Modulation of the Intestinal Microbiota Is Associated with Lower

Jan 18, 2015 - The reduction of Lactobacillus spp. by the ChrSd diet was accompanied by .... Grape pomace was obtained from coastal vineyards in Sonom...
1 downloads 0 Views 897KB Size
Download PDF
Article pubs.acs.org/JAFC

Modulation of the Intestinal Microbiota Is Associated with Lower Plasma Cholesterol and Weight Gain in Hamsters Fed Chardonnay Grape Seed Flour Hyunsook Kim,*,†,‡,⊥ Dong-Hyeon Kim,§ Kun-ho Seo,§ Jung-Whan Chon,§ Seung-Yeol Nah,‡ Glenn E. Bartley,¶ Torey Arvik,⊥ Rebecca Lipson,⊥ and Wallace Yokoyama¶ †

Department of Nutrition, UC Davis, Davis, California 95616, United States Department of Physiology and §KU Center for Food Safety, College of Veterinary Medicine, Konkuk University, Hwayang-dong, Gwangjin-gu, Seoul 143-701, South Korea ⊥ Sonomaceuticals LLC/WholeVine Products, Santa Rosa, California 95403, United States ¶ USDA, ARS, Albany, California 94710, United States ‡

ABSTRACT: The relationship between the intestinal microbiota and the hypocholesterolemic and antiobesity effects of whole grape seed flour from white and red winemaking was evaluated. Male Golden Syrian hamsters were fed a high-fat (HF) control diet or a HF diet supplemented with 10% partially defatted grape seed flours from either Chardonnay (ChrSd) or Cabernet Sauvignon (CabSd) grapes for 3 weeks. The numbers of total bacteria and relative abundances of Bifidobacterium spp., Lactobacillus spp., and Firmicutes in feces were significantly lower, while the relative abundance of Bacteroides fragilis was greater than the control from feeding the ChrSd diet. The ratio of Firmicutes/Bacteroidetes (F/B) was lower in the ChrSd diet. There were significantly positive correlations between Lactobacillus spp., ratio of F/B, and plasma total- and LDL-cholesterol and liver weight. The reduction of Lactobacillus spp. by the ChrSd diet was accompanied by inhibition of Farnesoid X receptor (FXR) signaling in the intestine as expression of intestinal fibrablast growth factor (FGF)15, positively regulated by FXR, was decreased. Expression of CYP7A1, negatively regulated by FGF15, was up-regulated in the liver, which indicates that alteration of the intestinal microbiota may regulate bile acid and lipid metabolism. These findings suggest that beneficial health effects of Chardonnay grape seed flour on HF-induced metabolic disease relate in part to modulation of intestinal microbiota and their metabolic processes. KEYWORDS: microbiota, cholesterol, antiobesity, FXR, grape seed flour, hamster

■

reduced that of Enterobacteriaceae.13 However, it remains unclear whether such changes in bacterial numbers mediate beneficial effects of grape seed flavonoids. Studies have found direct roles for specific intestinal bacteria in the etiology of CVD and obesity. C57BL/6 mice on high-fat (HF) diets supplemented with Bacteroides uniformis CECT7771 had reduced weight gain and serum and liver cholesterol as well as improved immune function.14 Lactobacillus curvatus HY7601 and L. plantarum KY1032 fed to diet-induced obese (DIO) mice altered gut microbiota composition and also reduced weight gain and plasma total-cholesterol concentration.15 Feeding of Akkermansia mucinphila (a mucin-degrading bacterium) enhanced mucus thickness, intestinal endocannabinoid production, and gut barrier function in mice on HF diets, which resulted in reduced fat mass, endotoxemia, adipose tissue inflammation, and insulin resistance.16 Alternatively, Enterobacter cloacae B29 isolated from the gut of an obese human induced obesity and insulin resistance in germ-free mice on a HF diet, but administration of E. cloacae B29 to mice on a chow

INTRODUCTION Dietary flavonoids may modulate intestinal microbial composition by selectively inhibiting the growth of some pathogenic bacteria while enhancing the growth of probiotic bacteria.1−3 Grape products such as grape juice, wine, grape extracts, and purified compounds are rich sources of flavonoids. Flavonoids have been shown to have potential health benefits such as reducing cardiovascular risk factors.4,5 Grape seeds contain twothirds of the extractable flavonoids of the grape. Flavan-3-ols (flavanols) are the most abundant class of flavonoids6,7 and include catechin, epicatechin, their 3-O-gallates, and (epi)catechin dimers, oligomers, and polymers.8 Monomeric (epi)catechin is readily absorbed by the small intestine, but oligomers and polymers are not absorbed and reach the colon where they are metabolized by gut bacteria into phenolic acids before absorption. The bioactivity of flavonoids in extracts and whole seeds may differ since a significant amount, 44%, of the proanthocyanidins of the grape is unextractable.9 Recently, research has focused on the effects on intestinal microbial ecology by flavonoids in grape seeds. A red grape pomace byproduct called grape antioxidant dietary fiber (GADF) was shown to boost the growth of Bifidobacterium and Lactobacillus species (spp.) both in vitro and in vivo studies.10−12 In a human study, intake of a proanthocyanidin-rich grape seed extract for 2 weeks significantly enhanced the number of Bifidobacterium but © XXXX American Chemical Society

Received: June 2, 2014 Revised: January 14, 2015 Accepted: January 18, 2015

A

DOI: 10.1021/jf5026373 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Sequences of PCR Primers target Lactobacillus spp. Bifidobacterium spp. Enterococcus spp. Clostridium letpum (cluster IV) Enterobacteriaceae Bacteroides fragilis total bacteria Bacteroidetes Firmicutes Proteobacteria gene FGF15/19 OCLN ZO-1

primer pair forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse

sequences (5′ to 3′)

bacterial strains for standard curve

AGCAGTAGGGAATCTTCCA Lactobacillus delbrueckii subsp. Bulgaricus (KCTC3635)56,57 CACCGCTACACATGGAG CTCCTGGAAACGGGTGG Bifidobacterium animalis subsp. Lactis (KCTC 5854)58 GGTGTTCTTCCCGATATCTACA CCCTTATTGTTAGTTGCCATCATT Enterococcus faecalis (KCTC 3206)59 ACTCGTTGTACTTCCCATTGT GCACAAGCAGTGGAGT Clostridium leptum (KCTC 5155)60 CTTCCTCCGTTTTGTCAA TGCCGTAACTTCGGGAGAAGGCA Escherichia coli (KCTC1682)61 TCAAGGCTCAATGTTCAGTGTC CTGAACCAGCCAAGTAGCG Bacteroides fragilis (KCTC1322)62 CCGCAAACTTTCACAACTGACTTA TCCTACGGGAGGCAGCAGT Escherichia coli (KCTC1682)63 GGACTACCAGGGTATCTAATCCTGTT CATGTGGTTTAATTCGATGAT Bacteroides fragilis (KCTC1322)64 AGCTGACGACAACCATGCAG ATGTGGTTTAATTCGAAGCA Lactobacillus delbrueckii subsp. Bulgaricus (KCTC3635)64 AGCTGACGACAACCATGCAC CATGACGTTACCCGCAGAAGAAG Escherichia coli (KCTC1682)38,65 CTCTACGAGACTCAAGCTTGC primer pair 5′ primer sequence 3′ product size (bp) forward reverse forward reverse forward reverse

