Modulation of Intestinal Folate Absorption by Erythropoietin in Vitro

Dec 2, 2013 - Besides the direct stimulation of erythropoiesis, erythropoietin (EPO) therapy in renal anemia may also play a regulatory role in mainta...
9 downloads 10 Views 5MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Modulation of Intestinal Folate Absorption by Erythropoietin in Vitro Junkai Yan, Guiying Jin, Lisha Du, and Qing Yang* State Key Laboratory of Genetic Engineering, Department of Biochemistry, School of Life Sciences, Fudan University, Handan Road 220, Shanghai, China ABSTRACT: Besides the direct stimulation of erythropoiesis, erythropoietin (EPO) therapy in renal anemia may also play a regulatory role in maintaining the homeostasis of hematopoietic nutrients. It has been reported that EPO can stimulate intestinal iron absorption. However, the involvement of EPO in intestinal folate absorption remains elusive. The objective of this study was to investigate the effect of EPO on intestinal transport of folate in vitro and to elucidate the possible mechanism(s) involved in this regulation. Transport assays of folic acid were performed in Caco-2 monolayers treated with EPO. The effect of EPO on the expression of transporters involved in the folate absorption was investigated. The possible involvement of three main EPO signaling pathways, the janus protein tyrosine kinase 2 (JAK-2) pathway, extracellular signal regulated kinases (ERK) pathway, and phosphatidylinositol 3 kinase/Akt (PI3K/Akt) pathway, in the transporter regulation was explored. The absorptive flux (apical to basolateral) of folic acid was enhanced by EPO treatment in a dose-dependent manner, which was companied with the significant up-regulation of reduced folate carrier (RFC) and apical proton coupled folate transporter (PCFT). The efflux (basolaterial to apical) of folic acid was enhanced only by the high dose of EPO treatment, which was associated with the significant up-regulation of apical multidrug resistance-associated protein 2 (MRP2). The expression levels of all of these transporters were up-regulated by EPO treatment in a dose- and time-dependent manner. Transporter expression in response to blocking EPO induced activation of JAK-2, ERK, and PI3K/Akt was changed to a different extent. As a conclusion, intestinal folate absorption was enhanced by EPO treatment in vitro. Our findings provided direct evidence to establish the correlation between EPO and folate homeostasis. KEYWORDS: erythropoietin, folate, Caco-2, PCFT, RFC, MRP2, JAK-2, ERK, PI3k/Akt

■

INTRODUCTION As inadequate production of endogenous erythropoietin (EPO) is the main cause of renal anemia, the development of recombinant EPO therapy represents a great advance in the treatment of renal anemia. Circulating in the plasma, EPO induces the production of red cells in bone marrow after sufficiently binding to erythroid progenitor cells.1 Besides stimulating erythropoiesis directly, EPO may also regulate the homeostasis of such hematopoietic nutrients as iron and folate that modulate the erythropoietic efficiency. Several studies have shown the impact of EPO modulation on the expression of hepatic hepcidin,2−4 a major regulator of body iron homeostasis which acts directly on a number of cell types, in particular iron recycling macrophages5−7 and intestinal epithelial cells.8−10 An in vitro study has suggested that EPO acts directly also on enterocytes to enhance iron absorption, in which the addition of EPO significantly increases the expression of apical divalent metal transporter 1 (DMT1) and basolateral ferroportin and, consequently, iron transport across the Caco-2 monolayer.11 Although these previous studies have revealed that EPO can improve iron homeostasis, the possible role of EPO in regulating folate homeostasis is still unclear. The intestinal “absorption” plays a central role in maintaining folate homeostasis because the vitamin cannot be synthesized in the body and must be obtained from exogenous sources.12 Folate absorption in the intestine occurs via carrier-mediated © 2013 American Chemical Society

process that involves the uptake transporters reduced folate carrier (RFC),13−15 apical proton coupled folate transporter (PCFT),16−18 and an efflux transporter multidrug resistanceassociated protein 2 (MRP2).19 Recent studies in rodent models have suggested a correlation between EPO and intestinal folate absorption. For an example, relatively high levels of serum EPO have been observed in Pcft−/− mice, implying a possible compensation of folate intestinal absorption by EPO.20 In addition, down-regulated expression of folate transporters PCFT and RFC in the intestine has been found in chronic kidney disease (CKD) rats with insufficient production of endogenous EPO.21 Thus, we assume that EPO may directly act on enterocytes and regulate intestinal folate absorption. After successfully binding to an EPO receptor (EPOR), EPO can activate three main signaling pathways: the janus protein tyrosine kinase 2 (JAK-2) pathway, extracellular signal regulated kinases (ERK) pathway, and phosphatidylinositol 3 kinase/Akt (PI3K/Akt) pathway, which subsequently modulate downstream signaling events. The presence of these EPO signaling pathways have been demonstrated both in hematopoietic and nonhematopoietic cells.1,22 Several studies Received: Revised: Accepted: Published: 358

May 28, 2013 November 25, 2013 November 27, 2013 December 2, 2013 dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366

