Molecular Dynamics of Double Stranded Xylo-Nucleic Acid - Journal

Subscriber access provided by UNIV OF NEWCASTLE

Article

Molecular Dynamics of double stranded Xylo Nucleic Acid (XyloNA) Amutha Ramaswamy, Daryna Smyrnova, Mattheus Froeyen, Mohitosh Maiti, Piet Herdewijn, and Arnout Ceulemans J. Chem. Theory Comput., Just Accepted Manuscript • DOI: 10.1021/acs.jctc.7b00309 • Publication Date (Web): 25 Jul 2017 Downloaded from http://pubs.acs.org on July 27, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Chemical Theory and Computation is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Chemical Theory and Computation

Molecular Dynamics of double stranded Xylo Nucleic Acid (XyloNA) Amutha Ramaswamy1, 3, Daryna Smyrnova1, Mathy Froeyen2, Mohitosh Maiti2, Piet Herdewijn2, Arnout Ceulemans1 1.

Laboratory for Quantum Chemistry, KULeuven, Celestijnenlaan 200F, B-3001

Leuven, Belgium 2.

Laboratory for Medicinal Chemistry, KULeuven, Herestraat 49, B-3000 Leuven,

Belgium 3.

Centre for Bioinformatics, School of Life Sciences, Pondicherry University,

Puducherry 605014, India

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 38

ABSTRACT. Xylo-nucleic acid (XyloNA) is a synthetic analogue of ribo-nucleic acid (RNA), where the ribose sugar has been replaced by xylose. We present a Molecular Dynamics study of the conformational evolution of XyloNA double strand oligomers derived from A-RNA through the substitution of beta-ᴅ-ribofuranose by beta-ᴅ-xylofuranose and having lengths of 8, 16 and 29 base pairs, using a set of independent all-atom simulations performed at various time scales ranging from 55 to 100 ns, with one long 500 ns simulation of the 29-mer. In order to validate the robustness of XyloNA conformation, a set of simulations using various cut-off distances and solvation box dimensions have also been performed. These independent simulations reveal the uncoiling or elongation of the initial conformation to form an open ladder type transient state conformation and the subsequent formation of a highly flexible duplex with a tendency to coil in a left-handed fashion. The observed open ladder conformation is in line with recently obtained NMR data on the XyloNA 8-mer derived using 5'-d(GUGUACAC)-3' . The observed negative inter-base pair twist leads to the observed highly flexible left-handed duplex, which is significantly less rigid than the stable left- handed dXyloNA duplex having strong negative twist. A comparison between the xylo-analogues of DNA and RNA shows a clear distinction between the helical parameters, with implications for the pairing mechanism.


Page 3 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION: XENO-NUCLEIC ACIDS The genetic information system is based on the unique molecular properties and evolutionary longevity of DNA and RNA molecules. The versatility and biological importance of these nucleic acids (NAs) make them the subject of numerous aspiring research activities. Besides the master play of these genetic materials in all natural forms of life, synthetic biologists seek to develop modified and programmable genetic regulators as orthogonal information systems (which are versatile enough to compete with the natural abilities of the genetic materials) capable of controlling gene expression, precisely. In line to this scenario, xenobiology has emerged as a novel approach to design and develop counter parts for the natural genetic materials. Hence, the uniqueness in the properties of NAs could be better understood by comparing them to mimetic xeno-nucleic acids.1-3 The modified nucleic acids gained much importance in a therapeutic context as they express enhanced characteristics as compared to natural nucleic acids and hence aid in understanding the limits of biological- or chemical information storage. The research areas of xeno-nucleic acids include numerous chemical modifications either in nucleo-base, sugar moiety, or backbone phosphate group. Chemically modified bases have gained great attraction due to their numerous pharmacological, biochemical, and biological applications.4-6 Substitution of nitrogen in pyrimidine and purine DNA bases by phosphorus resulted in novel nucleo-bases of special interest, such as the phosphorus-containing cytosine analogue, diphospho-cytosine.7 Backbone modified nucleic acids were also investigated by several research groups.8-9 A study on oligodeoxyribonucleotides, where the phosphodiester linkage in the backbone is replaced by an amide / amine -type linker, revealed a significant effect on the polymerase reaction.10 A new class of backbone modified potent nucleic acids analogs is based on



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 38

peptide nucleic acids (PNAs), in which the sugar phosphate backbone is replaced by a pseudo-peptide polymer, linked to the nucleo-bases.11-12 The sugar moiety is the principal causative agent creating the structural and functional diversity of DNA versus RNA and hence any modifications in the sugar moiety would influence their properties remarkably. Sugar modified derivatives like cyclonucleosides and arabinonucleosides have also shown biological activity.13 Similarly, ribonucleosides derived by substituting the 2'-hydroxyl moiety by fluorine, amino or methoxy groups have also been studied extensively.14-16 Therapeutic applications of locked nucleic acids designed to mimic RNA, have been well documented in the recent years. Here the ribose sugar moiety is locked by an oxymethylene bridge connecting the C2' and C4' atoms in order to impose conformational restriction to adopt C3'-endo/N-type furanose conformation.17 Very recently, Fiori et al. have reported locked NA as promising candidates for miRNA inhibition.18 Our research is involved in exploring the xeno-nucleic acid systems such as dXyloNA and XyloNA as orthogonal systems to the natural nucleic acids, DNA and RNA. Efforts have been put forth to understand the structural features of XyloNAs in comparison with natural systems using molecular dynamics approach to highlight the geometrical similarities as well as differences, if any. Studies on the structural features of these orthogonal nucleic acids from the molecular dynamics simulations have been first initiated by analyzing the dynamic properties of deoxy-xylo nucleic acids, dXyloNA of 29 base pairs long, where the deoxyribose sugar of DNA was replaced by deoxy-xylose.19 A subsequent synthesis and solution NMR study of dXyloNA 8-mer showed the presence of a dominant ladder structure with almost zero helicity.20 Recently the synthesis was extended to duplexes of the xylo nucleic acid, XyloNA, which can be considered as a xeno-analogue of RNA. The NMR structure of


Page 5 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the XyloNA 8-mer derived using 5'-d(GUGUACAC)-3' (PDB ID: 2N4J ) also established a ladder structure very similar to that of dXyloNA.21 However, in the absence of suitable polymerases, assembly of larger oligomers requires a considerable synthetic effort. Molecular Dynamics (MD) offers a complementary method to study the conformational evolution of larger strands. Our previous MD study for longer duplexes of dXyloNA has revealed a spectacular switch of helicity from right-to-left.19 Since this switch may have important consequences for the pairing mechanism, a similar investigation for XyloNA is carried out here to determine if it shows the same tendency. The last few decades have witnessed the rising efficiency of MD simulations in exploring the structures and functional dynamics of biomolecules in a time dependent fashion 22-24, and especially in understanding the structural aspects of the canonical