ACCCGCCTGCAGTACCTGT GCCGAGTAATGAATCAGCC GGAATACCCACCTATCACTTC TCATCAGCGGCAGCCATGTA GGTGTGTTGAGTTCCATAGAAAC CAGGTTTTAGGGTCACAGTGT

diet did not induce obesity.17 Germ-free mice on a HF diet did not become obese. Several lines of research have suggested that the regulation of a host’s metabolism by its intestinal microbiota occurs through alteration of the host’s nuclear receptor signaling via production of secondary metabolites by bacteria. Intestinal bacteria have been shown to produce short chain fatty acids (SCFAs), which reduce insulin-stimulated fat accumulation via the SCFA receptor GPR43.18 Trimethylamine-N-oxide (TMAO), another metabolite produced by intestinal bacteria, was associated with cardiovascular risk factors via multiple macrophage scavenger receptors.19 Reduction of the genus Lactobacillus following treatment with the antioxidant, tempol (4-hydroxy-2,2,6,6tetramethylpiperidin-1-oxyl), caused accumulation of tauro-βmuricholic acid (T-β-MCA) and inactivation of the intestinal farnesoid X (nuclear) receptor (FXR).20 Gut microbiota modulation of fasting-induced adipocyte factor (Fiaf) gene expression in the intestine and cytochrome P450 7A1 (CYP7A1) gene expression in the liver indicates a role of gut microbiota in host lipid and bile acid metabolism.21,22 Taken together, these findings suggest that restoration of the healthy phenotypic intestinal microbiota through diet may be a preferred strategy for preventing or treating obesity-related metabolic diseases. Our previous work23 has shown that hamsters fed a HF and hypercholesterolemic diet supplemented with white wine grape seed flour (ChrSd diet) exhibited significantly lowered plasma low density lipoprotein (LDL)-, very low density lipoprotein (VLDL)-, total-cholesterol concentrations, abdominal adipose tissue weight, and body weight gain compared to those fed a control diet. To date, the prebiotic effects of whole grape seed itself are largely unknown since most studies have utilized

224 186 236

aqueous or alcoholic polyphenolic grape seed extracts. To our knowledge, the effect of wine varietal grape seed flour on intestinal microbiota composition has not been evaluated. In this study, we extended our previous research to evaluate a select number of bacteria from hamster feces by reverse transcription quantitative polymerase chain reaction (RTqPCR) of 16S rRNA and correlated their relative abundances with physiological changes in order to determine whether metabolic effects were associated with intestinal microbiota in male Syrian Golden hamsters fed HF diets supplemented with grape seed flours from red and white wine production.

■

MATERIALS AND METHODS

Animals and Diets. Male Syrian Golden hamsters (approximately 80 g, LVG strain, Charles River Laboratories, Wilmington, MA) were randomized into three groups of 10 hamsters each and fed HF diets (37% of energy as fat, 18% as protein, and 45% as carbohydrate) ad libitum containing 10% (w/w) grape seed flour (Chardonnay or Cabernet Sauvignon from Sonomaceuticals, LLC/WholeVine Products, Santa Rosa, CA) and a control diet containing 5% microcrystalline cellulose (MCC; Dyets Inc. Bethlehem, PA) for 3 weeks as shown in our previous study.23 Microcrystalline cellulose (MCC), an insoluble fiber, has little effect on energy or sterol metabolism.24 Grape pomace was obtained from coastal vineyards in Sonoma County, California. Seeds from the 2010 vintage were screened and dried using heated air (55−70 °C) to be separated from skins and stems. Oil was pressed from the seed, and the residual press cake was then milled to pass through an 85 mesh sieve. Body weights were monitored weekly, and food intake was recorded twice per week. Feces were collected during the last 3 consecutive days of the feeding period and were lyophilized, milled, and stored at −20 °C. Blood was collected by cardiac puncture with syringes previously rinsed with potassium EDTA solution (15 wt %/v) after hamsters were feeddeprived for 12 h and anesthetized with isoflurane (Phoenix B

DOI: 10.1021/jf5026373 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Pharmaceutical, St. Joseph, MO). The plasma was separated after centrifugation at 2000 × g for 30 min at 4 °C. Livers, intestines, and adipose tissues (epididymal and perirenal adipose tissues) were collected, weighed, and immediately frozen in liquid nitrogen for later analysis. The protocol, #P-04−02, was reviewed and approved by the Animal Care and Use Committee, Western Regional Research Center, Albany, CA. The male Syrian hamster was used since its hepatic cholesterol and bile acid metabolism is more similar to humans compared to mice and rats.25,26 Plasma Lipoproteins and Hepatic and Fecal Lipids Analysis. Cholesterol in plasma lipoproteins was determined by size-exclusion chromatography as previously described.23,27 Liver and fecal total lipid contents were determined gravimetrically as described before.23,30 Fecal Microbiota Analysis. A 200 mg sample of lyophilized fecal samples was added to 10 volumes of RNA later-ICE (Applied Biosystems, Foster City, CA, USA) for 24 h for RNA stabilization. Total RNA from fecal samples was extracted using a Stool Total RNA purification kit (Norgen Biotek Inc., Thorold, ON, Canada), and cDNA was synthesized using a PrimeScript RT reagent kit (TaKaRa Biotechnology, Shiga, Japan) per the manufacturer’s protocol. Quantitative PCR was performed on an AB 7500 real-time PCR system (Applied Biosystems) using SYBR Premix Ex Taq (TaKaRa Biotechnology). Individual bacteria strains for generation of standard curve were obtained from Korean Collection for Type Cultures (KCTC), grown in pure culture media, and then isolated cDNA was serially diluted to generate the standard curve. The bacteria number from each sample was calculated by comparing the Ct value derived from the standard curve with the 7500 Software 2.01. Standard curves were generated by a serial 10-fold dilution of DNA from pure cultures, 101−1012 copies/g feces. The data represented the mean values of duplicate qPCR analysis. Bacterial groups reported to impart health benefits or prevent obesity-related metabolic disorders were selected for this study. The bacterial primer sequences are shown in Table 1. The cycle conditions were as follows: 30 s at 95 °C followed by 40 cycles of incubation at 95 °C for 5 s and 60 °C for 34 s. The experimental data were analyzed with the 7500 Software v2.0.1 (Applied Biosystems). Hepatic and Intestinal Gene Expression by Real-Time (RT)PCR. Total RNA from livers and intestines was extracted using a TRIzol plus RNA purification kit (Invitrogen, Life Technologies, Carlsbad, CA), and cDNA was synthesized using a GeneAmpRNA PCR kit (Applied Biosystems, Foster City, CA) per the manufacturer’s protocol. One microliter of diluted cDNA (1:10) was used in each real-time RT-PCR using SYBR Green Supermix (Bio-Rad, Hercules, CA) with an Mx3000P instrument (Stratagene, Cedar Creek, TX). The cycle conditions were as follows: 5 min at 95 °C followed by 40 cycles of incubation at 94 °C for 15 s, then 58−60 °C for 1 min and 72 °C for 30 s. The sequences of the primers used for this study are shown in Table 1 and our previous study.28,29 The primers were validated by size and sequencing of PCR products. No accumulation of nonspecific products and primer dimers was observed in a gel electrophoresis test of the PCR products. The results were analyzed using the software provided with the Stratagene Mx3000P QPCR system. Differences in mRNA expression for intestines and livers were calculated after normalizing to β-Actin or 36B4 mRNA expression. Statistical Analysis. All data are expressed as means ± SE. Oneway analysis of variance (ANOVA) was performed to examine the effect of treatment on plasma biomarkers, lipid levels, and body and tissue weights using the JMP7 statistical program (SAS Institute, Cary, NC). Tukey−Kramer honestly significant difference (HSD) tests were used to determine the significant differences in group means. Pearson correlation coefficients were calculated to investigate relationships between the abundance of intestinal bacteria and plasma cholesterol concentrations as well as liver, adipose tissue, and body weights. Significance was defined at P < 0.05.

