Article pubs.acs.org/Langmuir
Molecular Crowding Effects on Microgel-Tethered Oligonucleotide Probes Youlong Ma and Matthew Libera* Department of Chemical Engineering and Materials Science, Stevens Institute of Technology, Hoboken, New Jersey 07030, United States ABSTRACT: Microgel tethering is a nontraditional method with which to bind oligonucleotide hybridization probes to a solid surface. Microgel-tethering physically positions the probes away from the underlying hard substrate and maintains them in a highly waterlike environment. This paper addresses the question of whether molecular crowding affects the performance of microgel-tethered molecular beacon probes. The density of probe-tethering sites is controlled experimentally using thin-film blends of biotin-terminated [PEG-B] and hydroxyl-terminated [PEG−OH] poly(ethylene glycol) from which microgels are synthesized and patterned by electron beam lithography. Fluorescence measurements indicate that the number of streptavidins, linear DNA probes, hairpin probes, and molecular beacon probes bound to the microgels increases linearly with increasing PEG-B/PEG−OH ratio. For a given tethering-site concentration, more linear probes can bind than structured probes. Crowding effects emerge during the hybridization of microgel-tethered molecular beacons but not during the hybridization of linear probes, as the tethering density increases. Crowding during hybridization is associated with conformational constraints imposed by the close proximity of closed and hybridized structured probes. The signal-to-background ratio (SBR) of hybridized beacons is highest and roughly constant for low tethering densities and decreases at the highest tethering densities. Despite differences between microgel tethering and traditional oligonucleotide surface-immobilization approaches, these results show that crowding defines an optimum tethering density for molecular beacon probes that is less than the maximum possible, which is consistent with previous studies involving various linear and structured oligonucleotide probes.
■
INTRODUCTION DNA microarray technology has played a significant role in both basic life-science research and clinical applications including diagnostics, gene expression, and pathogen detection, among others.1 In contrast to solution-based assays where a specific probe and its hybridization target are typically identified based on the color of a labeling fluorophore, the microarray format can use probe position on a solid surface to identify a particular probe sequence. Microarrays can thus interrogate a very large number of target sequences simultaneously without the need for using different colored fluorophores. Despite the advantages of the microarray format, tethering oligonucleotides to a solid surface introduces constraints not present in solution-based assays.2−7 Among these are nonspecific oligonucleotide-surface interactions and probe−probe crowding effects, both of which can affect hybridization efficiency and the ultimate assay sensitivity. Typical probe densities on a solid surface are on the order of 1011−1013/cm2, and the probes can thus be spaced close enough to interact with each other. A number of studies have explored the effects of probe density on hybridization efficiency.8−12 At low probe densities, the measured signal increases as the probe concentration increases as one would expect. As the probe concentration is further raised, however, the signal intensity can decrease. This effect has been attributed to electrostatic repulsion that suppresses the ability of target molecules to approach the surface, inhibited physical access of the target to © 2016 American Chemical Society
the probes, and modified probe conformation and probe− probe partial hybridization.13,14 Crowding effects on the performance of various hybridization platforms have commonly been studied using some form of self-assembled surface layer. Thiolated oligonucleotide probes have been used extensively.15−21 The probe concentration can be controlled by incorporating thiolated spacer molecules, such as some form of PEG-thiol or hydroxylterminated alkanethiol, into the self-assembled surface film. These spacer molecules can be introduced by direct deposition from a mixture of thiols, by backfilling after deposition of thiolated oligonucleotide probes, or by inserting thiolated probes after deposition of a thiolated spacer layer. Josephs and Ye have recently shown that the method of spacer incorporation can affect the probe distribution and, hence, probe performance under nominally equivalent spacer-probe ratios.17 Several research efforts have addressed the effects of crowding using structured probes such as hairpins or molecular beacons tethered to surfaces.20,22−26 These structured probes typically have a 5−6 base double-stranded stem and a singlestranded loop that contains the probe sequence. Molecular beacon probes place a fluorophore at the end of one stem Received: April 20, 2016 Revised: May 26, 2016 Published: June 2, 2016 6551
DOI: 10.1021/acs.langmuir.6b01518 Langmuir 2016, 32, 6551−6558
Article
Langmuir