Molecular Pharmaceutics

Article

(NUNC, Roskilde, Denmark). Cells were grown up to 80% confluence and exposed to various concentrations of EPO (0.3, 1, and 3 U/mL dissolved in serum-free medium) for 48 h. When inhibitors were used, JAK-2 inhibitor AG490 (40 μM), ERK inhibitor PD98059 (25 μM), and PI3K/Akt inhibitor LY294002 (10 μM) were added to the medium 1 h prior to the addition of EPO. As the stock solution of inhibitors was dissolved in DMSO, an equal volume of DMSO (final concentration < 0.1%) was added to the control cells. For determining the long-term impacts of physiological dose EPO, Caco-2 cells were grown in 6-well culture plates in the presence or absence of EPO (10 mU/mL) for 15 days. Transport Studies. Transport of folic acid across the Caco-2 cell monolayers was studied using monolayers 21−24 days post seeding as described previously.26 Before the experiments, the monolayers were washed twice with Hank’s balanced salt solution (HBSS, pH 7.4). After being washed, the monolayers were preincubated at 37 °C for 20 min, and TEER was measured. The HBSS solution on both sides of the cell monolayers was then removed by aspiration. For the measurement of the apical (AP) to basolateral (BL) transport (AP→BL), 0.4 mL of HBSS containing folic acid (10 μM, pH 6.0) was added to the AP side, and 0.6 mL of blank HBSS (pH 7.4) was added to the BL side. For the measurement of the BL to AP transport (BL→AP), 0.6 mL of HBSS containing folic acid (10 μM, pH 7.4) was added to the BL side, and 0.4 mL of blank HBSS (pH 6.0) was added to the AP side. Folic acid solutions were freshly prepared dissolving it in dimethyl sulfoxide (DMSO). The final concentration of DMSO in the HBSS was below 0.1%. The monolayers were incubated at 37 °C and placed in a shaker (60 rpm) during the transport process to minimize the influence of aqueous boundary layer. Samples were taken from the receiver compartment at 30, 60, 90, and 120 min followed by an immediate replacement of the same volume of prewarmed fresh HBSS. HPLC Analysis of Folic Acid. An 80 μL aliquot of the samples obtained from the receiver compartment was directly injected into the HPLC column. The analysis was performed on an Agilent 1260 series HPLC system (Agilent Corp, USA) equipped with a quat pump and a UV detector. The detection wavelength was 280 nm. HPLC analysis of the samples was performed using an Agilent C18 column (5 μm particle size, L × I.D. 25 cm × 4.6 mm) preceded by a C18 guard column (Dikma, China). The mobile phase was a mixture of acetonitrile/50 mM KH2PO4 (adjusted to pH 6.3) (5:95, v/v). The retention time of folic acid was 8.5 min, and the standard curve of folic acid was linear within the range 0.01−5 μg/mL (r2 = 0.999). Calculations. The apparent permeability coefficients (Papp coefficients) were calculated for the directional flux studies according to the following equation:27

revealed regulatory effects of these pathways on the expression of folate transporters. MRP2 expression can be regulated via the PI3K/Akt pathway.23 PCFT is claimed to be a nuclear respiratory factor-1 (NRF-1) responsive gene,24 which can be activated by EPO via the Akt signaling pathway.25 In this study, human intestinal-derived Caco-2 cells expressing endogenous RFC, PCFT, MRP2, and EPOR were used as an in vitro enterocyte model to clarify the possible role of EPO in intestinal folate absorption. Transport assays of folic acid were performed in Caco-2 monolayers with or without the supplement of EPO. The expression profiles of three folate transporters PCFT, RFC, and MRP2 upon to EPO treatment were examined. The possible involvement of three main EPO signaling pathways JAK-2, ERK, and PI3/Akt in the transporter regulation was explored.

■

EXPERIMENTAL SECTION Reagents. Folic acid (HPLC purity: >97%) was obtained from Sigma-Aldrich (St Louis, MO). Recombinant human erythropoietin (3000 IU) was obtained from Shanghai Ninth People’s Hospital Affiliated Shanghai Jiaotong University School of Medicine (Shanghai, China). Routine biochemicals, fetal bovine serum (FBS), cell culture reagents, and acetonitrile (high-performance liquid chromatography (HPLC) grade) were purchased from Thermo Scientific (Tustin, CA) and Sigma-Aldrich (St. Louis, MO). Antibodies were obtained from the following sources: polyclonal rabbit anti-HCP1/PCFT antibody from Abcam (UK); polyclonal rabbit anti-RFC antibody from Abcam (UK); polyclonal rabbit anti-MRP2 antibody from CST (USA); monoclonal mouse anti-GAPDH antibody from Beyotime (China); polyclonal rabbit anti-JAK-2 antibody and polyclonal rabbit antiphospho-JAK-2 (Tyr1007+Tyr1008) antibody from Abcam (UK); polyclonal rabbit anti-ERK antibody and monoclonal mouse antiphospho-ERK (Thr202/Tyr204) antibody from CST (USA); polyclonal rabbit anti-Akt antibody and polyclonal rabbit antiphospho-Akt (Ser-473) antibody from CST (USA). Cell Culture. The Caco-2 cell line was obtained from American Type Culture Collection (ATCC, USA). The cells were grown routinely in culture flasks in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) FBS, 1% (v/v) nonessential amino acid solution (NEAA), and 0.1% (v/v) penicillin−streptomycin at 37 °C in an atmosphere of 5% CO2 and 90% relative humidity. The medium was replaced every 2−3 days after incubation. Cells were passaged every 5 days approximately between 70%−80% confluence at a split ratio of 1:5, using 0.25% trypsin and 0.02% ethylenediaminetetraacetic acid (EDTA). For the transport experiments, the cells of passages between 32 and 40 were seeded at a density of 1.0 × 105 cells/cm2 onto a Transwell insert (0.6 cm2, 0.4 um pore size, Millipore, USA) in 24-well culture plates (NUNC, Roskilde, Denmark). The media in the culture plates was changed every 2 days for the first week following seeding and then was replaced every day. Testing cell monolayer integrity on Transwell inserts was done by measuring transepithelial electrical resistance (TEER) across the cell monolayer at 37 °C using a Millicell-ERS apparatus (Millipore, USA). Only monolayers displaying TEER values above 300 Ω·cm2 were considered not leaky. In our culture condition, Caco-2 monolayers post seeding between 21 and 24 days usually were available for the experiments. To ensure the integrity of the monolayers, the TEER value was measured again right before the transport assay. Treatment with EPO and EPO Signaling Pathway Inhibitors. Caco-2 cells were treated in 6-well culture plates

Papp = (dQ /dt )/(AC0)