cholesterol concentrations of hamsters fed the ChrSd diet were 73, 56, and 38%, respectively, lower compared with the control diet (P < 0.05) (Table 2). The CabSd diet did not Table 2. Plasma Lipid Concentrations and Hepatic and Fecal Total Lipid Contents in Hamsters Fed HF Control, ChrSd, and CabSd Diets for 3 Weeksa,b Plasma Lipid (mg/dL) VLDL-cholesterol LDL-cholesterol HDL-cholesterol total-cholesterol LDL/HDL hepatic percent total lipid content (g/100g) fecal percent total lipid content (g/100g)

control

ChrSd

CabSd

23.6 ± 3.5a 75.2 ± 12.4a 90.3 ± 4.2a 189.1 ± 14.9a 0.8 ± 0.1a 23.9 ± 1.0a

6.5 ± 1.3b 33.4 ± 6.6b 77.6 ± 4.0ab 117.6 ± 6.7b 0.5 ± 0.1b 18.1 ± 1.0b

25.6 ± 5.2a 85.7 ± 7.2a 75.4 ± 3.7b 186.7 ± 8.9a 1.2 ± 0.1a 21.6 ± 1.4a

2.6 ± 0.5a

2.9 ± 0.9a

2.3 ± 0.4a

a

ChrSd, Chardonnay seed; CabSd, Cabernet Sauvignon seed. bValues are means ± SE, n = 10. Different letters indicate significant difference at P < 0.05.

lower plasma cholesterol concentration when compared to the control diet (Table 2). The ChrSd diet also significantly lowered hepatic total lipid concentration by 24% compared to the control diet (P < 0.05) (Table 2). Fecal percent total lipid of the grape seed diets did not significantly differ from the control diet (Table 2). The total methanol extractable flavonoid content of the CharSd was 1.4-fold greater than that of CabSd as described in our previous study.23 The higher levels of flavonoids in red wines and lower levels in seeds are partly due to the ethanol extraction of flavonoids during fermentation. Different processing methods for white and red wine account for some of the differences in flavonoid content; the whole fruit including seed is fermented for the production of red wines; however, only the juice is fermented in typical white wine production. Fecal Microbiota Profiles by Chardonnay and Cabernet Grape Seed Flour Supplementation. ChrSd supplementation significantly lowered numbers of total bacteria in feces compared to the HF control diet (Figure 1A). Relative abundance of Bifidobacterium spp. and Lactobacillus spp. in feces was significantly lowered by the ChrSd diet compared to the HF control diet (Figure 1B). In contrast, relative abundance of Bacteroides fragilis was significantly greater in feces of the ChrSd diet than the control diet (Figure 1B). The CabSd diet significantly lowered relative abundance of Enterobacteriaceae in feces compared to the control diet (Figure 1B). At a phylum level, relative abundance of Bacteroidetes tended to be greater, and Firmicutes were markedly lower in the ChrSd diet compared to the control diet; this resulted in a significant reduction in the ratio of Firmicutes/Bacteroidetes (F/B) (Figure 2A,B). Relative abundance of Proteobacteria numbers was significantly lower in the CabSd diet than in the control diet (Figure 2A). Expression of Hepatic and Intestinal Genes following Chardonnay Grape Seed Flour Supplementation. The expression of FGF15/19, a downstream target gene of FXR, in the intestine of hamsters fed the ChrSd diet was one-tenth that of hamsters fed the control diet (Figure 3). The mRNA levels of ZO-1 (zonula occludens 1) and OCLN (occludin), genes that encode intestinal tight junction proteins, were not significantly affected by the ChrSd diet (Figure 3). The

■

RESULTS Metabolic Effects of Grape Seed Flour Supplementation on Hamsters. Plasma VLDL-, LDL-, and totalC

DOI: 10.1021/jf5026373 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 1. Effect of grape seed flour diets on numbers of total bacteria (A) and relative abundance of specific intestinal bacteria (B). Male Golden Syrian hamsters were fed HF diets containing 10% (w/w) Chardonnay (ChrSd), Cabernet Sauvignon (CabSd) grape seed flours, and 5% MCC (control) for 3 weeks. Data are expressed as means ± SE; n = 4/group. ∗ indicates significant difference at P < 0.05.

Figure 3. Relative expression of FGF15/19, ZO-1, and OCLN genes in ileum and CYP7A1 in liver of hamsters fed HF diet supplemented with 10% (w/w) Chardonnay (ChrSd) grape seed flours and 5% MCC (control) for 3 weeks. Data are expressed as mean ± SE; n = 5/group.

intestinal microbiota with plasma cholesterol concentrations, liver, adipose tissue, and body weight were calculated to determine if the changes of the host physiological characteristics were associated with changes in the microbiota after grape seed flavonoid intake (Table 3). Relative abundance of Lactobacillus spp. and the F/B ratio showed strong positive correlations to plasma total-, LDL-cholesterol concentrations, and liver weights (P < 0.05). Relative abundance of Bifidobacterium spp. (P < 0.01) and Firmicutes (P < 0.05) both showed significant positive relationships with liver weights. Relative abundance of B. fragilis showed a significant negative relationship with liver weights (P < 0.01).