groups (PEG−OH, Mw = 6000 Da, Sigma-Aldrich). Thin polymer films with nominal compositions of 0, 20, 40, 60, 70, 80, 90, or 100 wt % PEG-B were prepared via spin-casting by dropping 50 μL PEG solution onto plasma-treated silicon substrates at 3250 rpm for 2 min. The resulting dry films were typically 70−80 nm thick. E-beam patterning used a Zeiss Auriga CrossBeam field-emission gun (FEG) scanning electron microscope (SEM) with an electrostatic beam-blanking system. This microscope was equipped with a Nanometer Pattern Generation System (NPGS, Nabity), which was used to control the patterning. Most of the experiments here used square exposure arrays with interpixel spacings of 1 to 5 μm. All exposures were done using a focused electron beam with an incident electron energy of 2 keV and an incident beam current of about 230 pA. Dwell times were controlled to give a point dose of 10 fC. After electron irradiation, insufficiently cross-linked polymer was removed by immersing the substrates in 2−3 mL of methanol for 10 min with gentle rotary shaking at 60 rpm (shaking). The patterned substrates were then immersed twice into DI water for 5 min with shaking and then dried using flowing nitrogen gas. A typical substrate was patterned with six different 7 × 7 microgel arrays with a 3 μm intergel spacing. Probe Immobilization and Hybridization. Streptavidin (SA), unlabeled or fluorescently labeled with either Dyelight 488 or Alexa 488, was obtained from Thermo Scientific (Somerset, NJ). Prior to exposure to any oligonucleotide probe, the biotinylated microgels were activated with (unlabeled) streptavidin (200 μg/mL) in phosphate buffered saline (PBS; 100 mM sodium phosphate, 150 mM sodium chloride, pH 7.2) for 2 h at room temperature. To remove excess SA, the activated substrates were washed in PBS with 0.02% Tween20 (v/ v) under shaking and then twice again in PBS (Tween-free) for 5 min with shaking. After rinsing with DI water, the substrates were dried using gently flowing nitrogen gas. A subset of specimens was prepared using fluorescently labeled SA with the identical SA-activation procedure. After removing excess SA, these specimens were hydrated with buffer and used for fluorescence imaging. Three different probes were studied: linear, hairpin, and molecular beacon. Their sequences were based on a pan-fungi molecular beacon probe designed by Zhao et al.39 All oligonucleotide probes and targets used in this work were obtained from Integrated DNA Technologies (Coralville, Iowa). Table 1 describes the sequences used. As-received
sequence and a quencher at the end of the other stem sequence.27,28 Hybridization of the loop to the target is sufficient to open the stem and separate the fluorophore and quencher. Thiol-based tethering systems can use the underlying gold surface as the quencher. Thus, upon probe-target hybridization the hairpin opens and moves the fluorophore away from the gold surface to enable fluorescence or some other measurable signal. While different in detail from linear probes, crowding affects also appear when structured oligonucleotide probes are present at higher surface concentrations. Microgel tethering has recently been introduced as an alternate means of immobilizing molecular beacon probes to a solid surface in a microarray format.29 Microgels based on poly(ethylene glycol) [PEG] can be patterned on surfaces such as silicon or glass using focused electron beams.30,31 Like biofunctionalized colloidal microgels,32 they resist protein adsorption and cell adhesion, and they can be used to modify the biointeractive properties of surfaces.33,34 Tethering sites can be introduced into the microgels by using PEG-based homopolymer precursor with functional end groups.35−37 We have used biotinylated PEG (PEG-B) to create surfacepatterned microgels that can be activated with streptavidin (SA) and to which biotinylated molecular beacons can be tethered.29,38 Importantly, an individual e-beam-patterned microgel has a unique structure where there is a core with a very high cross-link density surrounded by a corona whose cross-link density progressively decreases away from the core. Oligonucleotide probes bind to the outermost portions of the microgel. There they find themselves in a waterlike environment with minimal conformational constraints. They are furthermore physically separated from the underlying hard substrate, and nonspecific interactions between the probes and the substrate are thus minimized. Here we address the question of whether the crowding effects that have been observed previously with various oligonucleotide probes bound to a solid surface manifest themselves in a microgel-tethered system. A microgel platform provides a unique means by which to control the average probe spacing, namely by controlling the concentration of functional sites within the microgel. Here we achieve this control by blending PEG-B homopolymer and hydroxyl-terminated PEG (PEG−OH) homopolymer in the precursor thin film prior to ebeam patterning. We study linear, hairpin, and molecular beacon probes. For the range of tethering site densities studied here, we do not observe crowding effects with linear probes. Similarly, at low tethering densities, hybridized molecular beacon probes exhibit a very linear increase of fluorescent signal with increasing tethering density. This intensity ultimately begins to decrease at higher concentrations, however. Our experiments suggest that this crowding effect is due to limited accessibility of the targets to the molecular beacon probes.
■
Table 1. Summary of the Oligonucleotide Probes and Targetsa name
sequence (5′−3′)
linear probe
CGCGATATTCGGTAAGCGTTGGATTGTAGCGC-TEGbiotin Alex488NCGCGATATTCGGTAAGCGTTGGATTGATCGCGBHQ2-TEG-biotin Alex488NCGCGATATTCGGTAAGCGTTGGATTGATCGCG-TEGbiotin GGGTGAACAATCCAACGCTTACCGAATTCTGC
MB probe hairpin probe unlabeled target labeled target
Alex488NTGGGTGAACAATCCAACGCTTACCGAATTCTGC
a
The stem regions of the molecular beacon (MB) probes and hairpin probes are underlined. Complementary sequences are italicized.