(1)

where the dQ/dt (mg/min) is the drug permeation rate, A is the cross sectional area (0.6 cm2), and C0 (μg/mL) is the initial folic acid concentration in the donor compartment at t = 0 min. However, if under the nonlinear condition, then Papp is determined by nonlinear curve fitting of the following equation: C R (t ) = [M /(VD + VR )] + {C R,0 − [M /(VD + VR )]} × exp[−PappA(1/VD + 1/VR )t ]

(2)

where VD is the volume of the donor compartment, VR is the volume of the receiver compartment, A is the cross sectional 359

dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366

Molecular Pharmaceutics

Article

area (0.6 cm2), M is the total amount of folic acid in the system, CR,0 is the concentration of folic acid in the receiver compartment at the start of the time interval, and CR(t) is the concentration of folic acid at time t measured from the start of the time interval. Quantitative Real-Time PCR. Total RNA was extracted from Caco-2 cells using Trizol (Invitrogen, USA), and cDNA was synthesized using a kit (Invitrogen, USA). PCR was performed in triplicate using the SYBER Green PCR Master Mix kit (Invitrogen, USA); β-actin was used as an internal control. The amplification program consisted of activation at 95 °C for 5 min, followed by 40 amplification cycles, each consisting of 95 °Cfor 15 s then 60 °C for 1 min. The primers used for the analyses are shown in Table 1. Data were analyzed using My IQ software (Bio Rad, Germany).

diluted 10000-fold) was performed as loading control. Band densities were semiquantified using ImageQuant software (GE Healthcare, USA). To determine the activation of EPO signaling pathways, cell lysates were obtained by incubating the cells in the lysis buffer containing 1% NP-40, 50 mM Tris pH 7.4, 150 mM NaCl, 2 mM EDTA, and a cocktail of protease inhibitors (2 mM PMSF, 1 mM sodium vanadate, and 1 mM sodium fluoride) on ice for 20 min. An equivalent amount of protein (50 μg) was subjected to 10% SDS-PAGE gel electrophoresis and then transferred to PVDF membranes. The primary antibodies were diluted 500−1000-fold for use: polyclonal rabbit anti JAK-2 (diluted 500-fold, Abcam, USA); polyclonal rabbit anti phospho-JAK-2 (diluted 500-fold, Abcam, USA); polyclonal rabbit anti ERK (diluted 1000-fold, CST, USA); monoclonal mouse anti phospho-ERK (diluted 1000-fold, CST, USA); polyclonal rabbit anti Akt (diluted 1000-fold, CST, USA) and polyclonal rabbit anti phospho-Akt (diluted 500-fold, CST, USA). GAPDH was performed as loading control. The other process was similar to that described above. Pravastatin Efflux Assay. Caco-2 cells were treated in 6-well culture plates. When grown up to 80% confluence, cells were exposed to EPO (3 U/mL) for 48 h. For experiments, Caco-2 cells were washed with PBS and subsequently incubated in 1 mL of culture medium containing 0.1 mM of pravastatin in the dark at 37 °C for 1 h. Afterward the cells were washed with fresh ice-cold culture medium to remove nonabsorbed pravastatin, collected and suspended in 1 mL culture medium, and then quickly divided into two aliquots (0.5 mL each). One aliquot (0.5 mL, used for uptake study) was homogenized with an Ultra Turrax homogenizer (2 × 30 s, pulses on full speed). Released pravastain was determined by HPLC 29 and normalized to the protein content determined by Bradford method with bovine serum albumin as the standard.30 The other aliquot (0.5 mL used for efflux assay) was incubated at 4 °C for 20 min. After 20 min incubation, cells were quickly centrifuged, and 20 μL of supernatant was taken out for pravastatin analysis. Cells were homogenized, and the protein content was determined. The efflux rate was defined as (C20V20 − C0V0)/P, where C0 and C20 are the concentrations of pravastatin in the culture medium determined by HPLC at 0 min and at 20 min, respectively, V0 and V20 are the volumes of medium at 0 min and at 20 min, respectively, and P refers to the protein content. Statistical Analysis. Data in the figures and text are expressed as means ± standard error of the mean (SEM) of at least three experiments each performed in triplicate. Comparisons between group means were performed by a Student’s two-tailed t-test. A significant difference between means was considered to be present when P < 0.05.

Table 1. Primers Used for Quantitative Real-Time PCR Analysis in Caco-2 Cells gene

primer sequence (5′-3′)

amplicon size

PCFT

F: GGCATCTTCAACTCACTCTAC R: GGTGTTCACTTTGCTCCTC F: GGGGCTGGTCTTCCTTCTG R: CGTCCGAGACAATGAAAGTGAT F: CTCACTTCAGCGAGACCG R: CTCACCAGCCAGTTCAGG F: GGTGCTGGACAAATGGTT R: TTAGGTGGGGTGGGGTAG F: GCTACGAGCTGCCTGACG R: AGAAGCATTTGCGGTGGA

205

RFC MRP-2 EPOR β-actin

220 288 250 411

Western Blot Analysis. To determine the protein expression of folate transporters, total plasma membrane proteins from Caco-2 cells were prepared as described previously.28 Briefly, the membranous fractions were isolated by homogenizing the cells in a buffer containing 300 mM mannitol, 5 mM EGTA, and 12 mM Tris-HCl as well as a cocktail of protease inhibitors (1 mM PMSF, 1 μg/mL aprotinin, and 0.5 μg/mL leupeptin). After precipitation of unbroken cells and nuclei by centrifugation, the resulting supernatant was centrifuged for 60 min at 18 000 g to give a total plasma membrane protein, which was resuspended in phosphate-buffered saline containing a protease inhibitor cocktail and 1% sodium dodecyl sulfate. Protein (50 μg) samples were treated with Laemmli sample buffer and subjected to a 10% sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS-PAGE) gel. After electrophoresis, the proteins were electroblotted on the polyvinylidene difluoride (PVDF) membrane, washed twice with phosphate-buffered saline (PBS)−Tween20 for 10 min, and blocked with 5% dried milk in PBS−Tween 20. The immobilized proteins were exposed to commercially available antibodies of PCFT (polyclonal rabbit anti-HCP1/PCFT antibody, Abcam, USA, diluted 4000-fold), RFC (polyclonal rabbit anti-RFC antibody from Abcam, USA, diluted 4000-fold), and MRP2 (polyclonal rabbit anti-MRP2 antibody, CST, USA, diluted 4000-fold). Immunodetection was performed with goat antirabbit immunoglobin G conjugated to horseradish peroxidase (diluted 4000-fold in PBS-Tween 20) with the use of an enhanced chemiluminescence detection system (GE Healthcare, USA). Specific bands were scanned with the use of Typhoon FLA9000 system (GE Healthcare, USA). Western blotting for GAPDH (monoclonal mouse anti-GAPDH antibody, Beyotime, China,

