biomater. 2016, 43, 30-37. 22. Rubert Perez, C. M.; Rank, L. A.; Chmielewski, J., Tuning the thermosensitive properties of hybrid collagen peptide-polymer hydrogels. Chem. Commun. 2014, 50, 8174-8176. 23. Banwell, E. F.; Abelardo, E. S.; Adams, D. J.; Birchall, M. A.; Corrigan, A.; Donald, A. M.; Kirkland, M.; Serpell, L. C.; Butler, M. F.; Woolfson, D. N., Rational design and application of responsive α-helical peptide hydrogels. Nat. Mater. 2009, 8, 596-600. 24. Tian, Y. F.; Devgun, J. M.; Collier, J. H., Fibrillized peptide microgels for cell encapsulation and 3D cell culture. Soft Matter 2011, 7, 6005-6011. 25. Medina, S. H.; Schneider, J. P., Cancer cell surface induced peptide folding allows intracellular translocation of drug. J. Control. Release 2015, 209, 317-326. 26. Altunbas, A.; Lee, S. J.; Rajasekaran, S. A.; Schneider, J. P.; Pochan, D. J., Encapsulation of curcumin in self-assembling peptide hydrogels as injectable drug delivery vehicles. Biomaterials 2011, 32, 5906-5914. 27. Lim, Y.-b.; Lee, M., Nanostructures of β-sheet peptides: steps towards bioactive functional materials. J. Mater. Chem. 2008, 18, 723-727. 28. Nguyen, V. D.; Pal, A.; Snijkers, F.; Colomb-Delsuc, M.; Leonetti, G.; Otto, S.; van der Gucht, J., Multi-step control over self-assembled hydrogels of peptide-derived building blocks and a polymeric cross-linker. Soft Matter 2016, 12, 432-440. 29. Kumar, V. A.; Shi, S.; Wang, B. K.; Li, I. C.; Jalan, A. A.; Sarkar, B.; Wickremasinghe, N. C.; Hartgerink, J. D., Drug-Triggered and Cross-Linked Self-Assembling Nanofibrous Hydrogels. J. Am. Chem. Soc. 2015, 137, 4823-4830. 30. Liu, B.; Lewis, A. K.; Shen, W., Physical Hydrogels Photo-Cross-Linked from SelfAssembled Macromers for Potential Use in Tissue Engineering. Biomacromolecules 2009, 10, 3182-3187. 31. Wan, Y.; Liu, L.; Yuan, S.; Sun, J.; Li, Z., pH-Responsive Peptide Supramolecular Hydrogels with Antibacterial Activity. Langmuir 2017, 33, 3234-3240. 32. Mazunin, D.; Bode, J. W., Potassium Acyltrifluoroborate (KAT) Ligations are Orthogonal to Thiol-Michael and SPAAC Reactions: Covalent Dual Immobilization of Proteins onto Synthetic PEG Hydrogels. Helv. Chim. Acta 2017, 100, e1600311-e1600321. 33. Goor, O. J. G. M.; Keizer, H. M.; Bruinen, A. L.; Schmitz, M. G. J.; Versteegen, R. M.; Janssen, H. M.; Heeren, R. M. A.; Dankers, P. Y. W., Efficient Functionalization of Additives at Supramolecular Material Surfaces. Adv. Mater. 2017, 29, 1604652-1604659. 34. Lee, N. R.; Bowerman, C. J.; Nilsson, B. L., Sequence length determinants for selfassembly of amphipathic β-sheet peptides. J. Pept. Sci. 2013, 100, 738-750. 35. Lee, N. R.; Bowerman, C. J.; Nilsson, B. L., Effects of Varied Sequence Pattern on the Self-Assembly of Amphipathic Peptides. Biomacromolecules 2013, 14, 3267-3277. 36. Bowerman, C. J.; Nilsson, B. L., Review self-assembly of amphipathic β-sheet peptides: Insights and applications. J. Pept. Sci. 2012, 98, 169-184. 37. Bowerman, C. J.; Ryan, D. M.; Nissan, D. A.; Nilsson, B. L., The effect of increasing hydrophobicity on the self-assembly of amphipathic α-sheet peptides. Mol. BioSyst. 2009, 5, 1058-1069. 38. Zhang, S.; Marini, D. M.; Hwang, W.; Santoso, S., Design of nanostructured biological materials through self-assembly of peptides and proteins. Curr. Opin. Chem. Biol. 2002, 6, 865871.