EXPERIMENTAL METHODS
Microgel Patterning. Surface-patterned microgel substrates were prepared using techniques previously described in the literature.29−31 The 5 mm × 7 mm single-crystal silicon substrates (Ted Pella) were cleaned in piranha solution (3 parts H2SO4/1 part H2O2) for 20 min, rinsed 3 times using type 1 (Millipore) deionized (DI) water and then sonicated in DI water for 10 min. These substrates were then exposed to oxygen plasma for 6 min. Spin-casting was done using 2 wt % polymer solutions in tetrahydrofuran (THF) from mixtures of poly(ethylene glycol) [PEG] homopolymer with either biotin end groups [PEG-B, Mw = 5000 Da, CreativePEGworks) or hydroxyl end
lyophilized probe or target oligonucleotide was dissolved in deionized nuclease-free water (Biopak polisher, Millipore) to obtain a 100 μM stock solution. Prior to use, each stock solution was further diluted by a factor of 100 in a 10% PBS buffer (0.1× PBS; 10 mM sodium phosphate, 15 mM sodium chloride, pH 7.2). All three probes had at their 3′ end a triethylene glycol (TEG) spacer and a biotin. This combination was preceded in the molecular beacon probe by a black hole quencher 2 (BHQ2) moiety. Both the hairpin and molecular beacon probes had a stem sequence of six complementary nucleotides at each end with an Alexa 488 fluorophore at the 5′ end. Probe 6552
DOI: 10.1021/acs.langmuir.6b01518 Langmuir 2016, 32, 6551−6558
Article
Langmuir tethering to SA-activated microgel-patterned substrates used a 30 μL droplet of 1 μM probe solution deposited directly onto the patterned substrate and incubated for 1 h at room temperature. The specimens were then washed twice with 0.1× PBS under 60 rpm shaking for 5 min. A subset of specimens with immobilized hairpin probes was used for fluorescence imaging with the microgels hydrated in 0.1× PBS buffer. The rest of the specimens were used in hybridization experiments. After probe immobilization and prior to drying, specimens were immersed into DI water to remove salt and then dried using gently flowing nitrogen gas. These specimens were then exposed to 30 μL of 1 μM target (either labeled or unlabeled) solution in hybridization buffer (4 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, pH 8.0) deposited directly onto the patterned surface and left there for 1 h at room temperature. After this hybridization process, the specimens were washed twice with 0.1× PBS (10 min under shaking) and used in this condition for fluorescence imaging. Imaging. The fluorescence emitted by the various samples was quantified using a Nikon E1000 upright optical microscope with a mercury lamp source and a SensiCam high-sensitivity CCD Camera (Cooke). Imaging of hydrated specimens was carried out using a Nikon Plan Apo VC 60× (NA = 1.2) water-immersion objective lens and 0.170 mm glass coverslips. A typical exposure time was 500 ms. Digital image data were analyzed with ImageJ and Fiji.40,41 The topographical structure of surface-patterned dry microgels was characterized with atomic force microscopy (Nano-R, Pacific Nanotechnology) under tapping mode.
at tenth maximum of about 300 nm and a height of about 60 nm. The fact that the dry microgel height is somewhat less than that of the original solvent-cast polymer film, 70−80 nm thick, can be attributed to mass loss during electron irradiation due to chain scission events within the polymer film or to removal of insufficiently cross-linked precursor during development after patterning. The slight variations in microgel height and width that are manifested by these profiles are likely due in part to the structure of the precursor polymer thin film. These PEG-based films are semicrystalline with local variations in crystallinity and lamellar orientation together with occasional grain boundaries between adjacent spherulites, all of which can affect the electron−polymer interactions and subsequent radiation chemistry. When hydrated, each microgel swells, predominantly in the vertical direction,31 in amounts controlled by the incident electron energy and dose. However, the swelling is spatially nonuniform within a microgel, because the energy deposition and, hence, the distribution of cross-links throughout the microgel is nonuniform.30 The cross-link density is lowest and the swelling is highest at and near the microgel surface. Figure 2 shows typical fluorescence image data taken from a 7 × 7 microgel array with a 3 μm intergel spacing patterned from a 80 wt % PEG-B/20 wt % PEG−OH thin film. After patterning, the microgel array was activated with streptavidin,
■
RESULTS AND DISCUSSION PEG Microgel Properties. This project used arrays of individual microgels patterned on silicon substrates. Figure 1
Figure 1. AFM image of a 6 × 6 array of discrete (dry) microgels (60 wt % PEG-B) patterned on a silicon substrate (top). Three different profiles of height from three different pairs of microgels (bottom) indicate that the size and shape of the microgels are quite uniform.