Figure 2. Effect of grape seed flour diets on relative phylum abundance of intestinal bacteria (A) and ratio of Firmicutes to Bacteroidetes (B). Male Golden Syrian hamsters were fed HF diets containing 10% (w/ w) Chardonnay (ChrSd), Cabernet Sauvignon (CabSd) grape seed flours, and 5% MCC (control) for 3 weeks. Data are expressed as means ± SE; n = 4/group. ∗ indicates significant difference at P < 0.05.

mRNA level of CYP7A1, the gene that controls the ratelimiting step of bile acid synthesis from cholesterol, was 4.9-fold greater in the livers of hamsters fed the ChrSd diet compared to those fed the control diet (Figure 3). Correlation of Intestinal Microbiota−Host Metabolic Effects. Correlations of specific genus/species and phylum of

■

DISCUSSION The association between the health benefits of grape flavonoids, such as amelioration of cardiovascular and obesity risk factors, D

DOI: 10.1021/jf5026373 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Table 3. Correlations between Plasma Cholesterol Concentrations, Body and Organ Weights, and Fecal Microbiotaa,b type of bacteria

total-C

VLDL-C

LDL-C

HDL-C

liver

adipose tissue

body weight

Phylum Bacteroidetes Species Bacteroides f ragilis Phylum Firmicutes Species Clostridium Cluster IV Genus Lactobacillus spp. Genus Enterococcus spp. Phylum Actinobacteria Genus Bifidobacterium spp. Phylum Proteobacteria Family Enterobacteriaceae Ratio of F/Bc Total bacteria

−0.47 −0.36 0.54 −0.24 0.62* 0.00

−0.51 −0.24 0.22 −0.26 0.40 0.36

−0.46 −0.41 0.57 −0.20 0.69* −0.20

0.00 0.00 0.22 0.26 0.00 0.26

−0.56 −0.87** 0.65* −0.36 0.62* 0.00

−0.49 −0.41 0.14 −0.32 0.39 0.26

−0.57 −0.49 0.28 −0.40 0.49 0.10

0.56 0.10 0.00 0.66* 0.46

0.10 0.39 0.36 0.14 0.26

0.78** 0.20 0.10 0.73** 0.45

0.53 0.14 0.00 0.63* 0.44

0.36 0.60* 0.35 0.41 0.35

0.46 0.66* 0.44 0.33 0.00

0.55 0.36 0.00 0.46 0.00

a

Total-C, total cholesterol; VLDL-C, very low density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol; HDL-C, high density lipoprotein cholesterol. bValues are Pearson correlation, n = 12; ∗P < 0.05; ∗∗P < 0.01. cRatio of Firmicutes/Bacteroidetes.

lus−Enterococcus spp. in human fecal slurries.40 At low (150 mg/L) but not high (1000 mg/L) levels, (+)-catechin itself was shown to significantly stimulate growth of Bifidobacterium spp. in an in vitro study.11 These discrepancies with our results may be due to in vivo versus in vitro models, different species (rat, hamster, or human), gut biotype, and dosage threshold. Nonetheless, our observed effect of the ChrSd diet on intestinal bacteria may possibly represent the effects of multiple constituents specific to Chardonnay grape seed flour. The hypocholesterolemic properties of probiotic bacteria are still unclear.41 Previously, probiotic Lactobacillus and Bifidobacteria have been shown to possess bile salt hydrolase (BSH) activity that promotes bile acid excretion by increasing deconjugation of bile acids.42 Excretion of bile acids leads to a reduction of plasma cholesterol concentration by a compensatory mechanism since cholesterol is the precursor of bile acids in the liver.43 However, the present study exhibited no significant change in fecal lipid excretion after the ChrSd diet was consumed. Alternatively, studies suggest that intestinal microbiota regulate bile acid metabolism via intestinal FXR signaling and hepatic expression of genes related to bile acid pathway.22 It has been shown that germ-free mice had lower expression of FGF15 in the intestine, which attenuated FGF15mediated down-regulation of CYP7A1 in the liver compared to conventional mice.22 This effect was not observed in FXRdeficient mice. Furthermore, treatment of mice with a strong antioxidant (tempol) inactivated intestinal FXR, which led to a significant reduction in the genus Lactobacillus and caused down-regulation of FGF15 expression in the intestine.20 Our results are similar to these previous reports in that the ChrSd diet lowered the relative abundance of genus Lactobacillus in the intestine and that mRNA levels for both FGF15/19 in the intestine and CYP7A1 in the liver were altered compared to the control diet. These findings suggest that a modification of gut microbiota, such as reduction of Lactobacillus spp., by the ChrSd diet affects hepatic bile acid metabolism and improved plasma cholesterol concentrations in hypercholesterolemic hamsters possibly by activation of intestinal FXR. Recent studies have brought light to alterations in gut microbiota that are linked to the development of obesity in both animal models and humans.44 Our previous study showed that ChrSd supplementation of the HF diet for 3 weeks significantly reduced body weight gain and adipose tissue weights by 31 and 23%, respectively, compared to the control diet.23 Body weight gains (g) in control, ChrSd, and CabSd