25-36

and modified nucleic

acids 37-38. Relaxation of dXyloNA duplexes was shown to be dependent on the chain length. Short 12-mer and 13-mer dXyloNA duplexes, such as 5'-d(xC-xA-xT-xA-xG-xG-xC-xC-xC-xAxT-xG)-3' and 5'-d(xG-xT-xA-xG-xA-xA-xT-xT-xC-xT-xA-xC-xT)-3', simulated in explicit solvent, unwind to an almost linear ladder structure with a pronounced inclination of ~ -44 º (Figure S2 (subset b) in ref.19), in line with the NMR results on small oligomers.20 However larger oligomers, with up to 29 base pairs, switch from a right-handed double helix to a lefthanded helical structure within tens of ns of simulation19, concomitant with a sign switch of the inclination angle. In view of possible implications for the dXyloNA-XyloNA pairing mechanism, this study is extended to the XyloNA congener. A set of four XyloNA duplexes were examined with different sequences to reduce sequence dependence: the recently synthesized21 8-mer with sequence 5'-d(xG-xU-xG-xU-xA-xC-xA-xC)-3', a 16-mer with sequence 5'-d(xG-xU-xA-xU5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 38

xA-xU-xU-xC-xC-xC-xU-xC-xG-xG-xG-xA)-3' and two 29-mers: 5'-d(xG-xU-xA-xU-xAxU-xU-xC-xC-xC-xU-xC-xG-xG-xG-xA-xU-xU-xU-xU-xU-xU-xA-xU-xU-xU-xU-xG-xU)3' and 5'-d([xG-xC-xA-xU]7-xG)-3' (hereafter referred to as XyloNA1, XyloNA2, XyloNA3 and XyloNA4 , respectively). These strands were subjected to all-atom simulations to verify if a similar switch of helicity was taking place. METHODS Modeling of XyloNA The furanose sugar moiety of RNA in A-form is in the C3'-endo and the puckering form was not changed. The xylo-modification in the sugar moiety of RNA has been introduced by the following changes: (i) the positions of the atoms O3' as well as H3' which are connected to C3' are interchanged so that the atoms O3' and O5' lie on the same side of the pentose ring, and (ii) the positions of the backbone atoms; O3', P, O1P, O2P, O5', C5', H5'1 and H5'2 are adjusted to maintain the phosphodiester linkage with O3'. A template of the molecular fragment with the above described modifications has been designed separately for RNA (shown in Figure 1) and has been used to derive the complete XyloNA using Xleap of AMBER. For XyloNA we investigated the influence of a modified force constant for the χparameter, proposed by Yildirim et al.39 Molecular Dynamics Simulations The partial charges of the xylo-nucleotides (such as xA, xU, xG and xC) have been obtained by a two-stage fitting procedure (RESP)40 from the 6-31G*-derived electrostatic potentials calculated using Gaussian0341 and have been used for the simulations of XyloNA duplexes. The RESP charges derived for the four xylo-modified nucleotides formed by Adenine, Guanine, Uracil and Cytosine and used for the MD simulation of XyloNA are listed


Page 7 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in Table S1. Simulations were performed using the parm99 force field42 and the modified χ– parameter specially designed for RNA simulations.39 The protocol used for the molecular dynamics simulation of XyloNA is as follows. The initial XyloNA conformation is subjected to minimization for a few cycles in order to remove the distortions raised from modeling. After relaxation, the net charge of XyloNA expressed by the phosphate atoms is neutralized with an equal number of Na+ ions. The neutralized XyloNA was solvated using TIP3P water model in a rectangular box extending up to 10 Å from the extents of XyloNA.43 The potential energy of the system containing XyloNA, Na+ ions and water was minimized to ensure proper relaxation of the solvated, neutralized XyloNA prior to the dynamics simulation. Minimization was performed in three steps: first, initial minimization was performed only on the water and ion molecules keeping the XyloNA coordinates constrained. This prior relaxation of water molecules helps in rearranging themselves based upon the shape of the solute and to form a highly structured water pocket causing a better energy gradient throughout the simulation cell. After relaxing the water molecules, a complete minimization of XyloNA including Na+ ions and water molecules was performed. i.e. the energy difference between the successive iteration is set to a threshold value of 1.0E-06 kcal/mol. The constraints on all the base pairs of XyloNA were relaxed one by one simultaneously from top to bottom in every minimization step. The particle-mesh Ewald procedure is used to account long-range electrostatic interactions. 44 An 8 Å cutoff was used for the van der Waals interactions and the pair list was updated every 100 steps. The system was heated to 300K for 50 ps with harmonic restraints of 2 kcal/mol/ Å2 on XyloNA at constant volume and the system is maintained at 300 K by using the Langevin dynamics with the collision frequency of 1.0 ps-1.45-46 The bonds involving hydrogen are constrained using the SHAKE algorithm.47 The density of the system was equilibrated for 200 ps at constant pressure. Here, the harmonic constraint on XyloNA was reduced gradually in steps 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 38

of 0.5 kcal / mol /Å2 during four sequential simulations of 50ps duration. The whole system is equilibrated for 50ps without any constraints. After equilibration, the entire system was allowed for production molecular dynamics with constant pressure conditions. Simulation of XyloNA1 with a cut off distance of 12 Å and box size of 64.3 × 64.3 × 64.3 Å3 was performed for a period of 100ns. The duplexes XyloNA2 and XyloNA3 were simulated in this set up for a short period of 36 and 55 ns, respectively. Initially XyloNA4 was simulated over a period of 55 ns, using a cut off distance of 10 Å. In this simulation, XyloNA4 was solvated using a rectangular box of dimension 46.7 × 47.4 × 117.0 Å and this calculation is referred to as XyloNA4j. To investigate the influence of box size and simulation time, a further set of five independent simulations on XyloNA4 have been performed for a period of 100 ns using cut-off distance of 12 Å and two different solvation box dimensions to investigate the robustness of the resulted conformation. i.e. two independent simulations using a cut-off distance of 10 Å and the initial rectangular box of size 77.7 × 65.1 ×77.7 Å3 (referred as XyloNA4k and XyloNA4l, respectively) and another three simulations using a cut-off distance of 12 Å and the initial box of size 129.5 × 129.5 × 129.5 Å3 (referred to as XyloNA4m, XyloNA4n and XyloNAo, respectively).

We also

considered the bsco0 correction for the χ-parameter, which was intended to remove destabilization of the anti-region found in the f99 force field and thus prevent formation of spurious ladder-like structural distortions in RNA simulations.48 Finally we also performed a 500 ns simulation of the XyloNA4 to check the stability of the results at longer time scales. All these simulations at various cut-off distances and box sizes of XyloNAs in various lengths and time-intervals were performed to void off the dependency of the parameter used in simulations as well as to understand the uniqueness in conformational evolution. Structural Analysis


Page 9 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


All analyses have been performed on the stable MD trajectory observed from 20ns onwards using the ptraj module of Amber Tools 1.4. The conformations averaged over the last 100 ps in every 1 ns simulation have been used for the analysis of geometrical parameters and solvent accessible surface area (SASA). The solvent accessible surface area (SASA) has been calculated using the dms program of Richards49 implemented in MidasPlus package.50 All geometrical parameters presented in this article have been calculated using the CURVES program51. All analyses have been performed by excluding the last three terminal base pairs of XyloNA to avoid end effects.52,53 Molecular graphics images were produced using the UCSF Chimera package.54 Calculation of Groove width: As the left-handed XyloNA duplex is highly fluctuating, the number of base pairs forming the major and minor grooves is different throughout the dynamics. Hence a distance scan between its two strands has been performed to explain the groove width as performed in our previous report on dXyloNA.

19

As was observed in dXyloNA, the backbone phosphate

atoms of the left-handed XyloNA duplex are flipped toward the major groove and accordingly the sugar moieties are exposed at the minor groove and form the real minor groove width. Hence, a distance scan was performed using two reference atoms such as C4′ and P to explain the groove width of minor and major grooves, respectively. As explained, a distance scanning between the ith C4′ / P-atom on strand1 (reference atom) and the entire C4′ / P- atoms in strand 2 has been performed. Several trials were also made by changing the reference C4′-atoms. The shortest distance determines either the minor or the major groove widths depending on the grooves over which the distance is measured.