shows an example of a typical microgel array. It is an AFM image of (dry) microgels patterned in a 6 × 6 square array with a 1 μm intergel spacing from a 60 wt % PEG-B/40 wt % PEG− OH thin film. Because of the flexibility of e-beam patterning, changing the intergel spacing or array pattern is simple. Figure 1B shows a series of height profiles across several pairs of microgels at different locations within this array. The aspect ratio (height/width) of each microgel is small with a full-width
Figure 2. Fluorescence images from an electron-beam patterned 80 wt % PEG-B/20 wt % PEG−OH film activated with streptavidin and functionalized with a hairpin probe. The 7 × 7 array (B) was repeated 6 times to obtain a 3 × 2 set of arrays (A). 6553
DOI: 10.1021/acs.langmuir.6b01518 Langmuir 2016, 32, 6551−6558
Article
Langmuir functionalized with a fluorescently labeled hairpin probe, and exposed to linear target for 1 h. The dsDNA was further stained using picogreen. The fluorescence intensity per microgel (microgel intensity) was determined by measuring the total counts within an area surrounding a microgel (e.g., box 1, Figure 2B) less the total counts within an identical area away from a microgel (e.g., box 2, Figure 2B). Variations in microgel intensity are in part due to structural variations within the microgel as described above. They may also be partly caused by lateral fluctuations in the concentration of PEG-B. However, the relative uniformity of the microgel intensity observed in Figure 2 indicates that there is no large-scale phase separation between PEG-B and PEG−OH as one could expect if these homopolymers exhibited significant immiscibility. While fluorescence measurements do not directly give the precise number of binding sites within microgel, the variation of biotin sites as a function of PEG-B content in the precursor polymer thin film can be determined by exposing as-patterned microgels to fluorescently labeled streptavidin. Figure 3 shows
Because the linear probes were unlabeled, these specimens were also exposed to fluorescently labeled target. Otherwise the experiments were done identically, including the fluorescence imaging where the illumination conditions and the exposure times were identical. Figure 4 describes the results of this
Figure 4. There is a linear increase with increasing binding-site density for both the hybridized linear probe and the hairpin probe. Each data point represents the average and the error bar corresponds to the standard deviation of measurements from at least 15 different microgels sampled from different microgel arrays on different silicon substrates. The lines represent linear least-squares fits to each data set.
experiment. In both cases, there is a linear increase in the average microgel fluorescence intensity with increasing PEG-B concentration. These data show that the tethering-site densities studied here do not significantly restrict the tethering of either the linear or hairpin probes to the microgels. This finding is consistent with previous work using thiolated systems where increased binding densities can alter probe conformation, such as forcing the formation of ordered brush conformations at the highest densities, but the probes can nevertheless still bind. One notable difference manifested by Figure 4 is that the rate of increase in microgel fluorescence intensity with increasing PEG-B content is higher for the hybridized linear probes than it is for the hairpin probes. Care was taken to maintain all elements of the experiment as constant as possible, so the differences in fluorescence intensity indicate tethering differences between these two probe types. The fluorescence intensity from the hybridized linear probes is everywhere greater than that for the hairpin probes, so there must be more hybridized linear probes than hairpin probes for a given PEG-B composition. This may be because the streptavidin activation can create multiple possible tethering sites at each activated biotin site, which can be more efficiently accessed by the linear probes given their relative conformational flexibility. Hybridized microgel-tethered molecular beacon probes respond very differently than hybridized linear probes as the tethering-site density on the microgels is increased. Figure 5A illustrates the change in microgel fluorescence intensity as a function of microgel PEG-B content for molecular beacons hybridized to their unlabeled linear target. At the lower tethering densities, the microgel intensity increases linearly with increasing PEG-B content. The dashed line shows a linear leastsquares fit to the 0, 20, 40, and 60 wt % PEG-B data points, and this line fits these data well. Beyond the 60 wt % PEG-B concentration, however, the fluorescence intensity decreases
Figure 3. Normalized average microgel fluorescence intensity, measured in two different experiments, increases linearly with increasing PEG-B concentration in the precursor thin film. Typical images from one set of experiments are shown at the top.
that the fluorescence intensity increases almost linearly with increasing PEG-B content. The average microgel intensity was determined for 6 compositions (0, 20, 40, 60, 80, 100 wt % PEG-B) in two different sets of experiments using two different array patterns, two different fluorophores, and different fluorescence microscope illumination conditions. When normalized to their respective maxima (determined from a linear least-squares fit to each data set), however, the data in both cases fall close to the same line. We can conclude from these results that composition is an effective means by which to control the density of functional sites within this PEG-based system. Hairpins and Linear Probes. We next explored the question of whether secondary structure affects probe tethering to the microgels. We exposed identical sets of streptavidinactivated microgel arrays to linear and hairpin probes (Table 1). 6554
DOI: 10.1021/acs.langmuir.6b01518 Langmuir 2016, 32, 6551−6558
Article
Langmuir
dimensional surface, microgels present tethering sites in three dimensions throughout the high-swelling periphery of the microgel surface where the cross-link density is low. Hence, it is conceivable that two hybridized molecular beacons can not only be laterally close to each other but also offset in the third dimension so that the fluorophore of one is in close proximity to the quencher of the other (Figure 6). To assess whether this
Figure 6. Schematic illustration of molecular beacon probes tethered to the outermost portion of a e-beam patterned PEG microgel via a biotin−streptavidin−biotin (B-SA-B) linker. The diffuse nature of the microgel outer surface enables probe tethering in all three dimensions. High tethering densities can restrict some of the many degrees of translational and rotational freedom of both the tethering sites and the tethered probes.