■

RESULTS Effect of EPO on the Transport of Folic Acid. The time course of folic acid transport was examined after addition of 10 μM folic acid to either apical compartment or basolateral compartment of the Caco-2 monolayers. As can be seen, the nonlinear incline of folic acid transport in the uptake direction (AP→BL) over the period of 2 h in control cells was significantly increased in a dose-dependent manner by EPO treatment (0.3, 1, and 3 U/mL) (Figure 1A). Specifically, the cumulative amount of folic acid transport in the uptake direction was 117.9 ± 15.8 pmol/monolayer for control cells, and 154.7 ± 8.4 pmol/monolayer, 189.9 ± 6.8 pmol/monolayer, and 258.0 ± 7.6 pmol/monolayer for the cells treated by EPO with 0.3 U/mL, 1 U/mL, and 3 U/mL, respectively (Figure 1B). 360

dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366

Molecular Pharmaceutics

Article

Figure 1. Effect of EPO on the transport of folic acid across Caco-2 cell monolayers. Caco-2 cells were exposed to EPO (0.3, 1, and 3 U/mL added to the basolateral medium) for 48 h. Samples were taken from the receiver compartment at 30, 60, 90, and 120 min after the addition of 10 μM folic acid to the apical or basolateral compartment. A: EPO treatment increased the AP→BL transport of folic acid in a dose-dependent manner over the period of 2 h. B: The cumulative amount of folic acid transport in the uptake direction was 117.9 ± 15.8 pmol/monolayer for control cells and 154.7 ± 8.4 pmol/monolayer, 189.9 ± 6.8 pmol/monolayer, and 258.0 ± 7.6 pmol/monolayer for the cells treated by EPO with 0.3 U/mL, 1 U/mL, and 3 U/mL, respectively. C: Only high dose (3 U/mL) EPO treatment significantly increased the BL→AP transport of folic acid over the period of 2 h, while low doses (0.3, 1 U/mL) of EPO treatment had no significant effect. D: The cumulative amount of folic acid transport in the efflux direction over the period of 2 h was 86.4 ± 4.2 pmol/monolayer for control cells and 96.2 ± 18.2 pmol/monolayer, 104.3 ± 27.9 pmol/monolayer, and 135.6 ± 20.5 pmol/monolayer for the cells treated by EPO with 0.3 U/mL, 1 U/mL, and 3 U/mL, respectively. E: Apparent permeability coefficients (Papp) of AP→BL or BL→AP at each designed time point were calculated according to either eq 2 or 1 as described in “Calculations”. F: Ratios of Papp(AP→BL)/Papp(BL→AP) at each designed time point were compared among the control cells and the EPO treated cells. All experiments were run on at least three separate occasions. Data are means ± SEM of 4−6 observations in each group. *p < 0.05, **p < 0.01.

designed time point regardless of EPO treatment, while the Papp values were increased by EPO treatment in a dose-dependent manner at each designed time point. Furthermore, the ratios of Papp in the uptake direction versus that in the efflux direction, representing the net intestinal absorption of folic acid, are shown in Figure 1F. As indicated, no significant differences of the Papp ratios were observed between the EPO treated cells and control cells at the early time points (30 and 60 min). However, at the late time points (90 and 120 min) these ratios were increased by EPO treatment in a dose-dependent manner. Taken together, these results clearly revealed a positive role of EPO treatment in facilitating intestinal folate absorption. Effect of EPO on the Expression of Folate Transporters. Folate transport across the intestinal epithelium is mediated by PCFT and RFC, which facilitate the absorption of folate at the apical membrane, as well as MRP2 which opposes the absorption of folate.12 In preliminary study, we confirmed the expression of folate transporters and EPO receptor in Caco-2 cells by semiquantitative reverse transcription−polymerase chain

On the other hand, the linear incline of folic acid transport in an efflux direction (BL→AP) over the period of 2 h in control cells was significantly increased only by the high dose of EPO (3 U/mL), but not by the low doses (0.3 and 1 U/mL) of EPO treatment (Figure 1C). Specifically, the cumulative amount of folic acid transport in the efflux direction over the period of 2 h was 86.4 ± 4.2 pmol/monolayer for control cells and 96.2 ± 18.2 pmol/monolayer, 104.3 ± 27.9 pmol/monolayer, and 135.6 ± 20.5 pmol/monolayer for the cells treated by EPO with 0.3 U/mL, 1 U/mL, and 3 U/mL, respectively (Figure 1D). The Papp values at each time point in the uptake (AP→BL) or the efflux (BL→AP) direction were calculated according to eq 2 (nonlinear condition) or eq 1 (linear condition) and listed in Figure 1E. As indicated, in the uptake direction the Papp values were decreased in a time-dependent manner regardless of EPO treatment, while the Papp values were increased by EPO treatment in a dose-dependent manner at each designed time point (30, 60, 90, and 120 min). On the other hand, in the efflux direction the Papp values were remained almost constant at each 361

dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366

Molecular Pharmaceutics

Article

Figure 2. Effect of EPO on the folate transporter expression in Caco-2 cells. A: The expression of EPO-receptor (EPOR) and folate transporters in Caco-2 cells was detected by RT-PCR: left→right: PCFT (205 bp), RFC (220 bp), β-actin (411 bp), MRP2 (288 bp), and EPOR (250 bp). B: To investigate the effect of EPO dose on the protein expression of PCFT, RFC, and MRP2, Western blot analysis was performed with the membranous fractions from control cells and the cells exposed to 0.3, 1, and 3 U/mL EPO for 48 h. The protein expression levels of these three transporters were all increased by EPO treatment in a dose-dependent manner. C: To investigate the effect of EPO incubation time on the protein expression of PCFT, RFC and MRP2, Western blot analysis was performed with the membranous fractions from control cells and the cells exposed to 1 U/mL EPO for 4, 24, and 48 h. The protein expression levels of these three transporters were all increased by EPO treatment in a time-dependent manner. D: To investigate the effect of EPO dose on the mRNA expression of PCFT, RFC, and MRP2, quantitative real-time PCR was performed with the mRNA isolated from control cells and the cells exposed to 0.3, 1, and 3 U/mL EPO for 48 h and the specific primers as shown in Table 1. The results showed that the mRNA expression levels of PCFT and RFC were increased by EPO treatment in a dose-dependent manner, but the mRNA expression of MRP2 was increased only by the high dose of EPO treatment. E: To investigate the effect of EPO incubation time on the mRNA expression of PCFT and RFC, quantitative real-time PCR was performed with the mRNA isolated from control cells and the cells exposed to 1 U/mL EPO for 4, 24, and 48 h. The results showed that the significant changes of PCFT and RFC mRNA expression were only observed in the cells exposed to EPO for 48 h. No effects were observed at the time point of 4 h. Though the mRNA levels of PCFT and RFC were increased at 24 h, these alterations had no statistical difference. Images are representative results of three independent experiments. Values from three independent experiments are presented as means ± SEM, *p < 0.05, **p < 0.01.

time course study to examine the effect of EPO treatment on the regulation of transporter expression. As can be seen, the protein expression levels of PCFT, RFC, and MRP2 were increased by EPO treatment (1 U/mL) in a time-dependent manner (Figure 2C). Quantitative real-time PCR studies further substantially mirrored the above results of Western blot analysis. As indicated, the

reaction (RT-PCR) analysis (Figure 2A). Subsequent Western blot analysis showed that the protein expression levels of PCFT, RFC, and MRP2 were increased by EPO treatment in a dosedependent manner (Figure 2B). Since the lowest concentration of EPO to elicit a significant increase in the expression of these transporters was 1 U/mL, this concentration was used in the 362

dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366

Molecular Pharmaceutics

Article

(B) Involvement of Signaling Pathway in the Regulation of Folate Transporter Expression. Kinase inhibitors were used to assess the roles of the activated signaling pathways in mediating the regulation of folate transporter expression in Caco-2 cells. Concentrations of three inhibitors, JAK-2 inhibitor AG490 (40 μM), ERK inhibitor PD98059 (25 μM), and PI3K inhibitor LY294002 (10 μM), which inhibit JAK-2, ERK, and PI3K, in the JAK-2, ERK, and PI3K/Akt pathways, respectively, were optimized to determine the lowest concentration required to abolish EPO-induced signaling but without significantly affecting the other pathways. As shown in Figure 4B, the inhibitors at the optimal concentration only inhibited their target pathways. These inhibitors were then used to investigate the possible roles of these three signaling pathways in regulating folate transporter expression. As shown in Figure 4C, PCFT was up-regulated by EPO treatment; however, this effect was abolished by blocking of JAK-2 pathway and strengthened by blocking of either ERK or PI3K/ Akt pathway. These results suggested a positive role of JAK-2 pathway and a negative role of ERK or PI3K/Akt pathway in regulating PCFT expression. RFC was also up-regulated by EPO treatment; however, this effect was weakened by blocking of either ERK or PI3/Akt pathway, indicating their positive roles in RFC regulation. MRP2 was also up-regulated by EPO treatment; however, this effect was weakened by blocking of JAK-2 pathway but strengthened by blocking of ERK and not affected by blocking of PI3K/Akt. These results indicated a positive role of JAK-2 pathway and a negative role of ERK in regulating MRP2 expression. Long-Term Impact of the Physiological Dose of EPO (10 mU/mL) on Folate Transporter Expression. To evaluate the physiological role of EPO in intestinal folate absorption, we analyzed the long-term impact of the physiological dose of EPO (10 mU/mL) on folate transporter expression in Caco-2 cells. As can be seen, on the mRNA levels of PCFT and RFC there were no significant alterations over the period of 96 h by EPO treatment (Figure 5A). Similarly, on the protein levels of PCFT and RFC there were no significant alterations over the period of 15 d by EPO treatment either (Figure 5B).

mRNA expression levels of PCFT and RFC were increased by EPO treatment in a dose-dependent manner; however, the increased expression level of MRP2 was only observed in the cells exposed to the high dose (3 U/mL) of EPO (Figure 2D). Interestingly, the significant changes of PCFT and RFC expression on the mRNA levels were only observed in the cells exposed to EPO (1 U/mL) for 48 h, while no significant alterations were observed at the early time points (4 and 24 h, Figure 2E). Effect of EPO on MRP2 Functionality. Since folic acid is not a specific substrate for MRP2, to fully address the effect of EPO on MRP2 functionality, we also measured an uptake and an efflux of pravastatin (MRP2 specific substrate) in Caco-2 cells treated by EPO. As shown, MRP2 functionality was up-regulated by EPO treatment (3 U/mL for 48 h), consistent with its expression alterations (described in Figure 2). As can be seen, pravastatin uptake by EPO treated cells was significantly (P < 0.05) lower than that by control cells (192.59 ± 18.24 pmol/mg protein and 225.12 ± 4.25 pmol/mg protein, respectively) (Figure 3A). On

Figure 3. Effect of EPO on MRP2 functionality in Caco-2 cells. Caco2 cells were exposed to EPO (3 U/mL) for 48 h prior to this study. A: Caco-2 cells were incubated at 37 °C in DMEM containing 0.1 mM pravastatin. After 1 h of incubation, uptake of pravastatin by EPO treated cells was approximately 14.7% lower than that by control cells. B: Subsequent efflux assay was performed as described in the Pravastatin Efflux Assay section. After 20 min of incubation, the efflux rate of EPO treated cells was approximately 18.6% higher than that of control cells. Data are means ± SEM of three observations in each group. *p < 0.05.