RESULTS



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 38

The xylo-configured RNA duplex, XyloNA, is generated by replacing all the beta-ᴅribofuranose by the beta-ᴅ-xylofuranose moiety. Xylose and ribose (in B-DNA) are stereoisomers, the only difference being an inversion of the C3' carbon, are shown in Figure 1. The main objective is to analyze the conformational variation originating from this substitution, and to follow the conformational changes throughout a longer dynamics in order to elucidate the characteristic structural parameters of XyloNA. The studied four XyloNA duplexes such as XyloNA1, XyloNA2, XyloNA3 and XyloNA4 were found to exhibit similar dynamic patterns. In Figure 2 we present a superposition of XyloNA1 with the measured21 NMR structure (PDB ID: 2N4J). The two ladder structures are virtually identical, thus validating the MD simulation. The structure shown in the Figure 2 is a mean structure from the most populated cluster, with an RMSD of 4.08 Å from NMR structure, while an average RMSD for the whole trajectory is 4.3 Å. The Supplementary Figures S1 and S2 depict the conformational evolution of XyloNA1 and XyloNA2, respectively. The results obtained for the 29-mer are discussed here in detail. The dynamics of XyloNA3 and XyloNA4 duplexes simulated using a solvation box of dimension 10 Å (extended from the extents of DNA) over a period of 55 ns revealed a stable ladder type open conformation (after 20 ns onwards) by unwinding the double helix. The evolution is shown as a series of snapshots extracted from the MD simulation (Figure S3) and in this text; the geometrical parameters of the 55ns simulation (XyloNA4j) offer a description of the ladder type conformation of XyloNA. Despite the observed stable ladder type conformation, the terminal base pairs have also expressed a flexible dynamics with a spontaneous tendency to turn / wind the duplex in a reverse fashion. This observation prompted us to perform additional independent simulations (five simulations referred as XyloNA4k, XyloNAl, XyloNAm, XyloNA4n and XyloNAo, and are also occasionally referred as XyloNA4k-o to avoid repetition) on XyloNA4 at different simulation conditions (see Methods: Molecular 10 ACS Paragon Plus Environment

Page 11 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Dynamics Simulations for details) for a period of 100 ns to investigate the robustness of the resulted conformation. The evolution of XyloNA4l, in a bigger solvation box, starting from an A-RNA configuration is shown as a series of conformations extracted from MD simulation (Figure 3). The dynamics of XyloNAs observed over a period of 100 ns revealed similar conformational transition as that of dXyloNA, but the only difference is the state transition via a significantly stable intermediate state: i.e. the conformation of modelled right-handed XyloNA duplex unwinds to greater extent to form an open ladder type conformation (until 20 ns) and then initiates the winding of terminal base pairs in a reverse manner to adopt a left-handed duplex over the rest of the simulation period. This transition is smoothly mediated by the comparatively stable open ladder type transition state conformation (as revealed in the simulation of XyloNA3 and XyloNA4j), with the flexible terminal base pairs playing the key role in propagating the left-handedness over the entire sequence of the duplex. The conformation of XyloNA4 duplex in the complete left-handed form is highly flexible. The backbone superimposition of XyloNA duplex conformations (XyloNA4k-0) extracted at 100 ns is shown in Figure 4. The same for dXyloNA (in grey) is also depicted for comparison. The subsequent 500 ns simulation fully confirmed these results. In Figure 5 we present snapshots with atomic detail in the range from 100 to 500 ns. As can be seen the structure is periodically oscillating between a coiled and a more elongated structure, due to the greater flexibility of the terminal regions. The conformation of XyloNA was examined using the CURVES program and the observed geometry of XyloNA (both left-handed as well as open ladder type duplex conformations) is described below. Sugar puckering



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 38

In B-DNA, the ribose exists in S-conformation (C2'-endo), whereas in A-RNA, the sugar equilibrium is shifted towards N-conformation (C3'-endo). Modeling of XyloNA using ARNA was comparatively simpler as the sugar puckering was maintained in N-conformation for XyloNA. We also simulated one structure in B-form, but the structure collapsed through steric clash. The A form is also the preferred conformation of dXyloNA, and has been confirmed by the NMR data21, both for dXyloNA and XyloNA. Figure 1 depicts this conformation for the xylose sugar moiety used to build the structure of XyloNA. Backbone and glycosyl torsion angles In Table 1, we report the backbone and glycosyl torsion angles derived from MD trajectories for the XyloNAs and A-RNA 29-mers, and compare them to our previous MD data obtained for the 29-mer of dXyloNA and B-DNA. X-ray structures for B-DNA and ARNA and the recent NMR results for short strands of dXyloNA and XyloNA are also provided. It is observed that during simulation, a spiky rise in the value of a particular frame is observed due to the instantaneous flip of bases. This spiky flips were observed to revert back to the original value in the next frame itself, and were eliminated from the analysis. In addition, the values from the last three terminal nucleobases were not taken into account in order to eliminate the errors from end effects. In the present analysis of dXyloNA and XyloNAs, the values of all the helical parameters are derived only from the nucleobases expressing consistent values over the trajectory (i.e refined using smoothly varying values) and hence, the tabulated values for dXyloNA and B-DNA differ slightly from the reported values in Ramaswamy et al.19 The variation of the dihedral angles of dXyloNA and XyloNA observed during the course of MD simulation is shown in Figure S4. The inversion of C3'-atom of sugar ring drastically changed the endo-cyclic torsion angle δ from synclinal+ or anticlinal+ to synclinal-. This 12 ACS Paragon Plus Environment

Page 13 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


transition triggered a significant inversion of all backbone angles α, β, γ, δ, ɛ and ζ almost equally in the opposite direction except the angle δ, for which the transition in opposite direction is almost reduced by two fold. It is obvious that the dihedrals α, δ and ζ remain at the same values as that of dXyloNA, whereas the characteristic backbone conformation of XyloNA is reflected by the relaxation of β, γ and ɛ dihedrals. Precisely, the transition of sugar puckering to C3`-endo is mainly stabilized by the relaxation of two dihedral rotations; (i) the decreased dihedral rotation with respect to C4' – C5' bond (defining γ) and (ii) the subsequent increase in the dihedral of C3' – O3' bond (defining ɛ). Accordingly slight variation is also observed with the dihedral β. The MD simulations are in line with the trends observed by NMR.20-21 The χ angle that ensures the proper orientation of base pairs (with respect to the sugar moiety) for stable both H-bonding as well as stacking interactions for a typical A-type RNA is about −158° (-anti periplanar). The obtained χ angle of XyloNA varies between -155° and -161° thus maintaining the anti-conformation as that of A-RNA. The appropriate orientation of base pairs to form stable base pairing and stacking interactions in XyloNA is thus similar to that of regular RNA. In this respect it was found that the reparametrization of the glycoside torsion angle, proposed by Zgarbová et al.48, did not influence the results. This is illustrated in Figure S5. Base pairing and stacking The helical conformation of XyloNA maintains the complementary Watson–Crick base pairing through H-bonds as well as stable base stacking interactions (Figure S6). The local and global translational and rotational displacements of the paired as well as stacked bases have been listed in Table 2 for the simulated A-RNA and XyloNAs (XyloNA1, XyloNA2, XyloNA3 and XyloNA4), along with the previously reported values of the simulated 29-mers of B-DNA and dXyloNA. The X-displacement that defines the hole of the RNA duplex (4.35±0.3Å) fluctuates (between -1.18±1.1Å and 2.64±1.1Å) in XyloNA with an increasing 13 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 38