proximal quenching effect is significant, we functionalized SAactivated 100 wt % PEG-B microgels with hairpin probes fluorescently labeled at their 5′ end (Table 1). The average microgel intensity from these hairpin probes (Figure 7) was
Figure 5. (A) The increasing signal intensity from hybridized molecular beacon probes deviates from linearity as the probe density increases. The increase in the background intensity is linear over the same range. (B) The decreasing signal and increasing background at the highest binding densities decrease the signal to background ratio.
relative to the linear extrapolation. The average microgel intensity measured from the 100 wt % PEG-B sample, for example, is only about half of that predicted by the extrapolation of the linear fit to the lower concentration data. The nonlinear behavior of the molecular beacon probes is most likely not due to a change in the tethering rate of the probes. The molecular beacon probes are identical to the hairpin probes except for the additional quenching moiety at the stem. We can thus expect that the linear increase of microgel intensity manifested by the hairpin probes (Figure 4) should be characteristic of the molecular beacon probes, as well. We furthermore have direct information from the background signal of the molecular beacon probes. The background was measured by fluorescence imaging of microgel arrays functionalized with molecular beacon probes prior to hybridization. Figure 5A shows that the background signal increases linearly with increasing PEG-B content, again indicating that the tethering of the molecular beacon probes is not significantly hindered by an increase in the tethering-site density. The nonlinear behavior must thus have something to do with the hybridization process. One possible reason underlying the decrease in hybridized molecular beacon signal at the highest PEG-B concentrations could be interactions between the fluorophore of one hybridized molecular beacon with the quencher of another hybridized molecular beacon. In contrast to thiol-based experiments where the probes are organized along a two-
Figure 7. Microgel (100 wt % PEG-B) intensity characteristic of hairpin probes (HP) is about the same as that for hairpin probes hybridized to target labeled at the 5′ end with BHQ2 (HP + BHQ2 target) indicating that on average a quencher hybridized to one hairpin has little effect on the fluorescence from an adjacent hairpin.
24 940 ± 1450 counts. We then exposed these hairpins to complementary linear DNA labeled not with a fluorophore but instead with BHQ2 at their 5′ end. Thus, when hybridized the hairpin fluorophore would be sufficiently far from its complementary quencher to enable fluorescence. However, if quenchers from other hybridized hairpins were close enough we would expect the fluorescence intensity to decrease. After hybridization, the average microgel intensity was 25 180 ± 2040 6555
DOI: 10.1021/acs.langmuir.6b01518 Langmuir 2016, 32, 6551−6558
Article
Langmuir counts (Figure 7) and is quite comparable to the fluorescent intensity of the unhybridized hairpin probe. Thus, the effects of proximal quenching, if present, are small and cannot account for the nonlinear behavior of the hybridized molecular beacon probes as a function of PEG-B concentration (Figure 5). A second possible reason for the reduced signal at higher binding densities would be the less efficient hybridization of the linear target to the molecular beacon probe. To test this, we exposed microgels functionalized with fluorescently labeled hairpin probes to fluorescently labeled target. We did the experiment twice at two very different time points and normalized the data to account for variations in the fluorescence imaging conditions. The results are summarized by Figure 8A. As observed previously (Figure 4), the
Furthermore, in this lower PEG-B regime the intensity of the labeled target is almost the same as the intensity of the hairpin probe, and the hybridization efficiency, given by the ratio of these two intensities, is close to unity (Figure 8B). At higher PEG-B concentrations, the intensity from the hybridized hairpin and thus the intensity of the linear target both deviate from linearity. As illustrated by Figure 8B, in the higher PEG-B regime the hybridization efficiency falls to about 0.4. The results of these experiments thus indicate that hybridization to the linear target is responsible for the reduced signal characteristic of microgel-tethered molecular beacon probes at higher binding densities. The origin of the crowding observed in these experiments appears to be predominantly due to steric effects. The average molecular beacon probe density on a 100 wt % PEG-B microgel was previously measured by Dai et al. to be about 5 × 1012/cm2 in an experimental system quite similar to that used here.29 This concentration corresponds to an average spacing of about 5 nm between probes, and crowding effects