■

DISCUSSION Our aims in this study were to examine the effect of EPO on intestinal folate absorption and to address the possible mechanisms involved in this regulation. As known, EPO therapy is widespread in patients with renal anemia, but its effectiveness varies individually. Folate deficiency is one of the influencing factors that may affect the EPO induced erythropoiesis process. We suppose EPO may play a protective role in regulating intestinal folate absorption so as to prevent folate deficiency. To address this issue, the present study was designed with the intestinal epithelial Caco-2 cells as a model, which has been shown to be excellent in vitro for investigating physiologic and molecular aspects of nutrient transport with the results similar to those obtained from native human intestinal epithelia.31 In the present study, the folic acid concentration of 10 μM was used to minimize the contribution of the folate receptor α (FRα) mediated uptake of folate because Caco-2 cells, but not the normal intestinal epithelial cells, express FRα with the apparent dissociation constant of Kd ≈ 10 nM;28,32 and the apparent Km values of the RFC and the PCFT in the cells are known to be within the micromolar range.13,16,33 Additionally, we also investigated the expression of FRα under EPO

the other hand, the efflux rate of pravastatin by EPO treated cells was significantly (p < 0.05) higher than that of control cells (38.93 ± 2.16 pmol/5 min/mg protein and 32.82 ± 0.98 pmol/5 min/mg protein, respectively) (Figure 3B). Signaling Pathways Mediating the EPO Response. (A) Activation of Three Signaling Pathways by EPO Treatment. We investigated the possible roles of three main EPO signaling pathways (JAK-2, ERK, and PI3K/Akt) in the regulation of folate transporter in Caco-2 cells. First of all, we confirmed the activation of these signaling proteins (JAK-2, ERK, and Akt) in the cells by examining their phosphorylation. Caco-2 cells were exposed to EPO (3 U/mL) for various times (0, 5, 15, 30, and 60 min), and followed by determining the phosphorylation levels and the total amount of these three signaling proteins. As shown in Figure 4A, no changes of total amount of JAK-2, ERK, and Akt were found within the first 60 min exposed to EPO (panels 1, 3, and 5, respectively); however, their phosphorylation levels were evident already at 15 min after EPO stimulation and decreased until 60 min (highlighted, panels 2, 4, and 6 for phosphorylation of JAK-2, ERK, and Akt, respectively). 363

dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366

Molecular Pharmaceutics

Article

Figure 4. Signaling pathways mediating the effect of EPO on folate transporter expression in Caco-2 cells. A: EPO-induced activation of JAK-2, ERK, and Akt pathways was investigated by Western blot analysis. Caco-2 cells were exposed to EPO (3 U/mL) for various time (0, 5, 15, 30, and 60 min), followed by determining the phosphorylation levels and total amount of JAK-2, ERK, and Akt. B: Specific inhibitors were added to the medium 1 h prior to the addition of EPO. AG490 (40 μM), PD98059 (25 μM), and LY294002 (10 μM) were used for blocking the activation of JAK-2, ERK, and PI3K/Akt pathways, respectively. At these concentrations, only the targeted pathway showed significantly reduced signaling capacity (dashed box). C: Specific inhibitors AG490 (40 μM), PD98059 (25 μM), and LY294002 (10 μM) were added to the medium 1 h prior to the addition of EPO for blocking the activation of JAK-2, ERK, and PI3K/Akt pathways, respectively. After the 48 h incubation, quantitative real-time PCR was performed to determine the relative expression of PCFT, RFC, and MRP2. Data are means ± SEM of 3−4 observations in each group. *P < 0.05, **p < 0.01, ***p < 0.001.

manner, which was companied with an increase in the expression levels of PCFT and RFC. However, PCFT contributed predominantly because AP→BL transport was measured with the apical compartment at pH 6 and RFC does not operate at that pH. On the other hand, the BL→AP transport of folic acid in the cells exposed to the high dose (3 U/mL) of EPO was also significantly higher than that in the control cells, which was associated with an increase in the expression level of MRP2. One aspect of evaluating MRP2 functionality requires comment. Though folic acid is a substrate for MRP2, it is not a specific one. Therefore, we conducted an efflux assay of pravastatin (a specific compound exported from cytoplasm via MRP2) to validate the effect of EPO on MRP2 regulation. Consistent with its Western blot analysis, pravastain uptake was significantly decreased after EPO treatment (3 U/mL, for 48 h), while the pravastatin efflux was significantly increased. These results strongly demonstrated that the expression of MRP2 was up regulated by the high dose of EPO treatment. In summary, our data not only suggest that EPO may facilitate intestinal folate uptake but also make an important note that high dose EPO may affect folate transport bidirectionally, both uptake and efflux. Detailed studies in hematopoietic and nonhematopoietic cells have demonstrated that EPO can activate a number of cell signaling pathways, once successfully binding to EPO receptor, and in turn modulate downstream gene expression or downstream signaling events. To address the possible roles of EPO signaling pathways in regulating the expression of folate transporters, we used specific inhibitors to block the EPO-induced activation of JAK-2, ERK, and PI3/Akt pathways. In comparison to the cells exposed to EPO alone, the expression levels of folate transporters were dramatically changed to different extent when specific inhibitors were used, which suggested complicated regulation systems involved in EPO response. Our data suggest that JAK-2 activation may contribute to the up-regulation of PCFT and MRP2 expression; ERK activation may contribute to the upregulation of RFC expression and down-regulation of PCFT and