23


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

39. Hwang, W.; Marini, D. M.; Kamm, R. D.; Zhang, S., Supramolecular structure of helical ribbons self-assembled from a β-sheet peptide. J. Chem. Phys. 2003, 118, 389-397. 40. DiMaio, J. T. M.; Raymond, D. M.; Nilsson, B. L., Display of functional proteins on supramolecular peptide nanofibrils using a split-protein strategy. Org. Biomol. Chem. 2017, 15, 5279-5283. 41. Li, B.; Ren, K.; Wang, Y.; Qi, Y.; Chen, X.; Huang, Y., Protein-Cross-Linked Hydrogels with Tailored Swelling and Bioactivity Performance: A Comparative Study. ACS Appl. Mater. Interfaces 2016, 8, 30788-30796. 42. Zhang, X.; Dong, C.; Huang, W.; Wang, H.; Wang, L.; Ding, D.; Zhou, H.; Long, J.; Wang, T.; Yang, Z., Rational design of a photo-responsive UVR8-derived protein and a selfassembling peptide-protein conjugate for responsive hydrogel formation. Nanoscale 2015, 7, 16666-16670. 43. Mosiewicz, K. A.; Johnsson, K.; Lutolf, M. P., Phosphopantetheinyl TransferaseCatalyzed Formation of Bioactive Hydrogels for Tissue Engineering. J. Am. Chem. Soc. 2010, 132, 5972-5974. 44. Lin, Y. A.; Chalker, J. M.; Davis, B. G., Olefin Cross-Metathesis on Proteins: Investigation of Allylic Chalcogen Effects and Guiding Principles in Metathesis Partner Selection. J. Am. Chem. Soc. 2010, 132, 16805-16811. 45. Nielsen, P. E., Peptide Nucleic Acids (PNA) in Chemical Biology and Drug Discovery. Chem. Biodivers. 2010, 7, 786-804. 46. Nielsen, P. E., Peptide Nucleic Acid. A Molecule with Two Identities. Acc. Chem. Res. 1999, 32, 624-630. 47. Braasch, D. A.; Corey, D. R., Synthesis, Analysis, Purification, and Intracellular Delivery of Peptide Nucleic Acids. Methods 2001, 23, 97-107. 48. Hyrup, B.; Nielsen, P. E., Peptide Nucleic Acids (PNA): Synthesis, properties and potential applications. Bioorg. Med. Chem. 1996, 4, 5-23. 49. Thomson, S. A.; Josey, J. A.; Cadilla, R.; Gaul, M. D.; Fred Hassman, C.; Luzzio, M. J.; Pipe, A. J.; Reed, K. L.; Ricca, D. J.; Wiethe, R. W.; Noble, S. A., Fmoc mediated synthesis of Peptide Nucleic Acids. Tetrahedron 1995, 51, 6179-6194. 50. Koch, T.; Naesby, M.; Wittung, P.; Jørgensen, M.; Larsson, C.; Buchardt, O.; Stanley, C. J.; Nordén, B.; Nielsen, P. E.; Ørum, H., PNA-peptide chimerae. Tetrahedron Lett. 1995, 36, 6933-6936. 51. Ratilainen, T.; Holmén, A.; Tuite, E.; Nielsen, P. E.; Nordén, B., Thermodynamics of Sequence-Specific Binding of PNA to DNA. Biochemistry 2000, 39, 7781-7791. 52. Kim, Y.; Hong, I. S., PNA/DNA interstrand cross-links from a modified PNA base upon photolysis or oxidative conditions. Bioorg. Med. Chem. Lett. 2008, 18, 5054-5057. 53. Takiya, T.; Seto, Y.; Yasuda, H.; Suzuki, T.; Kawai, K., Nucl. Acids S. Nucleic Acids Symp. Ser. 2004, 48, 131-132. 54. Bowerman, C. J.; Ryan, D. M.; Nissan, D. A.; Nilsson, B. L., The effect of increasing hydrophobicity on the self-assembly of amphipathic beta-sheet peptides. Mol. Biosyst. 2009, 5, 1058-1069. 55. Swanekamp, R. J.; DiMaio, J. T. M.; Bowerman, C. J.; Nilsson, B. L., Coassembly of Enantiomeric Amphipathic Peptides into Amyloid-Inspired Rippled beta-Sheet Fibrils. J. Am. Chem. Soc. 2012, 134, 5556-5559. 56. Hwang, W.; Marini, D. M.; Kamm, R. D.; Zhang, S., Supramolecular structure of helical ribbons self-assembled from a β-sheet peptide. J. Chem. Phys. 2003, 118, 389-397.