have been observed previously in thiol-based molecular-beacon-based systems with similar probe densities.20,22,23 Interestingly, however, the microgel system exhibits these effects because tethering occurs on the outermost portions of the microgel where the minimum condition for stable gel formation, one cross-link per molecule, is just met (Figure 6).30 The tethered probes are thus each attached to the free end of a highly flexible macromolecule in a good solvent. Thus, when the molecular beacon probe density is relatively low the probes not only have a significant amount of translational and rotational freedom but are also sufficiently separated that the hybridization of one probe does not interfere with the hybridization of an adjacent probe. When the molecular beacon probe density is high, we speculate that the first probes to hybridize, presumably those on the outermost portions of the microgel, either sterically inhibit the penetration of linear target into the underlying regions of microgel or sterically inhibit target-beacon hybridization. The fact that similar crowding behavior was not exhibited by linear probes despite an even higher binding density (Figure 4) suggests that the relative flexibility of the linear probes plays a role in their higher degree of hybridization at high tethering densities. Linear probes furthermore do not have the additional constraint of achieving a threshold level of hybridization sufficient to break a six-base-pair stem like that on the molecular beacon probes, and they are thus able to tolerate a greater number of hybridization mismatches than can molecular beacon probes. Presumably, crowding effects would manifest themselves with the linear probes if we were to explore even higher tethering densities. In this high-density regime, electrostatic effects are furthermore likely to add an additional inhibiting component to the hybridization process.12 From a more practical point of view where one can consider using microgel-tethered molecular beacon probes in a diagnostic platform, the crowding effects can be very important. Figure 5B shows that the signal-to-background ratio (SBR) is relatively constant at low probe-tethering density with a value of about 11. In this regime, the hybridization efficiency is close to unity and both the signal and the background increase linearly with increasing tethering density. Significantly, this SBR value indicates a quenching efficiency, QE = 1 − 1/SBR, of about 91% prior to hybridization, which is consistent with the value of 93% reported by Marras et al.42 for the same fluorophore and quencher in a system of untethered molecular beacons in buffer. With increasing PEG-B, the background
Figure 8. (A) The concentration of microgel-tethered hairpin probes increases linearly with increasing binding density but the concentration of hybridized targets increases linearly only for lower binding densities. (B) The hybridization efficiency is close to unity for low binding densities but decreases to about 0.4 at higher binding densities.
fluorescence intensity of the hairpin (red squares) increases linearly (red dashed line) with increasing PEG-B content. After hybridization to a linear target labeled by the same fluorophore, the fluorescence intensity of the hybridized hairpin (green diamonds) is everywhere higher than the intensity from the hairpin alone. The fluorescence intensity due to the labeled target alone (inverted blue triangles), given by the intensity difference between the hybridized hairpin and the hairpin probe by itself, is linear for the lower PEG-B concentrations. 6556
DOI: 10.1021/acs.langmuir.6b01518 Langmuir 2016, 32, 6551−6558
Langmuir
■
continues to increase linearly but the signal decreases. Hence, the SBR decreases to a value of about 6 for the 100 wt % PEGB. While such a value is often sufficient for discriminating between positive and negative cases within a diagnostic test, the probability of a false positive decreases with increasing SBR. In particular, the signal will depend on many factors such as the nature of the beacon, the length of the target, and the nature of the hybridization buffer, among others, but these results indicate, like a number of studies before this one, that better performance is achieved at some intermediate binding density that finds the proper compromise between the amount of signal increase associated with a higher probe concentration and the amount of signal decrease due to hybridization inefficiencies under conditions of probe crowding.
Article
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This research project has been supported by the National Science Foundation via Grant CBET-1402706.
■
■
REFERENCES