Figure 5. Long-term impact of the physiological dose of EPO (10 mU/mL) on folate transporter expression in Caco-2 cells. Caco-2 cells were grown in 6-well plates and coincubated with or without EPO (10 mU/mL) for 15 days. (A) Quantitative real-time PCR studies were performed at 2, 12, 24, 48, and 96 h post seeding. Data were normalized by the control and presented as a solid line (PCFT) and dotted line (RFC). No significant differences were observed over the period of 96 h. (B) Western blot analysis was performed on the 5th day, 10th day, and 15th day post seeding. No significant differences were observed between the EPO treated cells and control cells. Images are representative results of three independent experiments. Values from three independent experiments are presented as means ± SEM.

treatment in preliminary experiment. The result was that neither mRNA expression nor protein expression of FRα was changed under EPO treatment (0.3, 1, and 3 U/mL for 48 h, data not shown). Taken together, it is reasonable to assume that under our experimental conditions of 10 μM folic acid, the transport of folic acid is mainly mediated via the RFC and PCFT systems, and the observed regulation is mainly resulted from the activity changes in these systems. Our results with transport studies showed that EPO treatment (0.3, 1, and 3 U/mL, for 48 h) significantly increased the AP→BL transport of folic acid in a dose-dependent 364

dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366

Molecular Pharmaceutics

Article

(7) Delaby, C.; Pilard, N.; Goncalves, A. S.; Beaumont, C.; CanonneHergaux, F. Presence of the iron exporter ferroportin at the plasma membrane of macrophages is enhanced by iron loading and downregulated by hepcidin. Blood 2005, 106, 3979−3984. (8) Mena, N. P.; Esparza, A.; Tapia, V.; Valdes, P.; Nunez, M. T. Hepcidin inhibits apical iron uptake in intestinal cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2008, 294, G192−G198. (9) Laftah, A. H.; Ramesh, B.; Simpson, R. J.; Solanky, N.; Bahram, S.; Schumann, K.; Debnam, E. S.; Srai, S. K. Effect of hepcidin on intestinal iron absorption in mice. Blood 2004, 103, 3940−3944. (10) Yamaji, S.; Sharp, P.; Ramesh, B.; Srai, S. K. Inhibition of iron transport across human intestinal epithelial cells by hepcidin. Blood 2004, 104, 2178−2180. (11) Srai, S. K.; Chung, B.; Marks, J.; Pourvali, K.; Solanky, N.; Rapisarda, C.; Chaston, T. B.; Hanif, R.; Unwin, R. J.; Debnam, E. S.; Sharp, P. A. Erythropoietin regulates intestinal iron absorption in a rat model of chronic renal failure. Kidney Int. 2010, 78, 660−667. (12) Zhao, R.; Matherly, L. H.; Goldman, I. D. Membrane transporters and folate homeostasis: intestinal absorption and transport into systemic compartments and tissues. Expert Rev. Mol. Med. 2009, 11, e4. (13) Said, H. M. Recent advances in carrier-mediated intestinal absorption of water-soluble vitamins. Annu. Rev. Physiol. 2004, 66, 419−446. (14) Balamurugan, K.; Said, H. M. Role of reduced folate carrier in intestinal folate uptake. Am. J. Physiol. Cell Physiol. 2006, 291, C189− C193. (15) Sirotnak, F. M.; Tolner, B. Carrier-mediated membrane transport of folates in mammalian cells. Annu. Rev. Nutr. 1999, 19, 91−122. (16) Qiu, A.; Jansen, M.; Sakaris, A.; Min, S. H.; Chattopadhyay, S.; Tsai, E.; Sandoval, C.; Zhao, R.; Akabas, M. H.; Goldman, I. D. Identification of an intestinal folate transporter and the molecular basis for hereditary folate malabsorption. Cell 2006, 127, 917−928. (17) Zhao, R.; Min, S. H.; Wang, Y.; Campanella, E.; Low, P. S.; Goldman, I. D. A role for the proton-coupled folate transporter (PCFT-SLC46A1) in folate receptor-mediated endocytosis. J. Biol. Chem. 2009, 284, 4267−4274. (18) Qiu, A.; Min, S. H.; Jansen, M.; Malhotra, U.; Tsai, E.; Cabelof, D. C.; Matherly, L. H.; Zhao, R.; Akabas, M. H.; Goldman, I. D. Rodent intestinal folate transporters (SLC46A1): secondary structure, functional properties, and response to dietary folate restriction. Am. J. Physiol. Cell Physiol. 2007, 293, C1669−C1678. (19) Mottino, A. D.; Hoffman, T.; Jennes, L.; Vore, M. Expression and localization of multidrug resistant protein mrp2 in rat small intestine. J. Pharmacol. Exp. Ther. 2000, 293, 717−723. (20) Salojin, K. V.; Cabrera, R. M.; Sun, W.; Chang, W. C.; Lin, C.; Duncan, L.; Platt, K. A.; Read, R.; Vogel, P.; Liu, Q.; Finnell, R. H.; Oravecz, T. A mouse model of hereditary folate malabsorption: deletion of the PCFT gene leads to systemic folate deficiency. Blood 2011, 117, 4895−4904. (21) Bukhari, F. J.; Moradi, H.; Gollapudi, P.; Ju, K. H.; Vaziri, N. D.; Said, H. M. Effect of chronic kidney disease on the expression of thiamin and folic acid transporters. Nephrol. Dial Transplant. 2011, 26, 2137−2144. (22) Szenajch, J.; Wcislo, G.; Jeong, J. Y.; Szczylik, C.; Feldman, L. The role of erythropoietin and its receptor in growth, survival and therapeutic response of human tumor cells From clinic to bench - a critical review. Biochim. Biophys. Acta 2010, 1806, 82−95. (23) Role of PI3KAkt and MEKERK signaling pathways in sulforaphane- and erucin-induced phase II enzymes and MRP2 transcription, G2M arrest, and cell death in Caco-2 cells. (24) Gonen, N.; Assaraf, Y. G. The obligatory intestinal folate transporter PCFT (SLC46A1) is regulated by nuclear respiratory factor 1. J. Biol. Chem. 2010, 285, 33602−33613. (25) Carraway, M. S.; Suliman, H. B.; Jones, W. S.; Chen, C. W.; Babiker, A.; Piantadosi, C. A. Erythropoietin activates mitochondrial biogenesis and couples red cell mass to mitochondrial mass in the heart. Circ. Res. 2010, 106, 1722−1730.