and changes in intestinal microbiota composition has profound implications for the relationship between diet and chronic metabolic disease. The present study provides further indirect evidence for the potential role of the intestinal microbiota in metabolic dyslipidemia. Quantification of selected species/ genera and phylum of fecal bacteria from obese and hypercholesterolemic hamsters revealed that supplementation of flavonoid-rich Chardonnay grape seed flour (ChrSd diet) significantly altered intestinal microbiota composition and total number. These modifications were correlated to the prevention of ectopic HF-induced hepatic fat deposition, decreased adipose tissue accumulation and body weight gain, and reduced plasma LDL-, VLDL-, and total-cholesterol concentrations by supplementation of the HF diet with Chardonnay grape seed flour. The ChrSd diet significantly lowered numbers of total bacteria and relative abundance of Bifidobacterium spp. and Lactobacillus spp. compared to control. It has been previously shown that there is a positive relationship between total flavonoid content in grape-derived products (pomace or grape seed extract) with selective antimicrobial activity.30−36 Calculated intakes of flavonoids from our previous study23 by the hamsters from ChrSd and CabSd diets are about 1000 and 700 mg/kg body wt/d, respectively, and total epicatechin intakes of about 138 and 21 mg/kg body wt/d, respectively. Therefore, lower numbers of total bacteria were associated with higher total catechin content in the grape seed diets, which supports the role of flavonoids as the potential bioactive component responsible for selective antimicrobial effects of Chardonnay grape seed flour on these bacteria. However, other studies reported either no effect or stimulation of growth of Lactobacillus spp. or Bifidobacterium spp. in the presence of grape or related flavonoids. Tea flavonoids, for example, did not affect growth of these bacteria.37 Flavonoid intake from red wine or procyanidin-rich grape seed extract was found to stimulate growth of Bifidobacterium spp. in human studies.13,38 Consumption of red wine polyphenols significantly increased numbers of Bifidobacterium as well as Enterococcus, Prevotella, and Bacteroides, while it reduced total- and HDL-cholesterol concentrations in a small (n = 10) human study.38 Phenolic extracts from grape pomace increased the growth of Lactobacillus acidophilus in an in vitro study.39 Malvidin, an anthocyanidin extracted from grape pomace, and enocianin, an anthocyanin extracted from grape skin, both significantly enhanced the growth of Bifidobacterium spp. and LactobacilE

DOI: 10.1021/jf5026373 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry diets were 34.7 ± 1.9, 23.9 ± 1.9, and 38.8 ± 1.9, respectively.23 Here we observed that reduction of adipose tissue and body weight was accompanied by an increased relative abundance of B. fragilis and reduced relative abundance of Lactobacillus spp. and Firmicutes. The F/B ratio was also lowered by ChrSd supplementation. Consistent to our study, previous studies have shown that Bacteroidetes numbers including the B. fragilis group were increased with weight loss in obese human subjects undergoing dietary or surgical interventions.45 Several studies such as a recent report have shown that on HF diets, obeseprone rats had a higher F/B ratio compared to obese-resistant rats.46 However, other studies, for example, in obese humans, have not shown a causative relationship between the ratio of intestinal F/B and obesity.47 We have also found similar percentage levels of Firmicutes and Bacteroidetes compared to total number of bacteria in feces of mice fed ChrSd diets by next generation sequencing (NGS, data not shown). Lactobacillus numbers were elevated in obese humans and animals.48−50 The converse was demonstrated when a reduction of the genus Lactobacillus contributed to inactivation of FXR signaling in the intestine via accumulation of intestinal T-β-MCA, a FXR antagonist, and subsequently decreased intestinal FXR-mediated obesity.20 Interestingly, the present study also correlated a significant reduction of intestinal Lactobacillus spp. with the down-regulation of FGF15/19 in the intestine, which supports inactivation of FXR signaling following a ChrSd diet. These data suggest that the antiobesity effect of ChrSd diet may be in part associated with reduced abundance of Lactobacillus in the intestine. Other factors in the antiobesity effects of the flavonoid-rich ChrSd diet may be the antioxidant effect of the flavonoids themselves, playing a preventive role in the development of obesity by regulating adipocyte differentiation,51 or the suppression of PPAR γ2 expression, adipogenesis, and lipid accumulation.52,53 Increased abundance of probiotics (Lactobacillus spp. and Bifidobacterium spp.) may reduce HF-induced plasma lipopolysaccharide (LPS, endotoxin) concentration and inflammatory markers and lead to decreased hepatic steatosis.54,55 Our previous work showed that ChrSd supplementation of the HF diet for 3 weeks significantly reduced liver weight by 38% compared to the control diet.23 In the current study, liver weight was positively correlated with relative abundance of Lactobacillus spp. and Bifidobacterium spp. as well as the F/B ratio. The reduction of liver weight is mainly due to decreased lipid content after ChrSd feeding. Therefore, these results suggest that improvement of hepatic steatosis following ChrSd feeding may be mediated via alteration of the intestinal microbiota independent of the relative abundances of Lactobacillus spp. and Bifidobacterium spp. In summary, numbers of total bacteria and relative abundances of Bifidobacterium spp., Lactobacillus spp., and Firmicutes were all lowered in feces from hamsters fed diets supplemented with the ChrSd diet. The ChrSd diet prevented HF and hypercholesterolemic diet-induced increases of plasma LDL-, VLDL-, total-cholesterol concentrations, hepatic steatosis, abdominal adipose tissue weight, and body weight gain. The hypocholesterolemic effect of the ChrSd diet may be mediated, in part, by up-regulation of hepatic CYP7A1 via decreased expression of intestinal FGF15/19 and is associated with lowered relative abundance of Lactobacillus spp. There was a significant positive correlation between Lactobacillus spp., the F/B ratio, and plasma total- and LDL-cholesterol. Reduction of HF-diet induced adipose tissue and body weight gain was

accompanied by an increased relative abundance of B. fragilis and other Bacteroidetes and by reduced Lactobacillus spp. and Firmicutes, as represented in the F/B ratio. The antiobesity effect of the ChrSd diet may partially act through a change in the abundance of Lactobacillus spp. and subsequent inhibition of intestinal FXR-mediated signaling. In conclusion, although our study did not provide evidence for direct interaction of Chardonnay grape seed flour with intestinal microbiota, these findings suggest that the effect of Chardonnay grape seed flour on ameliorating HF- and high cholesterol-induced metabolic disorders is closely linked to modulation of intestinal microbiota. These data must be considered cautiously because only a few species and genera were quantified. In-depth analysis of intestinal microbiota composition following consumption of Chardonnay grape seed flour warrants further investigation.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: +82 2 450 4154. Fax: +82 2 450 3037. Author Contributions

Many thanks to Sonomaceuticals, LLC/WholeVine Products, and their sister company for their contribution of grape seed flours and compositional analysis. Funding