(1) Heller, M. J. DNA Microarray Technology: Devices, Systems, and Applications. Annu. Rev. Biomed. Eng. 2002, 4 (1), 129−153. (2) Elder, R. M.; Pfaendtner, J.; Jayaraman, A. Effect of hydrophobic and hydrophilic surfaces on the stability of double-stranded DNA. Biomacromolecules 2015, 16 (6), 1862−1869. (3) Rao, A. N.; Grainger, D. W. Biophysical properties of nucleic acids at surfaces relevant to microarray performance. Biomater. Sci. 2014, 2 (4), 436−471. (4) Ravan, H.; Kashanian, S.; Sanadgol, N.; Badoei-Dalfard, A.; Karami, Z. Strategies for optimizing DNA hybridization on surfaces. Anal. Biochem. 2014, 444 (1), 41−46. (5) Shchepinov, M. S.; Case-Green, S. C.; Southern, E. M. Steric factors influencing hybridisation of nucleic acids to oligonucleotide arrays. Nucleic Acids Res. 1997, 25 (6), 1155−1161. (6) Southern, E.; Mir, K.; Shchepinov, M. Molecular interactions on microarrays. Nat. Genet. 1999, 21, 5−9. (7) Wang, Z.; Zeng, X.; Deng, Y.; He, N.; Wang, Q.; Huang, J. Molecular dynamics simulations of end-tethered single-stranded DNA probes on a silica surface. J. Nanosci. Nanotechnol. 2011, 11 (10), 8457−8468. (8) Castronovo, M.; Radovic, S.; Grunwald, C.; Casalis, L.; Morgante, M.; Scoles, G. Control of steric hindrance on restriction enzyme reactions with surface-bound DNA nanostructures. Nano Lett. 2008, 8 (12), 4140−4145. (9) Jayaraman, A.; Hall, C. K.; Genzer, J. Computer simulation study of probe-target hybridization in model DNA microarrays: Effect of probe surface density and target concentration. J. Chem. Phys. 2007, 127 (14), 144912. (10) Lei, Q. L.; Ren, C. L.; Su, X. H.; Ma, Y. Q. Crowding-induced cooperativity in DNA surface hybridization. Sci. Rep. 2015, 5, 9217. (11) Nakano, S. I.; Miyoshi, D.; Sugimoto, N. Effects of molecular crowding on the structures, interactions, and functions of nucleic acids. Chem. Rev. 2014, 114 (5), 2733−2758. (12) Wong, I. Y.; Melosh, N. A. An electrostatic model for DNA surface hybridization. Biophys. J. 2010, 98 (12), 2954−2963. (13) Gong, P.; Levicky, R. DNA surface hybridization regimes. Proc. Natl. Acad. Sci. U. S. A. 2008, 105 (14), 5301−5306. (14) Harrison, A.; Binder, H.; Buhot, A.; Burden, C. J.; Carlon, E.; Gibas, C.; Gamble, L. J.; Halperin, A.; Hooyberghs, J.; Kreil, D. P.; Levicky, R.; Noble, P. A.; Ott, A.; Pettitt, B. M.; Tautz, D.; Pozhitkov, A. E. Physico-chemical foundations underpinning microarray and nextgeneration sequencing experiments. Nucleic Acids Res. 2013, 41 (5), 2779−2796. (15) Boozer, C.; Chen, S.; Jiang, S. Controlling DNA orientation on mixed ssDNA/OEG SAMs. Langmuir 2006, 22 (10), 4694−4698. (16) Herne, T. M.; Tarlov, M. J. Characterization of DNA probes immobilized on gold surfaces. J. Am. Chem. Soc. 1997, 119 (38), 8916−8920. (17) Josephs, E. A.; Ye, T. Nanoscale spatial distribution of thiolated DNA on model nucleic acid sensor surfaces. ACS Nano 2013, 7 (4), 3653−3660. (18) Peeters, S.; Stakenborg, T.; Reekmans, G.; Laureyn, W.; Lagae, L.; Van Aerschot, A.; Van Ranst, M. Impact of spacers on the hybridization efficiency of mixed self-assembled DNA/alkanethiol films. Biosens. Bioelectron. 2008, 24 (1), 72−77.
SUMMARY AND CONCLUSIONS Microgel tethering is a nontraditional method with which to bind structured hybridization probes such as molecular beacons to a solid surface in a microarray format while preserving those probes in as waterlike an environment as possible. This tethering format has been particularly effective for molecular beacon probes whose performance in liquids is well established but has been compromised in microarray formats because of interactions with the underlying substrate. Here we addressed the question of whether molecular crowding induced by the proximity of probes to each other affects the performance of microgel-tethered molecular beacon probes. We controlled the density of probe-tethering sites using thinfilm blends of biotin-terminated (PEG-B) and hydroxylterminated poly(ethylene glycol) [PEG−OH], and from these films we synthesized and patterned microgels on surfaces using a variation of electron beam lithography. From measurements of fluorescence intensity, we showed that the number of streptavidins, linear DNA probes, hairpin DNA probes, and molecular beacon probes bound to the microgels increases linearly with increasing PEG-B/PEG−OH ratio. For a given tethering-site concentration, more linear probes are able to bind than can structured hairpin and molecular beacon probes. We attribute this behavior to the greater conformational flexibility associated with the linear probes. We find that crowding effects emerge for microgel-tethered molecular beacons as the tethering density increases. While the number of tethered molecular beacon probes increases linearly with increasing PEG-B concentration, the fluorescence signal from molecular beacons hybridized to linear targets becomes nonlinear at the highest tethering densities. We showed that this effect is not due to proximal quenching where the fluorophore of one hybridized beacon is quenched by the quencher of an adjacent beacon. The crowding effect instead appears to be a consequence of inhibited hybridization, presumably due to conformational constraints imposed by the close proximity of molecular beacon probes and doublestranded DNA (hybridized molecular beacons). The signal-tobackground ratio of hybridized molecular beacon probes is highest and roughly constant in the regime of lower tethering densities where the signal and background both exhibit linear behavior. The SBR decreases at the highest tethering densities. Despite differences between microgel tethering and traditional oligonucleotide surface-immobilization approaches, these results show that crowding effects define an optimum binding-site density that is less than the maximum possible consistent with previous studies involving various linear and structured oligonucleotide probes. 6557