Y-displacement (even up to 1.44±0.3 Å). The tip representing the rotation of the base pair with respect to the Y-axis is highly fluctuating (between +1.73±1.4° to -5.32±0.9°) when compared to RNA (-0.27±1.0º). The most pronounced difference is the highly negative value for the inclination (-39.2±1.2° to -54.98±5.3°). The inclination measured by NMR for the 8mer of XyloNA is in the same range with a value of -45.2±0.9°. Our earlier study of the 29mer of dXyloNA yielded a similar amplitude of base inclination but with opposite sign (+31.99±7.0°). We will return to this point in the discussion. The structural parameters that characterize the translational and rotational motions between the base pairs like shear, stretch, stagger, buckle and opening of XyloNA (Table 2) do not vary much when compared to the RNA conformation. The propeller twist that defines the coplanarity of the paired bases with respect to the long axis formed by the C8 of purine and C6 of pyrimidine varies between -14.64 ± 2.4° and -22.76 ± 3.2°. The propeller twist that was identified as one of the important parameter mediating left-handed helical transition in dXyloNA is again of opposite sign, with a value of +8.67 ± 1.7°. The global translational (Shift, Slide, Rise) and rotational (Tilt, Roll, Twist) inter-base parameters as compared to simulations for A-RNA and dXyloNA are also listed in Table 2. The shift, slide and tilt in XyloNA are like A-RNA and dXyloNA. The rise, that defines the stacking between a dinucleotide step in XyloNA (ranging between 4.84 ± 0.2 Å and 6.14 ± 0.3 Å), is doubled when compared to that of B-DNA and A-RNA. NMR measurements both for dXyloNA and XyloNA yield values of 5.8 and 5.1, respectively20-21, which are in excellent agreement with the MD results. Such wide separation is interesting, when issues related to intercalation are considered.55-57 Unlike RNA, XyloNA expressed a positive roll (between 10.12±1.5° and 11.85±4.5°) similar to dXyloNA (13.59±4.1°).


Page 15 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


An important parameter is the global twist, which is an indication of the helicity. For righthanded helices the twist is positive with values of 33.93±1.0° and 31.45±1.3° for B-DNA and A-RNA, respectively. A full turn of 360° thus requires approximately 10 or 11 base-pairs, which corresponds to the periodicity of the helix. In the open-ladder structures observed by NMR, the helicity is drastically reduced to 2.7° for dXyloNA and 10.7° for XyloNA.20-21 This implies that the structures are nearly planar, but with still a small residual right-handed helicity. In comparison the MD simulated twist of XyloNA4j, which exists in open-ladder structure, is strongly fluctuating with a negative value of -11.73±6.3°. The twist in the XyloNAs (from XyloNAk to XyloNAo) in the left-handed duplex form varies between -16.55 ± 1.7° and -19.41± 3.2°. Accordingly, a complete turn in XyloNA requires a significantly longer nucleotide sequence, and at the same time, the fact of uncertainty in determining one helical turn due to the conformational flexibility of XyloNA should not be ignored. The communicative dynamics between helical parameters such as X-displacement, inclination, rise, roll, twist mediating conformational transition during the course of simulation is shown in Figure S7. An associated dynamics between inclination, twist and roll with respect to rise is clearly observed in both left-handed dXyloNA and XyloNA and emphasizes similar trends in the conformational evolution of XyloNA as of dXyloNA during dynamics. Conformational Evolution of XyloNA during Dynamics The time evolution of XyloNA4l starting from the A-RNA input conformation shows an interesting behaviour which is different from similar simulations for dXyloNA. The evolution is shown as a series of snapshots extracted from the MD simulation (Figure 3). It reveals an unwinding of the helix and a tendency to turn over to a left-handed helicity, but with a long periodicity. The observed range for the negative twist between -16.55 ± 1.7° and -19.41± 3.2° 15 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 38

reflects the flexible helical nature. Upon closer inspection though, it is observed that the twist is mainly mediated from both ends of the duplex. In Figure S8, we compare the evolution of the global inter-base twist and rise in B-DNA, A-RNA, dXyloNA and XyloNA. While the natural nucleic acids show a stable right-handed helicity, the xeno-nucleic acids clearly unwind to adopt a left-handed helix, but with significantly higher degree of flexibility. The dXyloNA clearly turns over to a left-handed helix with a twist of -24.38±2.9° which is opposite to the value for B-DNA of +33.93±1.0°. However, for XyloNA the negative helical twist is less than for dXyloNA. The plots shown in Figure S7 reveal that the translational parameters, X-displacement and rise and the rotational parameters roll and twist move in accordance with each other to unwind the modeled duplex to achieve the left-handed XyloNA duplex. The pattern of base pairing influenced by these helical parameters in dXyloNA and XyloNA is shown using a short segment from the 29-mer in Figure S9. Helical Groove Analysis The helical flexibility observed during the evolution of XyloNA4m (as per Table 1) for a period of 100 ns is shown in Figure S10. As explained in Methodology, the distance is calculated (using C4′-atom) over the 29 base pairs of strand2 (Bases 30-59) with respect to the base reference point in strand1 starting from Base 1 to Base 29. The left-handed XyloNA duplex expresses a highly flexible dynamics, which results in a non-uniformity in the helical nature over the strand during the period of simulation. Figure S11 depicts the distance calculated using C4` and P with respect to the bases at 7 and 23 of strand1 as the reference points. The distance scan using both C4` and P reveals that the minor groove is consistently formed between n and n+2 base pairs with a groove width of 10±0.5 Å. Moreover, the depth


Page 17 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of minor groove in XyloNA is not pronounced due to the higher inclination of the base pairs, which 2-fold higher (~-160º) than that of dXyloNA (-85º) Due to the helical non-uniformity, the number of base pairs forming the major groove varies significantly during dynamics. The distance scan using P reveals that the major groove is formed by a minimal number of 17 base pairs (i.e n and n+17) with a minimal width of 32 Å. The groove width as well as the base pairs defining the major groove increase according to the helical flexibility and a maximum of 21 base pairs (width extending up to 46 Å) is observed from these simulations. The observed base pair twist (ranging between -17° and 19°) and the number of base pairs (between 17 and 21) forming the major groove are in good agreement and reflects the periodicity of the helix. Solvent Accessible Surface Area The solvent accessible surface area (SASA) is an important parameter to understand the degree of hydration of a (bio)molecule and explains its stability in aqueous medium. Table S2 lists the polar (N, O, P …atoms), non-polar (C atoms), and total SASA of the duplexes of BDNA, A-RNA, dXyloNA and XyloNAs along with the SASA of nucleic acid fragments like sugar, base and backbone. The polar surface area of the transition state open ladder conformation of XyloNA4j (4172±54 Å2) is 26% larger than that of dXyloNA (3290±38 Å2). At the same time, it possesses a non-polar surface area of 2852±39 Å2, which is 13 % smaller than the non-polar surface area of dXyloNA. In contrast, the solvation of dXyloNA was equally governed by both polar (3290±38 Å2) as well as non-polar (3270±42 Å2) SASAs. In both duplexes XyloNA and dXyloNA, the SASA for the backbone is almost similar, whereas the sugars and bases of XyloNA4j are ~12% more accessible to water molecules. Overall, it is clear that the open ladder type conformation of XyloNA possesses higher SASA than that of left handed dXyloNA duplex. 17 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 38

While making the transition from the open ladder conformation to the left-handed helix, a similar trend in solvation property is also adopted by the left-handed duplex. Hence, the lefthanded XyloNA duplex is also less accessible to solvent molecules than the open ladder structure, but the decrease in solvation effect is less pronounced (see Table S2). The helical conformation with higher flexibility might be due to the observed decrease in SASA property. DISCUSSION The MD results compare favorably with the NMR structural data on short oligomers of dXyloNA and XyloNA that have recently become available.20,21 Both local and global parameters of the backbone and the base interactions are essentially reproducible. Salient features which distinguish natural and xylo-nucleic acids are the open ladder structure, the strong inclination, and the larger rise. All these features are retained in the MD simulations of short strand duplexes. Apparently the large inclination reflects an increase in the base-pair stacking, and is a result of the modified backbone torsion angles. This is also reflected by increased duplex stability, as evidenced by higher melting temperatures. MD simulations have the advantage that they also make it possible to simulate longer duplexes. Independent simulations on 29-mers showed a marked difference between XyloNA and its de-oxy analogue. Starting from a right-handed configuration the dXyloNA quickly unwinded and turned into a compact left-handed conformation with a periodicity of about 15 base-pairs. Concomitant with this transition is a turnover of the inclination from negative to positive values. In comparison, the transition to the left-handed conformation of XyloNA is mediated by an open ladder type conformation with similar geometrical properties. The base pair inclination in both ladder as well as left-handed helical conformations remains negative, in agreement with the NMR values for short oligomers. In contrast, in dXyloNA the right-to-