Hyunsook Kim was supported by the KU-Research Professor Program of Konkuk University. Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Hervert-Hernándeza D, G. I. Dietary Polyphenols and Human Gut Microbiota: A Review. Food Rev. Int. 2011, 27, 154−169. (2) Puupponen-Pimiä R, A. A.; Oksman-Caldentey, K. M.; Myllärinen, P.; Saarela, M.; Mattila-Sandholm, T.; Poutanen, K. Development of Functional Ingredients for Gut Health. Trends Food Sci. Technol. 2002, 13, 3−11. (3) Etxeberria, U.; Fernandez-Quintela, A.; Milagro, F. I.; Aguirre, L.; Martinez, J. A.; Portillo, M. P. Impact of Polyphenols and PolyphenolRich Dietary Sources on Gut Microbiota Composition. J. Agric. Food Chem. 2013, 61, 9517−9533. (4) Tremaroli, V.; Backhed, F. Functional Interactions between the Gut Microbiota and Host Metabolism. Nature 2012, 489, 242−249. (5) Laparra, J. M.; Sanz, Y. Interactions of Gut Microbiota with Functional Food Components and Nutraceuticals. Pharmacol. Res. 2010, 61, 219−225. (6) Cavaliere, C.; Foglia, P.; Gubbiotti, R.; Sacchetti, P.; Samperi, R.; Lagana, A. Rapid-Resolution Liquid Chromatography/Mass Spectrometry for Determination and Quantitation of Polyphenols in Grape Berries. Rapid Commun. Mass Spectrom. 2008, 22, 3089−3099. (7) Pastrana-Bonilla, E.; Akoh, C. C.; Sellappan, S.; Krewer, G. Phenolic Content and Antioxidant Capacity of Muscadine Grapes. J. Agric. Food Chem. 2003, 51, 5497−5503. (8) Beecher, G. R. Overview of Dietary Flavonoids: Nomenclature, Occurrence, and Intake. J. Nutr. 2003, 133, 3248S−3254S. (9) Hellstrom, J. K.; Mattila, P. H. HPLC Determination of Extractable and Unextractable Proanthocyanidins in Plant Materials. J. Agric. Food Chem. 2008, 56, 7617−7624. (10) Tabasco, R.; Sanchez-Patan, F.; Monagas, M.; Bartolome, B.; Victoria Moreno-Arribas, M.; Pelaez, C.; Requena, T. Effect of Grape Polyphenols on Lactic Acid Bacteria and Bifidobacteria Growth: Resistance and Metabolism. Food Microbiol. 2011, 28, 1345−1352. (11) Tzounis, X.; Vulevic, J.; Kuhnle, G. G.; George, T.; Leonczak, J.; Gibson, G. R.; Kwik-Uribe, C.; Spencer, J. P. Flavanol Monomer-

F

DOI: 10.1021/jf5026373 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Induced Changes to the Human Faecal Microflora. Br. J. Nutr. 2008, 99, 782−792. (12) Pozuelo, M. J.; Agis-Torres, A.; Hervert-Hernandez, D.; Elvira Lopez-Oliva, M.; Munoz-Martinez, E.; Rotger, R.; Goni, I. Grape Antioxidant Dietary Fiber Stimulates Lactobacillus Growth in Rat Cecum. J. Food Sci. 2012, 77, H59−H62. (13) Yamakoshi J, T. S.; Kikuchi, M.; Kubota, Y.; Konishi, H.; Mitsuoka, T. Effect of Proanthocyanidin-Rich Extract from Grape Seeds on Human Fecal Flora and Fecal Odor. Microb. Ecol. Health Dis. 2001, 13, 25−31. (14) Gauffin Cano, P.; Santacruz, A.; Moya, A.; Sanz, Y. Bacteroides uniformis CECT 7771 Ameliorates Metabolic and Immunological Dysfunction in Mice with High-Fat-Diet Induced Obesity. PLoS One 2012, 7, e41079. (15) Park, D. Y.; Ahn, Y. T.; Park, S. H.; Huh, C. S.; Yoo, S. R.; Yu, R.; Sung, M. K.; McGregor, R. A.; Choi, M. S. Supplementation of Lactobacillus curvatus HY7601 and Lactobacillus plantarum KY1032 in Diet-Induced Obese Mice Is Associated with Gut Microbial Changes and Reduction in Obesity. PLoS One 2013, 8, 1−12. (16) Everard, A.; Belzer, C.; Geurts, L.; Ouwerkerk, J. P.; Druart, C.; Bindels, L. B.; Guiot, Y.; Derrien, M.; Muccioli, G. G.; Delzenne, N. M.; de Vos, W. M.; Cani, P. D. Cross-Talk Between Akkermansia muciniphila and Intestinal Epithelium Controls Diet-Induced Obesity. Proc. Natl. Acad. Sci. U. S. A. 2013, 110 (22), 9066−9071. (17) Fei, N.; Zhao, L. An Opportunistic Pathogen Isolated from the Gut of an Obese Human Causes Obesity in Germfree Mice. ISME J. 2013, 7, 880−884. (18) Kimura, I.; Ozawa, K.; Inoue, D.; Imamura, T.; Kimura, K.; Maeda, T.; Terasawa, K.; Kashihara, D.; Hirano, K.; Tani, T.; Takahashi, T.; Miyauchi, S.; Shioi, G.; Inoue, H.; Tsujimoto, G. The Gut Microbiota Suppresses Insulin-Mediated Fat Accumulation via the Short-Chain Fatty Acid Receptor GPR43. Nat. Commun. 2013, 4, 1829. (19) Wang, Z.; Klipfell, E.; Bennett, B. J.; Koeth, R.; Levison, B. S.; Dugar, B.; Feldstein, A. E.; Britt, E. B.; Fu, X.; Chung, Y. M.; Wu, Y.; Schauer, P.; Smith, J. D.; Allayee, H.; Tang, W. H.; DiDonato, J. A.; Lusis, A. J.; Hazen, S. L. Gut Flora Metabolism of Phosphatidylcholine Promotes Cardiovascular Disease. Nature 2011, 472, 57−63. (20) Li, F.; Jiang, C.; Krausz, K. W.; Li, Y.; Albert, I.; Hao, H.; Fabre, K. M.; Mitchell, J. B.; Patterson, A. D.; Gonzalez, F. J. Microbiome Remodelling Leads to Inhibition of Intestinal Farnesoid X-Receptor Signalling and Decreased Obesity. Nat. Commun. 2013, 4, 2384. (21) Backhed, F.; Ding, H.; Wang, T.; Hooper, L. V.; Koh, G. Y.; Nagy, A.; Semenkovich, C. F.; Gordon, J. I. The Gut Microbiota As an Environmental Factor That Regulates Fat Storage. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 15718−15723. (22) Sayin, S. I.; Wahlstrom, A.; Felin, J.; Jantti, S.; Marschall, H. U.; Bamberg, K.; Angelin, B.; Hyotylainen, T.; Oresic, M.; Backhed, F. Gut Microbiota Regulates Bile Acid Metabolism by Reducing the Levels of Tauro-Beta-Muricholic Acid, A Naturally Occurring FXR Antagonist. Cell Metab. 2013, 17, 225−235. (23) Kim, H.; Bartley, G. E.; Arvik, T.; Lipson, R.; Nah, S. Y.; Seo, K.; Yokoyama, W. Dietary Supplementation of Chardonnay Grape Seed Flour Reduces Plasma Cholesterol Concentration, Hepatic Steatosis, and Abdominal Fat Content in High-Fat Diet-Induced Obese Hamsters. J. Agric. Food Chem. 2014, 62, 1919−1925. (24) Horton, J. D.; Cuthbert, J. A.; Spady, D. K. Regulation of Hepatic 7 Alpha-Hydroxylase Expression by Dietary Psyllium in the Hamster. J. Clin. Invest. 1994, 93, 2084−2092. (25) Zhang, Z.; Wang, H.; Jiao, R.; Peng, C.; Wong, Y. M.; Yeung, V. S.; Huang, Y.; Chen, Z. Y. Choosing Hamsters but Not Rats as a Model for Studying Plasma Cholesterol-Lowering Activity of Functional Foods. Mol. Nutr. Food Res. 2009, 53, 921−930. (26) Turley, S. D.; Spady, D. K.; Dietschy, J. M. Role of Liver in the Synthesis of Cholesterol and the Clearance of Low Density Lipoproteins in the Cynomolgus Monkey. J. Lipid Res. 1995, 36, 67−79. (27) German JB, X. R.; Walzem, R.; Kinsella, J. E.; Knuckles, B.; Nakamura, M.; Yokoyama, W. H. Effect of Dietary Fats and Barley