24


Page 24 of 34

Page 25 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

57. Marini, D. M.; Hwang, W.; Lauffenburger, D. A.; Zhang, S.; Kamm, R. D., Left-Handed Helical Ribbon Intermediates in the Self-Assembly of a β-Sheet Peptide. Nano Lett. 2002, 2, 295-299. 58. Mangold, S. L.; Cloninger, M. J., Binding of monomeric and dimeric Concanavalin A to mannose-functionalized dendrimers. Org. Biomol. Chem. 2006, 4, 2458-2465. 59. Mandal, D. K.; Bhattacharyya, L.; Koenig, S. H.; Brown, R. D.; Oscarson, S.; Brewer, C. F., Studies of the Binding Specificity of Concanavalin A. Nature of the Extended Binding Site for Asparagine-Linked Carbohydrates. Biochemistry 1994, 33, 1157-1162. 60. Lim, Y.-b.; Park, S.; Lee, E.; Jeong, H.; Ryu, J.-H.; Lee, M. S.; Lee, M., Glycoconjugate Nanoribbons from the Self-Assembly of Carbohydrate−Peptide Block Molecules for Controllable Bacterial Cell Cluster Formation. Biomacromolecules 2007, 8, 1404-1408. 61. Lim, Y.-b.; Park, S.; Lee, E.; Ryu, J.-H.; Yoon, Y.-R.; Kim, T.-H.; Lee, M., Tunable Bacterial Agglutination and Motility Inhibition by Self-Assembled Glyco-Nanoribbons. Chem. Asian J. 2007, 2, 1363-1369. 62. Bouckaert, J.; Hamelryck, T. W.; Wyns, L.; Loris, R., The crystal structures of Man(alpha1-3)Man(alpha1-O)Me and Man(alpha1-6)Man(alpha1-O)Me in complex with concanavalin A. J. Biol. Chem. 1999, 274, 29188-95.

25


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Pictorial representation of hydrogel viscoelasticity enhancement through bridging of biomolecules appended to supramolecular peptide fibrils via specific interactions. 954x443mm (96 x 96 DPI)


Page 26 of 34

Page 27 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 2. Conceptual illustration of Watson-Crick mediated fibril cross-linking of peptide nucleic acid (PNA) bearing self-assembled Ac-(FKFE)2-NH2 nanofibrils (PPH1/PPH2 nanofibrils) with a bridging oligonucleotide that is complementary to the PPH1 and PPH2 PNA sequences. The bridging oligonucleotide forms selective noncovalent cross-links between fibrils, which strengthens the hydrogel network thereby increasing the emergent hydrogel viscoelasticity. 193x56mm (300 x 300 DPI)


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Chemical structure of the peptide nucleic acid (PNA) aminoethyl glycine backbone and the appended nucleobases. 62x39mm (300 x 300 DPI)


Page 28 of 34

Page 29 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 4. CD spectra and TEM micrographs of Ac-(FKFE)2-NH2 (black) and a combination of Ac-(FKFE)2-NH2, PPH1, and PPH2 (red). All concentrations are 500 µM (total peptide concentration). The combination of Ac(FKFE)2-NH2, PPH1, and PPH2 is a total peptide concentration of 500 µM, but in a ratio of 5 : 1 : 1 (Ac(FKFE)2-NH2 : PPH1 : PPH2). (A) CD spectra; (B) TEM Micrograph of Ac-(FKFE)2-NH2; and (C) TEM micrograph of a combination of Ac-(FKFE)2-NH2, PPH1, and PPH2. 158x50mm (300 x 300 DPI)


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. Dynamic frequency sweep of Ac-(FKFE)2-NH2, PPH1, and PPH2 in the absence of DNA (red) and presence of bridging DNA (black). The combination of Ac-(FKFE)2-NH2, PPH1, and PPH2 is a total peptide concentration of 4.2 mM in a ratio of 5 : 1 : 1 (Ac-(FKFE)2-NH2 : PPH1 : PPH2). 150x149mm (96 x 96 DPI)


Page 30 of 34

Page 31 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 6. Structures of the mannose-bearing peptides and tetrameric ConA. (A) Structure of the mannosebearing (FKFE)2 peptide (Man-(FKFE)2-NH2). (B) Structure of tetrameric ConA. 118x68mm (300 x 300 DPI)


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 7. CD spectrum and TEM micrographs of Man-(FKFE)2-NH2. (A) CD spectrum of Man-(FKFE)2-NH2; (B) TEM micrograph of Man-(FKFE)2-NH2 fibrils without ConA; and (C) TEM micrograph of Man-(FKFE)2-NH2 fibrils with ConA. 157x50mm (300 x 300 DPI)


Page 32 of 34

Page 33 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 8. Dynamic frequency sweep of Man-(FKFE)2-NH2 hydrogels (4.2 mM) in the absence of ConA (red) and presence of ConA (black). 248x244mm (96 x 96 DPI)


Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table of contents figure. 954x443mm (72 x 72 DPI)


Page 34 of 34

Modulating Supramolecular Peptide Hydrogel Viscoelasticity Using

Recommend Documents