Page 19 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


left transition is really concomitant with the switch of inclination angle, as twin components of a simple mirror relation between double helices. This is clearly seen when comparing small sections of 29-mers of dXyloNA and XyloNA, as seen in the Figure S9. The reason why XyloNA is highly flexible and cannot to make compact and stable left-handed helix, is probably the increased solvation, mainly due to the exposed O2'-hydroxyl group. CONCLUSIONS Design of modified nucleic acids promotes scientific challenges as they facilitate the discovery as well as understanding of novel biological issues related to the evolution of life. Understanding the structural characteristics of modified nucleic acids is of therapeutic interest as the modifications at the nucleic acid moieties like nucleobase, sugar moiety, etc. express potent anticancer and/or antiviral activities. In this article we present the role of substitution of beta-ᴅ-xylofuranose in place of beta-ᴅ-ribofuranose of A-RNA. The backbone and glycosyl torsions angles and the base-pairing geometry are in good agreement with the recently determined NMR structure of an 8-mer.21 However the global translational and helical characteristics, as obtained by simulating longer 29-mers, show a further evolution of an open ladder-like conformation to a helical form. In dXyloNA, similar xylo-substitution supported a transition from right-handed helicity to a left-handed one with a positive inclination of base pairs. Unlike the dXyloNA, during the evolution of XyloNA, the base pairs adopted equal amplitude of χ angle assisted inclination, but in the opposite direction. Hence, during dynamics simulation, the structure of xylo-substituted A-RNA relaxed first to unwind the duplex as an open ladder type and then to the left-handed helical state. In this process the flexible terminal base pairs are seen to act as initiators of the left-handed rewinding.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 38

Over all, the comparative analysis on the dynamics of both xylo-substituted B-DNA and A-RNA revealed a unique pathway of structural relaxation derived mainly by the helical parameters such as inclination and stacking of base pairs and the subsequent relaxation of backbone torsion angles. Structural stability of the left-handed XyloNA duplex is highly enhanced by the freely accessible surface for solvent molecules.


Page 21 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Schematic representation of ribose (in A-RNA) and xylose sugar moieties in front (top panel) and planar (bottom panel) views. The carbon atoms are indicated by primed numbers and the N1-atom belongs to the base. Orientation of the characteristic O3`-atom in ribose and xylose sugars is indicated.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 38

Figure 2. XyloNA1 8-mer: comparison of the simulated structure (blue) with the measured NMR structure21(green).


Page 23 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Conformational evolution of XyloNA4o observed during the period of 100 ns simulation .



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 38

Figure 4. The backbone superimposition of XyloNA duplex conformations (XyloNA4k-0) extracted at 100 ns is shown in comparison with dXyloNA (in grey).


Page 25 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Extended simulation of XyloNA4 to 500 ns. Snapshots have been taken every 25 ns in the interval from 100-500 ns. The middle region is almost consistent while the terminal regions are fluctuating.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 38


Page 27 of 38

Table 1: Backbone and glycosyl torsion angles of the canonical nucleic acids (B-DNA, A-RNA) and xylo-modified nucleic acids (dXyloNA and XyloNA) calculated from the MD conformations using CURVES program. The X-ray data for B-DNA and A-RNA and the NMR data from the ladder like open conformation of the dXyloNA and XyloNA 8-mers are reported for reference. Nucleic Acids

Backbone Angles ( in ° ) α

δ

ε

-41.0 -68.0

136.0 178.0

38.0 54.0

139.0 82.0

-133.0 -153.0

-157.0 -71.0

-102.0 -158.0

53.0±18

-156.0±14

-122.0±8

-25.0±3

146.0±13

75.0±12

-161.0±6

47.0±20

-130.0±14

-100.0±25(A/G) - 91.0.±9 (C/U)

- 21.0±6

132.0±16

86.0±21

-165.0±17

B-DNAe dXyloNAe

-67.2±2.2 85.0±1.8

171.4±1.7 -145.9±1.5

35.9±6.1 -163.6±1.9

126.4±2.5 -30.8±1.6

-162.1±6.0 121.2±2.4

-87.5±1.4 69.5±1.3

-117.0±3.1 -85.0±1.2

A-RNAf XyloNA1 g

-71.5±3.7 81.5±36

170.7±1.7 -173.4±2.8

61.2±3.6 -129.0±15

79.2±1.7 -30.4±5.2

-156.4±2.2 159.3±3.4

-68.9±1.3 70.6±2.1

-156.1±2.0 -155.3±3.6

XyloNA2h XyloNA3i

85.8±5.3 84.7±4.6

-168.6±3.6 -170.8±1.7

-144.7±10.3 -134.5±4.1

-35.4±10.9 -38.5±1.5

157.9±6.4 162.2±1.5

68.7±3.1 72.5±2.6

-159.3±3.0 -156.3±2.5

XyloNA4 j XyloNA4k

85.0±5.7 84.9±2.4

-165.0±2.5 -171.6±4.0

-137.3±8.7 -124.7±4.7

-35.8±2.3 -33.5±1.6

162.4±1.9 155.2±5.7

71.2±1.9 69.5±1.0

-161.0±2.2 -160.5±2.8

XyloNA4l XyloNA4m

83.8±1.7 86.1±7.7

-172.1±3.0 -175.6±0.6

-123.4±5.9 -127.2±3.4

-33.0±1.1 -35.4±1.2

154.5±7.4 160.0±1.0

69.7±1.3 70.3±0.7

-159.6±1.2 -159.8±1.0

XyloNA4n XyloNA4o

85.9±1.8 85.3±3.6

-173.8±5.1 -173.6±8.2

-126.8±5.2 -127.0±4.3

-35.4±1.0 -34.8±1.0

160.1±1.1 159.8±1.1

70.4±0.7 70.8±0.9

-158.4±2.4 -158.7±0.7

Experimental Reports

X-ray

MD Simulations

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48


BF-DNAa A-RNAb

NMR 8-mer

dXyloN Ac XyloNAd

β

γ

ζ

χ

a

W. Saenger, Principles of Nucleic Acid Structure, Springer-Verlag New York Inc. Ch. 11, 1984, data for BFDNA in Table 113, p266, extracted from the article Arnott, S.; Chandrasekaran, R.; Birdsall, D.L.; Leslie, A.G.W.; Ratcliff, R. L. Nature 1980, 283, 743-745. b New fiber data, private communications Drs Arnott and Chandrasekaran (1982) Table 9-3 from “Principles of Nuclec Acids” by W Saenger c Ladder conformation of the dxylo 8-mer 5’-GTGTACAC-3’ from Ref.20 d Ladder conformation of the xylo 8-mer 5’-GUGUACAC-3’ from Ref.21 27