Fiber on Total Cholesterol and Lipoprotein Cholesterol Distribution in Plasma of Hamsters. Nutr. Res. (N.Y.) 1996, 16, 1239−1249. (28) Bartley, G. E.; Yokoyama, W.; Young, S. A.; Anderson, W. H.; Hung, S. C.; Albers, D. R.; Langhorst, M. L.; Kim, H. Hypocholesterolemic Effects of Hydroxypropyl Methylcellulose Are Mediated by Altered Gene Expression in Hepatic Bile and Cholesterol Pathways of Male Hamsters. J. Nutr. 2010, 140, 1255−1260. (29) Kim, H.; Bartley, G. E.; Young, S. A.; Seo, K. H.; Yokoyama, W. Altered Hepatic Gene Expression Profiles Associated with Improved Fatty Liver, Insulin Resistance, and Intestinal Permeability after Hydroxypropyl Methylcellulose (HPMC) Supplementation in DietInduced Obese Mice. J. Agric. Food Chem. 2013, 61, 6404−6411. (30) Shi, J.; Yu, J.; Pohorly, J. E.; Kakuda, Y. Polyphenolics in Grape SeedsBiochemistry and Functionality. J. Med. Food 2003, 6, 291− 299. (31) Brown, J. C.; Huang, G.; Haley-Zitlin, V.; Jiang, X. Antibacterial Effects of Grape Extracts on Helicobacter pylori. Appl. Environ. Microbiol. 2009, 75, 848−852. (32) Su, X.; D’Souza, D. H. Grape Seed Extract for Control of Human Enteric Viruses. Appl. Environ. Microbiol. 77, 3982−3987. (33) Alexa, E.; Poiana, M. A.; Sumalan, R. M. Mycoflora and Ochratoxin a Control in Wheat Grain Using Natural Extracts Obtained from Wine Industry Byproducts. Int. J. Mol. Sci. 2012, 13, 4949−4967. (34) Baydar, N. G.; Sagdic, O.; Ozkan, G.; Cetin, S. Determination of Antibacterial Effects and Total Phenolic Contents of Grape (Vitis vinifera L.) Seed Extracts. Int. J. Food Sci. Technol. 2006, 41, 799−804. (35) Baydara, N. G.; Ö zkanb, G.; Sağdiçc, O. Total Phenolic Contents and Antibacterial Activities of Grape (Vitis vinifera L.) Extracts. Food Control 2004, 15, 335−339. (36) Mahboubi, M.; Kazempour, N.; Reza, A.; Nazar, B. Total Phenolic, Total Flavonoids, Antioxidant, and Antimicrobial Activities of Scrophularia Striata Boiss Extracts. Jundishapur J. Nat. Pharmaceutical Prod. 2013, 8, 15−19. (37) Lee, H. C.; Jenner, A. M.; Low, C. S.; Lee, Y. K. Effect of Tea Phenolics and Their Aromatic Fecal Bacterial Metabolites on Intestinal Microbiota. Res. Microbiol. 2006, 157, 876−884. (38) Queipo-Ortuno, M. I.; Boto-Ordonez, M.; Murri, M.; GomezZumaquero, J. M.; Clemente-Postigo, M.; Estruch, R.; Cardona Diaz, F.; Andres-Lacueva, C.; Tinahones, F. J. Influence of Red Wine Polyphenols and Ethanol on the Gut Microbiota Ecology and Biochemical Biomarkers. Am. J. Clin. Nutr. 2012, 95, 1323−34. (39) Hervert-Hernandez, D.; Pintado, C.; Rotger, R.; Goni, I. Stimulatory Role of Grape Pomace Polyphenols on Lactobacillus acidophilus Growth. Int. J. Food Microbiol. 2009, 136, 119−122. (40) Hidalgo, M.; Oruna-Concha, M. J.; Kolida, S.; Walton, G. E.; Kallithraka, S.; Spencer, J. P.; de Pascual-Teresa, S. Metabolism of Anthocyanins by Human Gut Microflora and Their Influence on Gut Bacterial Growth. J. Agric. Food Chem. 2012, 60, 3882−3890. (41) Kumar, M.; Nagpal, R.; Kumar, R.; Hemalatha, R.; Verma, V.; Kumar, A.; Chakraborty, C.; Singh, B.; Marotta, F.; Jain, S.; Yadav, H. Cholesterol-Lowering Probiotics As Potential Biotherapeutics for Metabolic Diseases. Exp. Diabetes Res. 2012, 2012, 1−14. (42) Huang, Y.; Wang, X.; Wang, J.; Wu, F.; Sui, Y.; Yang, L.; Wang, Z. Lactobacillus plantarum Strains As Potential Probiotic Cultures with Cholesterol-Lowering Activity. J. Dairy Sci. 2013, 96, 2746−2753. (43) Sanders, T. A. Food Production and Food Safety. BMJ 1999, 318, 1689−1693. (44) Delzenne, N. M.; Neyrinck, A. M.; Cani, P. D. Modulation of the Gut Microbiota by Nutrients with Prebiotic Properties: Consequences for Host Health in the Context of Obesity and Metabolic Syndrome. Microb. Cell Fact 2011, 10 (Suppl. 1), S10. (45) Ley, R. E.; Turnbaugh, P. J.; Klein, S.; Gordon, J. I. Microbial Ecology: Human Gut Microbes Associated with Obesity. Nature 2006, 444, 1022−1023. (46) Duca, F. A.; Sakar, Y.; Lepage, P.; Devime, F.; Langelier, B.; Dore, J.; Covasa, M. Replication of Obesity and Associated Signaling Pathways through Transfer of Microbiota from Obese Prone Rat. Diabetes 2014, 63, 1624−1636. G