MRP2 expression; PI3K/Akt activation may contribute to the down-regulation of PCFT and up-regulation of RFC expression but has no effect on MRP2 expression. It is known that erythropoietin levels in the absence of anemia are quite low (at around 10 mU/mL blood); however, in the presence of hypoxic stress, EPO production may increase a 1000-fold, reaching 10 000 mU/mL blood.34,35 Interestingly, compared with those significant effects induced by the pharmacological doses of EPO (0.3, 1, and 3 U/mL), the physiological dose (10 mU/mL) of EPO had no significant effect on the expression of folate transporters in Caco-2 cells. This phenomenon suggested that EPO response in enterocytes could be considered as a stress response that facilitates folate absorption to avoid its deficiency, so as to ensure effective erythropoiesis in response to hypoxic stress. In conclusion, our results indicate that EPO up regulated the transport of folic acid across Caco-2 cells, which was associated with the modulation on the expression of folate transporters (PCFT, RFC, and MRP2). JAK-2, ERK, and PI3K/Akt pathways were involved in this EPO response, but each of them may have distinct effects on folate transporter expression. Our data provide valuable evidence for the direct impact of EPO on intestinal folate absorption and may support an expanding role of EPO in hematopoiesis.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel. & fax: 8621-65643446. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Basic Research Program of China (973 Program) (no. 2010CB912600) and National Natural Science Foundation of China (no. 81373396).

■

ABBREVIATIONS USED EPO, erythropoietin; EPOR, EPO receptor; PCFT, proton couple folate transporter; RFC, reduced folate carrier; MRP2, multidrug resistance-associated protein 2; FRα, folate receptor α; JAK-2, janus protein tyrosine kinase 2; ERK, extracellular signal regulated kinases; PI3K/Akt, phosphoinositide 3 kinase/Akt

■

REFERENCES

(1) Elliott, S.; Pham, E.; Macdougall, I. C. Erythropoietins: a common mechanism of action. Exp. Hematol. 2008, 36, 1573−1584. (2) Pinto, J. P.; Ribeiro, S.; Pontes, H.; Thowfeequ, S.; Tosh, D.; Carvalho, F.; Porto, G. Erythropoietin mediates hepcidin expression in hepatocytes through EPOR signaling and regulation of C/EBPalpha. Blood 2008, 111, 5727−5733. (3) Kong, W. N.; Chang, Y. Z.; Wang, S. M.; Zhai, X. L.; Shang, J. X.; Li, L. X.; Duan, X. L. Effect of erythropoietin on hepcidin, DMT1 with IRE, and hephaestin gene expression in duodenum of rats. J. Gastroenterol. 2008, 43, 136−143. (4) Huang, H.; Constante, M.; Layoun, A.; Santos, M. M. Contribution of STAT3 and SMAD4 pathways to the regulation of hepcidin by opposing stimuli. Blood 2009, 113, 3593−3599. (5) Chaston, T.; Chung, B.; Mascarenhas, M.; Marks, J.; Patel, B.; Srai, S. K.; Sharp, P. Evidence for differential effects of hepcidin in macrophages and intestinal epithelial cells. Gut 2008, 57, 374−382. (6) Knutson, M. D.; Oukka, M.; Koss, L. M.; Aydemir, F.; WesslingResnick, M. Iron release from macrophages after erythrophagocytosis is up-regulated by ferroportin 1 overexpression and down-regulated by hepcidin. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 1324−1328. 365

dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366

Molecular Pharmaceutics

Article

(26) Verwei, M.; van den Berg, H.; Havenaar, R.; Groten, J. P. Effect of folate-binding protein on intestinal transport of folic acid and 5methyltetrahydrofolate across Caco-2 cells. Eur. J. Nutr. 2005, 44, 242−249. (27) Hubatsch, I.; Ragnarsson, E. G.; Artursson, P. Determination of drug permeability and prediction of drug absorption in Caco-2 monolayers. Nat. Protocols 2007, 2, 2111−2119. (28) Ashokkumar, B.; Mohammed, Z. M.; Vaziri, N. D.; Said, H. M. Effect of folate oversupplementation on folate uptake by human intestinal and renal epithelial cells. Am. J. Clin. Nutr. 2007, 86, 159− 166. (29) Li, X.; Otter, K.; Ziegler, A. Determination of pravastatin in rat liver by RP-HPLC. Yao Xue Xue Bao 2001, 36, 123−126. (30) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248−254. (31) Sun, H.; Chow, E. C.; Liu, S.; Du, Y.; Pang, K. S. The Caco-2 cell monolayer: usefulness and limitations. Expert Opin. Drug Metab. Toxicol. 2008, 4, 395−411. (32) McMartin, K. E.; Morshed, K. M.; Hazen-Martin, D. J.; Sens, D. A. Folate transport and binding by cultured human proximal tubule cells. Am. J. Physiol. 1992, 263, F841−F848. (33) Balamurugan, K.; Said, H. M. Role of reduced folate carrier in intestinal folate uptake. Am. J. Physiol. Cell Physiol. 2006, 291, C189− C193. (34) Jacobson, L. O.; Goldwasser, E.; Fried, W.; Plzak, L. Role of the Kidney in Erythropoiesis. Nature 1957, 179, 633−634. (35) Fisher, J. W.; Koury, S.; Ducey, T.; Mendel, S. Erythropoietin production by interstitial cells of hypoxic monkey kidneys. Br. J. Hamaetol. 1996, 95, 27−32.

366

dx.doi.org/10.1021/mp400318c | Mol. Pharmaceutics 2014, 11, 358−366