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

Page 28 of 38

e

B-DNA and dXyloNA 29-mers derived using 5'-d(GTATATTCCCTCGGGATTTTTTATTTTGT)-3' from Ref.19 Data refined using smoothly varying values. f A-RNA 29-mer derived using 5'-d(GUAUAUUCCCUCGGGAUUUUUUAUUUUGU)-3' g XyloNA1: XyloNA 8-mer derived using 5`-d(GUGUACAC)-3` h XyloNA2: XyloNA 16-mer derived using 5'-d(GUAUAUUCCCUCGGGA)-3' i XyloNA3: XyloNA 29-mer derived using 5'-d(GUAUAUUCCCUCGGGAUUUUUUAUUUUGU)-3' j XyloNA4: XyloNA 29-mer derived using 5'-d(GCAUGCAUGCAUGCAUGCAUGCAUGCAUG)-3' k,l Two independent simulations of XyloNA4 using an initial solvation box of size 77.7 × 65.1 ×77.7 Å3 m, n,o Three independent simulations of XyloNA4 using an initial solvation box of size 129.5 × 129.5 × 129.5 Å3

28


Page 29 of 38

Table 2: Global base pair-axis, base-base, inter-base and inter-base pair parameters of the canonical (B-DNA, A-RNA) and modified (dXyloNA, XyloNA) nucleic acids 29-mers calculated from the MD conformations using CURVES program. The superscripts are adopted as per Table 1. Global Parameters

Data from Ref 19

Base pairaxis Base – Base Inter-Base

Data from present simulations

29-mers e

Inter- Base pair

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48


8-mer e

XyloNA1

16-mer g

B-DNA

dXyloNA

X-disp(Å) Y-disp(Å) Tip (°) Inclin (°)

-1.61±0.3 -0.09±0.1 -0.75±0.9 0.88±1.2

-1.69±1.4 -0.13±0.2 -0.66±1.1 31.99±7.0

3.56±2.7 0.003±0.5 0.30±3.5 -42.58±5.4

Shear (Å) Stretch (Å) Stagger (Å) Buckle (°) Propeller(°) Opening (°) Shift (Å) Slide (Å) Rise (Å) Tilt (°) Roll (°) Twist (°) Shift (Å) Slide (Å) Rise (Å) Tilt (°) Roll (°) Twist (°)

-0.09±0.0 0.12±0.0 -0.17±0.0 -3.31±1.3 -12.27±1.3 1.26±0.5 -0.07±0.1 -0.06±0.0 3.38±0.0 0.66±1.5 1.89±1.1 33.93±1.0 -0.01±0.1 -0.01±0.1 3.39±0.0 0.75±0.5 2.17±1.0 33.42±1.0

-0.01±0.0 -0.09±0.2 0.11±0.1 -2.78±1.8 8.67±1.7 1.88±0.4 -0.01±0.1 0.28±0.1 3.97±0.4 -3.55±2.2 13.59±4.1 -24.38±2.9 0.05±0.1 0.08±0.1 3.86±0.4 0.34±0.7 12.51±3.1 -24.55±2.6

-0.01±0.1 -0.24±0.2 -0.26±0.1 2.94±3.0 -22.76±3.2 1.69±2.2 0.05±0.1 -0.23±0.2 5.97±0.7 0.67±2.5 11 .81±10.6 -16.35±3.9 0.02±0.1 -0.07±0.2 6.09±0.7 0.57±1.4 4.28±3.1 -16.03±3.2

h

XyloNA2

29-mer f

R-ANA

XyloNA3

1.12±0.7 -0.23±0.8 -2.09±5.0 -47.72±3.9

-4.35±0.2 -0.11±0.2 -0.27±1.0 6.72±2.5

-0.02 ± 0.2 -0.04 ± 0.1 -0.11 ± 0.1 3.93±2.5 -19.5±3.9 -0.03±2.4 0.19±0.1 -0.10±0.2 5.63±0.2 -0.92±1.5 10.63±6.6 -16.99±17.5 0.17±0. 1 -0.22±0.2 5.32±0.8 -0.08±1.4 7.66±5.3 -17.58±5.6

-0.03±0.1 0.26±0.1 -0.34±0.1 3.23±2.6 -11.43±3.0 1.39±1.1 -0.03±0.1 0.08±0.1 2.96±0.1 -0.05±1.6 -3.19±1.8 31.45±1.3 -0.03±0.1 -0.13±0.1 2.87±0.1 2.28±1.3 4.26±1.3 30.88±0.9

i

j

XyloNA4l

XyloNA4m

XyloNA4n

XyloNA4o

2.55±1.0 -0.02±0.3 -0.42±1.1 -44.39±2.2

2.64±1.1 -0.05±0.3 1.73±1.4 -43.49±2.4

-1.27±0.7 1.44±0.3 1.45±1.8 -49.83±3.7

-1.18±1.1 1.11±0.6 -0.44±5.7 -50.23±5.7

-1.24±0.3 1.04±0.5 -0.47±6.6 -54.98±5.3

0.003±0.03 -0.27±0.1 -0.18±0.05 2.39±0.9 -19.74±1.9 2.31±1.1 -0.03±0.07 0.12±0.07 5.82±0.3 0.08±0.3 10.95±1.7 -19.13±4.4 -0.04±0.1 0.03±0.1 5.81±0.3 0.08±0.3 9.69±2.1 -19.41±3.2

0.002±0.03 -0.31±0.1 -0.21±0.04 4.16±1.4 -20.85±8.6 1.72±1.0 0.06±0.04 0.06±0.07 5.90±0.3 0.14±0.3 10.12±1.5 -19.18±1.8 0.03±0.1 0.05±0.1 5.91±0.3 0.13±0.3 7.79±1.9 -18.35±1.8

0.02±0.1 -0.10±0.1 -0.07±0.03 3.86±1.0 -18.73±1.7 1.72±1.2 0.20±0.1 0.01±0.2 5.21±0.2 -0.07±0.5 11.02±2.5 -17.09±2.1 0.09±0.1 0.10±0.2 5.1±0.2 0.27±0.3 8. 67±3.7 -16.55±1.7

-0.001±0.3 -0.11±0.1 -0.08±0.1 3.98±1.1 -17.76±2.7 1.75±1.3 0.07±0.2 0.08±0.1 5.3±0.2 -0.68±0.5 10.84±5.7 -18.79±3.1 0.07±0.1 -0.07±0.2 5.3±0.2 0.28±0.5 7.89±5.6 -17.13±2.0

0.04±0.5 0.18±0.4 -0.08±0.03 3.24±1.1 -18.42±3.4 -1.72±1.9 0.16±0.1 0.08±0.2 4.84±0.2 1.98±3.2 10.19±4.8 -18.60±2.1 0.09±0.01 -0.15±0.2 5.18±0.2 -0.5±1.3 8.27±5.2 -18.5±2.3

XyloNA4

XyloNA4

0.06±0.5 -0.84±0.5 -4.93±1.8 -40.54±4.0

-0.34±0.3 -1.10±0.4 -5.32±0.9 -39.20±1.2

-0.02±0.1 -0.09±0.1 -0.23±0.1 2.21±2.4 -16.27±3.7 -2.18±3.7 0.05±0.2 0.34±0.4 6.14±0.3 -1.97±3.5 10.48±4.9 -10.07±4.0 -0.07±0.1 0.23±2 5.29±0.2 -0.27±1.6 8.71±6.0 -6.42±2.4

-0.08±0.1 0.10±0.2 -0.13±0.1 1.35±5.5 -14.64±2.4 -0.71±2.9 -0.01±0.1 0.04±0.2 5.62±0.1 -0.67±1.7 11.85±4.5 -11.73±6.3 -0.12±0.1 0.11±0.1 5.64±0.1 0.15±1.0 11.12±2.8 -6.03±2.1

k

29



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 38

ASSOCIATED CONTENT Supporting Information Tables S1-S2 and Figures S1-S11 as described in the text. This material is available free of charge via the Internet at http://pubs.acs.org. AUTHOR INFORMATION Corresponding Author * Arnout Ceulemans, Laboratory of Quantum Chemistry, KULeuven, Celestijnenlaan 200F, B-3001 Leuven, Belgium, Email: [email protected] Author Contributions A.R. performed the calculations and analysed the data. D.S. did additional calculations on the influence of box size, different parametrizations, and the extension of the interval to 500 ns. M.F. and M.M. assisted with the analysis and the comparison with previous NMR and MD data. P.H. and A.C. conceived and defined the project. The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Funding Sources A. R. greatly acknowledges the financial support from the University Grants Commission and SERB, India. MM performed this research as a postdoctoral fellow (No. 1200113N) of FWO Vlaanderen, Belgium. ABBREVIATIONS


Page 31 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RNA, ribo-nucleic acid; DNA, deoxy-ribo nucleic acid; XyloNA, xylo nucleic acid; dXyloNA, deoxy-xylo nucleic acid; PNAs, peptide nucleic acids; siRNA, short interfering RNA; MD, molecular dynamics REFERENCES 1.