DOI: 10.1021/jf5026373 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

fragilis Group by Multiplex PCR Assays Using Group- and SpeciesSpecific Primers. FEMS Microbiol. Lett. 2003, 222, 9−16. (63) Nadkarni, M. A.; Martin, F. E.; Jacques, N. A.; Hunter, N. Determination of Bacterial Load by Real-Time PCR Using a BroadRange (Universal) Probe and Primers Set. Microbiology 2002, 148, 257−266. (64) Guo, X.; Xia, X.; Tang, R.; Zhou, J.; Zhao, H.; Wang, K. Development of a Real-Time PCR Method for Firmicutes and Bacteroidetes in Feces and Its Application to Quantify Intestinal Population of Obese and Lean Pigs. Lett. Appl. Microbiol. 2008, 47, 367−373. (65) Bartosch, S.; Fite, A.; Macfarlane, G. T.; McMurdo, M. E. Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using RealTime PCR and Effects of Antibiotic Treatment on the Fecal Microbiota. Appl. Environ. Microbiol. 2004, 70, 3575−33581.

(47) Santacruz, A.; Collado, M. C.; Garcia-Valdes, L.; Segura, M. T.; Martin-Lagos, J. A.; Anjos, T.; Marti-Romero, M.; Lopez, R. M.; Florido, J.; Campoy, C.; Sanz, Y. Gut Microbiota Composition Is Associated with Body Weight, Weight Gain, and Biochemical Parameters in Pregnant Women. Br. J. Nutr. 2010, 104, 83−92. (48) Armougom, F.; Henry, M.; Vialettes, B.; Raccah, D.; Raoult, D. Monitoring Bacterial Community of Human Gut Microbiota Reveals an Increase in Lactobacillus in Obese Patients and Methanogens in Anorexic Patients. PLoS One 2009, 4, e7125. (49) Khan, M.; Raoult, D.; Richet, H.; Lepidi, H.; La Scola, B. Growth-Promoting Effects of Single-Dose Intragastrically Administered Probiotics in Chickens. Br. Poult. Sci. 2007, 48, 732−735. (50) Million, M.; Thuny, F.; Angelakis, E.; Casalta, J. P.; Giorgi, R.; Habib, G.; Raoult, D. Lactobacillus reuteri and Escherichia coli in the Human Gut Microbiota May Predict Weight Gain Associated with Vancomycin Treatment. Nutr. Diabetes 2013, 3, e87. (51) Kanda, Y.; Hinata, T.; Kang, S. W.; Watanabe, Y. Reactive Oxygen Species Mediate Adipocyte Differentiation in Mesenchymal Stem Cells. Life Sci. 2011, 89, 250−258. (52) Furuyashiki, T.; Nagayasu, H.; Aoki, Y.; Bessho, H.; Hashimoto, T.; Kanazawa, K.; Ashida, H. Tea Catechin Suppresses Adipocyte Differentiation Accompanied by Down-Regulation of PPARgamma2 and C/EBPalpha in 3T3-L1 Cells. Biosci. Biotechnol. Biochem. 2004, 68, 2353−2359. (53) Hung, P. F.; Wu, B. T.; Chen, H. C.; Chen, Y. H.; Chen, C. L.; Wu, M. H.; Liu, H. C.; Lee, M. J.; Kao, Y. H. Antimitogenic Effect of Green Tea (−)-Epigallocatechin Gallate on 3T3-L1 Preadipocytes Depends on the ERK and Cdk2 Pathways. Am. J. Physiol. Cell Physiol. 2005, 288, C1094−C1108. (54) Griffiths, E. A.; Duffy, L. C.; Schanbacher, F. L.; Qiao, H.; Dryja, D.; Leavens, A.; Rossman, J.; Rich, G.; Dirienzo, D.; Ogra, P. L. In Vivo Effects of Bifidobacteria and Lactoferrin on Gut Endotoxin Concentration and Mucosal Immunity in Balb/c Mice. Dig. Dis. Sci. 2004, 49, 579−589. (55) Fukunishi, S.; Sujishi, T.; Takeshita, A.; Ohama, H.; Tsuchimoto, Y.; Asai, A.; Tsuda, Y.; Higuchi, K. Lipopolysaccharides Accelerate Hepatic Steatosis in the Development of Nonalcoholic Fatty Liver Disease in Zucker Rats. J. Clin. Biochem. Nutr. 2014, 54, 39−44. (56) Heilig, H. G.; Zoetendal, E. G.; Vaughan, E. E.; Marteau, P.; Akkermans, A. D.; de Vos, W. M. Molecular Diversity of Lactobacillus spp. and Other Lactic Acid Bacteria in the Human Intestine As Determined by Specific Amplification of 16S Ribosomal DNA. Appl. Environ. Microbiol. 2002, 68, 114−123. (57) Walter, J.; Hertel, C.; Tannock, G. W.; Lis, C. M.; Munro, K.; Hammes, W. P. Detection of Lactobacillus, Pediococcus, Leuconostoc, and Weissella Species in Human Feces by Using Group-Specific PCR Primers and Denaturing Gradient Gel Electrophoresis. Appl. Environ. Microbiol. 2001, 67, 2578−2585. (58) Matsuki, T.; Watanabe, K.; Fujimoto, J.; Miyamoto, Y.; Takada, T.; Matsumoto, K.; Oyaizu, H.; Tanaka, R. Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces. Appl. Environ. Microbiol. 2002, 68, 5445−5451. (59) Rinttila, T.; Kassinen, A.; Malinen, E.; Krogius, L.; Palva, A. Development of an Extensive Set of 16S rDNA-Targeted Primers for Quantification of Pathogenic and Indigenous Bacteria in Fecal Samples by Real-Time PCR. J. Appl. Microbiol. 2004, 97, 1166−1177. (60) Matsuki, T.; Watanabe, K.; Fujimoto, J.; Takada, T.; Tanaka, R. Use of 16S rRNA Gene-Targeted Group-Specific Primers for RealTime PCR Analysis of Predominant Bacteria in Human Feces. Appl. Environ. Microbiol. 2004, 70, 7220−7228. (61) Matsuda, K.; Tsuji, H.; Asahara, T.; Kado, Y.; Nomoto, K. Sensitive Quantitative Detection of Commensal Bacteria by rRNATargeted Reverse-Transcription PCR. Appl. Environ. Microbiol. 2007, 73, 32−39. (62) Liu, C.; Song, Y.; McTeague, M.; Vu, A. W.; Wexler, H.; Finegold, S. M. Rapid Identification of the Species of the Bacteroides H

DOI: 10.1021/jf5026373 J. Agric. Food Chem. XXXX, XXX, XXX−XXX