DOI: 10.1021/acs.langmuir.6b01518 Langmuir 2016, 32, 6551−6558
Article
Langmuir (19) Peterson, A. W.; Heaton, R. J.; Georgiadis, R. M. The effect of surface probe density on DNA hybridization. Nucleic Acids Res. 2001, 29 (24), 5163−5168. (20) Ricci, F.; Lai, R. Y.; Heeger, A. J.; Plaxco, K. W.; Sumner, J. J. Effect of molecular crowding on the response of an electrochemical DNA sensor. Langmuir 2007, 23 (12), 6827−6834. (21) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Electrochemical quantitation of DNA immobilized on gold. Anal. Chem. 1998, 70 (22), 4670−4677. (22) Cederquist, K. B.; Keating, C. D. Hybridization efficiency of molecular beacons bound to gold nanowires: effect of surface coverage and target length. Langmuir 2010, 26 (23), 18273−80. (23) Cederquist, K. B.; Stoermer Golightly, R.; Keating, C. D. Molecular Beacon−Metal Nanowire Interface: Effect of Probe Sequence and Surface Coverage on Sensor Performance. Langmuir 2008, 24 (16), 9162−9171. (24) Chen, T.; Tan, W. Molecular beacons on solid surfaces. In Molecular Beacons; Springer-Verlag: Berlin Heidelberg, 2013; pp 75− 90. (25) Du, H.; Strohsahl, C. M.; Camera, J.; Miller, B. L.; Krauss, T. D. Sensitivity and specificity of metal surface-immobilized “molecular beacon” biosensors. J. Am. Chem. Soc. 2005, 127 (21), 7932−7940. (26) Kjällman, T. H. M.; Peng, H.; Soeller, C.; Travas-Sejdic, J. Effect of probe density and hybridization temperature on the response of an electrochemical hairpin-DNA sensor. Anal. Chem. 2008, 80 (24), 9460−9466. (27) Tan, W.; Wang, K.; Drake, T. J. Molecular Beacons. Curr. Opin. Chem. Biol. 2004, 8 (5), 547−553. (28) Tyagi, S.; Kramer, F. R. Molecular Beacons: Probes that Fluoresce upon Hybridization. Nat. Biotechnol. 1996, 14 (3), 303−308. (29) Dai, X.; Yang, W.; Firlar, E.; Marras, S. A. E.; Libera, M. Surfacepatterned microgel-tethered molecular beacons. Soft Matter 2012, 8, 3067−3076. (30) Wang, Y.; Firlar, E.; Dai, X.; Libera, M. Poly(ethylene glycol) as a biointeractive electron-beam resist. J. Polym. Sci., Part B: Polym. Phys. 2013, 51 (21), 1543−1554. (31) Krsko, P.; Mansfield, M.; Sukhishvili, S.; Clancy, R.; Libera, M. Electron-Beam Patterned Poly(Ethylene Glycol) Microhydrogels. Langmuir 2003, 19, 5618−5625. (32) Su, S.; Ali, M. M.; Filipe, C. D. M.; Li, Y.; Pelton, R. MicrogelBased Inks for Paper-Supported Biosensing Applications. Biomacromolecules 2008, 9, 935−941. (33) Kolodziej, C. M.; Maynard, H. D. Electron-beam lithography for patterning biomolecules at the micron and nanometer scale. Chem. Mater. 2012, 24 (5), 774−780. (34) Krsko, P.; Libera, M. Biointeractive Hydrogels. Mater. Today 2005, 8 (12), 36−44. (35) Christman, K. L.; Schopf, E.; Broyer, R. M.; Li, R. C.; Chen, Y.; Maynard, H. D. Positioning multiple proteins at the nanoscale with electron beam cross-linked functional polymers. J. Am. Chem. Soc. 2009, 131 (2), 521−527. (36) Saaem, I.; Papasotiropoulos, V.; Wang, T.; Soteropoulos, P.; Libera, M. Hydrogel-based protein nanoarrays. J. Nanosci. Nanotechnol. 2007, 7 (8), 2623−2632. (37) Hong, Y.; Krsko, P.; Libera, M. Protein surface patterning using nanoscale poly(ethylene glycol) nanohydrogels. Langmuir 2004, 20 (25), 11123−11126. (38) Dai, X.; Libera, M. Dip-pen microarraying of molecular beacon probes on microgel thin-film substrates. Analyst 2014, 139 (21), 5568−5575. (39) Zhao, Y. A.; Park, S.; Kreiswirth, B. N.; Ginocchio, C. C.; Veyret, R.; Laayoun, A.; Troesch, A.; Perlin, D. S. Rapid Real-Time Nucleic Acid Sequence-Based Amplification-Molecular Beacon Platform To Detect Fungal and Bacterial Bloodstream Infections. J. Clin Microbiol 2009, 47 (7), 2067−2078. (40) Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; Tinevez, J.-Y.; White, D. J.; Hartenstein, V.; Eliceiri, K.;
Tomancak, P.; Cardona, A. Fiji: an open-source platform for biological-image analysis. Nat. Methods 2012, 9 (7), 676−682. (41) Schneider, C. A.; Rasband, W. S.; Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9 (7), 671− 675. (42) Marras, S. A.; Kramer, F. R.; Tyagi, S. Efficiencies of fluorescence resonance energy transfer and contact-mediated quenching in oligonucleotide probes. Nucleic Acids Res. 2002, 30 (21), 122e.
6558
DOI: 10.1021/acs.langmuir.6b01518 Langmuir 2016, 32, 6551−6558