Schmidt, M., Xenobiology: a new form of life as the ultimate biosafety tool.

Bioessays 2010, 32 (4), 322-31. 2.

Pinheiro, V. B.; Taylor, A. I.; Cozens, C.; Abramov, M.; Renders, M.; Zhang, S.;

Chaput, J. C.; Wengel, J.; Peak-Chew, S. Y.; McLaughlin, S. H.; Herdewijn, P.; Holliger, P., Synthetic genetic polymers capable of heredity and evolution. Science 2012, 336 (6079), 3414. 3.

Pinheiro, V. B.; Holliger, P., The XNA world: progress towards replication and

evolution of synthetic genetic polymers. Curr Opin Chem Biol 2012, 16 (3-4), 245-52. 4.

Egli, M.; Pallan, P. S., Crystallographic studies of chemically modified nucleic acids:

a backward glance. Chem Biodivers 2010, 7 (1), 60-89. 5.

Fu, Y.; He, C., Nucleic acid modifications with epigenetic significance. Curr Opin

Chem Biol 2012, 16 (5-6), 516-24. 6.

Kasahara, Y.; Kuwahara, M., Artificial specific binders directly recovered from

chemically modified nucleic acid libraries. J Nucleic Acids 2012, 2012, 156482. 7.

Al-Sehemi, A. G.; El-Gogary, T. M.; Wolschann, K. P.; Koehler, G., Structure and

Stability of Chemically Modified DNA Bases: Quantum Chemical Calculations on 16 Isomers of Diphosphocytosine. ISRN Physical Chemistry 2013, 2013, 10. 8.

Micklefield, J., Backbone modification of nucleic acids: synthesis, structure and

therapeutic applications. Curr Med Chem 2001, 8 (10), 1157-79. 9.

Dragulescu-Andrasi, A.; Rapireddy, S.; Frezza, B. M.; Gayathri, C.; Gil, R. R.; Ly, D.

H., A simple gamma-backbone modification preorganizes peptide nucleic acid into a helical structure. J Am Chem Soc 2006, 128 (31), 10258-67.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

10.

Page 32 of 38

Kuwahara, M.; Takeshima, H.; Nagashima, J.; Minezaki, S.; Ozaki, H.; Sawai, H.,

Transcription and reverse transcription of artificial nucleic acids involving backbone modification by template-directed DNA polymerase reactions. Bioorg Med Chem 2009, 17 (11), 3782-8. 11.

Pellestor, F.; Paulasova, P., The peptide nucleic acids (PNAs): introduction to a new

class of probes for chromosomal investigation. Chromosoma 2004, 112 (8), 375-80. 12.

Pellestor, F.; Paulasova, P.; Macek, M.; Hamamah, S., The peptide nucleic acids

(PNAs): "high-tech" probes for genetic and molecular cytogenetic investigations. Med Sci

(Paris) 2005, 21 (8-9), 753-8. 13.

Fox, J. J.; Yung, N.; Wempen, I.; Doerr, I. L., Pyrimidine Nucleosides. III. On the

Syntheses of Cytidine and Related Pyrimidine Nucleosides. J Am Chem Soc 1957, 79 (18), 5060-5064. 14.

Eaton, B. E.; Pieken, W. A., Ribonucleosides and RNA. Annu Rev Biochem 1995, 64,

837-63. 15.

Verma, S.; Eckstein, F., Modified oligonucleotides: synthesis and strategy for users.

Annu Rev Biochem 1998, 67, 99-134. 16.

Pankiewicz, K. W., Fluorinated nucleosides. Carbohydr Res 2000, 327 (1-2), 87-105.

17.

Veedu, R. N.; Wengel, J., Locked nucleic acid nucleoside triphosphates and

polymerases: on the way towards evolution of LNA aptamers. Mol Biosyst 2009, 5 (8), 78792. 18.

Fiori, M.E.; Barbini, C.; Haas, T.L.; Marroncelli, N.; Patrizii, M.; Biffoni, M.; De

Maria, R., Antitumer effect of miR-197 targetting in p53 wild-type lung cancer. Cell Death

and Differentiation 2014, 21, 774-782. 19.

Ramaswamy, A.; Froeyen, M.; Herdewijn, P.; Ceulemans, A., Helical structure of

xylose-DNA. J Am Chem Soc 2010, 132 (2), 587-95. 20.

Maiti, M.; Siegmund, V.; Abramov, M.; Lescrinier, E.; Rosemeyer, H.; Froeyen, M.;

Ramaswamy, A.; Ceulemans, A.; Marx, A.; Herdewijn, P., Solution structure and


Page 33 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


conformational dynamics of deoxyxylonucleic acids (dXNA): an orthogonal nucleic acid candidate. Chemistry 2012, 18 (3), 869-79. 21.

Maiti, M.; Maiti, M.; Knies, C.; Dumbre, S.; Rosemeyer, H.; Ceulemans, A.;

Herdewijn, P., Xylonucleic acid: synthesis, structure and orthogonal pairing properties.

Nucleic Acids Res 2015, 43(15), 7189-200. 22.

Cheatham, T. E., III; Miller, J. L.; Fox, T.; Darden, T. A.; Kollman, P. A., Molecular

Dynamics Simulations on Solvated Biomolecular Systems: The Particle Mesh Ewald Method Leads to Stable Trajectories of DNA, RNA, and Proteins. J Am Chem Soc 1995, 117 (14), 4193-4194. 23.

Cheatham, T. E., 3rd; Young, M. A., Molecular dynamics simulation of nucleic acids:

successes, limitations, and promise. Biopolymers 2000, 56 (4), 232-56. 24.

Wang, W.; Donini, O.; Reyes, C. M.; Kollman, P. A., Biomolecular simulations:

recent developments in force fields, simulations of enzyme catalysis, protein-ligand, proteinprotein, and protein-nucleic acid noncovalent interactions. Annu Rev Biophys Biomol Struct 2001, 30, 211-43. 25.

Norberg, J.; Nilsson, L., Advances in biomolecular simulations: methodology and

recent applications. Q Rev Biophys 2003, 36 (3), 257-306. 26.

Cheatham, T. E., 3rd, Simulation and modeling of nucleic acid structure, dynamics

and interactions. Curr Opin Struct Biol 2004, 14 (3), 360-7. 27.

Ponomarev, S. Y.; Thayer, K. M.; Beveridge, D. L., Ion motions in molecular

dynamics simulations on DNA. Proc Natl Acad Sci U S A 2004, 101 (41), 14771-5. 28.

Pastor, N., The B- to A-DNA transition and the reorganization of solvent at the DNA

surface. Biophys J 2005, 88 (5), 3262-75. 29.

Lankas, F.; Lavery, R.; Maddocks, J. H., Kinking occurs during molecular dynamics

simulations of small DNA minicircles. Structure 2006, 14 (10), 1527-34. 30.

Kastenholz, M. A.; Schwartz, T. U.; Hunenberger, P. H., The transition between the B

and Z conformations of DNA investigated by targeted molecular dynamics simulations with explicit solvation. Biophys J 2006, 91 (8), 2976-90. 33 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

31.

Page 34 of 38

Song, C.; Xia, Y.; Zhao, M.; Liu, X.; Li, F.; Ji, Y.; Huang, B.; Yin, Y., The effect of

salt concentration on DNA conformation transition: a molecular-dynamics study. J Mol

Model 2006, 12 (3), 249-54. 32.

Ettig, R.; Kepper, N.; Stehr, R.; Wedemann, G.; Rippe, K., Dissecting DNA-histone

interactions in the nucleosome by molecular dynamics simulations of DNA unwrapping.

Biophys J 2011, 101 (8), 1999-2008. 33.

Šponer, J.; Banáš, P.; Jurečka, P.; Zgarbová, M.; Kührová, P.; Havrila, M.; Krepl, M.;

Stadlbauer, P.; Otyepka, M., Molecular Dynamics Simulations of Nucleic Acids. From Tetranucleotides to the Ribosome. J Phys Chem Lett 2014, 5 (10), 1771-1782. 34.

Galindo-Murillo, R.; Roe, D. R.; Cheatham, T. E., 3rd, Convergence and

reproducibility in molecular dynamics simulations of the DNA duplex d(GCACGAACGAACGAACGC). Biochim Biophys Acta 2015, 1850 (5), 1041-58. 35.

Brown, R. F.; Andrews, C. T.; Elcock, A. H., Stacking Free Energies of All DNA and

RNA Nucleoside Pairs and Dinucleoside-Monophosphates Computed Using Recently Revised AMBER Parameters and Compared with Experiment. J Chem Theory and Comput 2015, 11 (5), 2315-2328. 36.

Aranda, J.; Zinovjev, K.; Roca, M.; Tunon, I., Dynamics and Reactivity in Thermus

aquaticus N6-Adenine Methyltransferase. J Am Chem Soc 2015, 136(46), 16227-16239. 37.

Sun, C.; Tang, T.; Uludag, H.; Cuervo, J. E., Molecular dynamics simulations of

DNA/PEI complexes: effect of PEI branching and protonation state. Biophys J 2011, 100 (11), 2754-63. 38.

Islam, B.; Sgobba, M.; Laughton, C.; Orozco, M.; Sponer, J.; Neidle, S.; Haider, S.,

Conformational dynamics of the human propeller telomeric DNA quadruplex on a microsecond time scale. Nucleic Acids Res 2013, 41 (4), 2723-35. 39.

Yildirim, I.; Stern, H. A.; Kennedy, S. D.; Tubbs, J. D.; Turner, D. H.,

Reparameterization of RNA χ Torsion Parameters for the AMBER Force Field and Comparison to NMR Spectra for Cytidine and Uridine. J Chem Theory and Comput 2010, 6 (5), 1520-1531.


Page 35 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


40.

Bayly, C. I.; Cieplak, P.; Cornell, W.; Kollman, P. A., A well-behaved electrostatic

potential based method using charge restraints for deriving atomic charges: the RESP model.

J Phys Chem 1993, 97 (40), 10269-10280. 41.

Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb, M. A.;

Cheeseman, J. R.; Montgomery, J., J. A.; Vreven, T.; Kudin, K. N.; Burant, J. C.; Millam, J. M.; Iyengar, S. S.; Tomasi, J.; Barone, V.; Mennucci, B.; Cossi, M.; Scalmani, G.; Rega, N.; Petersson, G. A.; Nakatsuji, H.; Hada, M.; Ehara, M.; Toyota, K.; Fukuda, R.; Hasegawa, J.; Ishida, M.; Nakajima, T.; Honda, Y.; Kitao, O.; Nakai, H.; Klene, M.; Li, X.; Knox, J. E.; Hratchian, H. P.; Cross, J. B.; Bakken, V.; Adamo, C.; Jaramillo, J.; Gomperts, R.; Stratmann, R. E.; Yazyev, O.; Austin, A. J.; Cammi, R.; Pomelli, C.; Ochterski, J. W.; Ayala, P. Y.; Morokuma, K.; Voth, G. A.; Salvador, P.; Dannenberg, J. J.; Zakrzewski, V. G.; Dapprich, S.; Daniels, A. D.; Strain, M. C.; Farkas, O.; Malick, D. K.; Rabuck, A. D.; Raghavachari, K.; Foresman, J. B.; Ortiz, J. V.; Cui, Q.; Baboul, A. G.; Clifford, S.; Cioslowski, J.; Stefanov, B. B.; Liu, G.; Liashenko, A.; Piskorz, P.; Komaromi, I.; Martin, R. L.; Fox, D. J.; Keith, T.; Al-Laham, M. A.; Peng, C. Y.; Nanayakkara, A.; Challacombe, M.; Gill, P. M. W.; Johnson, B.; Chen, W.; Wong, M. W.; Gonzalez, C.; Pople, J. A. Gaussian

03, Revision C.02, Gaussian, Inc., Wallingford CT,: 2004. 42.

Cheatham, T. E., 3rd; Cieplak, P.; Kollman, P. A., A modified version of the Cornell

et al. force field with improved sugar pucker phases and helical repeat. J Biomol Struct Dyn 1999, 16 (4), 845-62. 43.

Jorgensen, W. L.; Chandrasekhar, J.; Madura, J. D.; Impey, R. W.; Klein, M. L.,

Comparison of simple potential functions for simulating liquid water. J Chem Phys 1983, 79 (2), 926-935. 44.

Darden, T.; York, D.; Pedersen, L., Particle mesh Ewald: An Nlog(N) method for

Ewald sums in large systems. The Journal of Chemical Physics 1993, 98, 10089-10092. 45.

Pastor, R. W.; Brooks, B. R.; Szabo, A., An analysis of the accuracy of Langevin and

molecular dynamics algorithms. Mol Phys 1988, 65 (6), 1409-1419. 46.

Izaguirre, J. A.; Catarello, D. P.; Wozniak, J. M.; Skeel, R. D., Langevin stabilization

of molecular dynamics. J Chem Phys 2001, 114 (5), 2090-2098.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

47.

Page 36 of 38

Ryckaert, J.-P.; Ciccotti, G.; Berendsen, H. J. C., Numerical integration of the

cartesian equations of motion of a system with constraints: molecular dynamics of n-alkanes.

J Comput Phys 1977, 23 (3), 327-341. 48.

Marie Zgarbová, Michal Otyepka, Jirí Sponer, Arnost Mladek, Pavel Banas,Thomas

E. Cheatham, III, and Petr Jurecka, Refinement of the Cornell et al. Nucleic Acids Force Field Based on Reference Quantum Chemical Calculations of Glycosidic Torsion Profiles. J

Chem Theory Comput 2011, 7, 2886–2902. 49.

Richards, F.M., Areas, volumes, packing and protein structure. Annu Rev Biophys

Bioeng 1977, 6, 151-176. 50.

Ferrin, T. E.; Huang, C. C.; Jarvis, L. E.; Langridge, R., The MIDAS database system.

J Mol Graphics 1988, 6, 13-27 and 36–37. 51.

Lavery, R.; Skelnar, H. J., Defining the structure of irregular nucleic acids:

conventions and principles. Biomol Struct Dyn 1988, 6, 63–91. 52.

Leroy, J. L.; Kochoyan, M.; Huynh-Dinh, T.; Gueron, M., Characterization of base-

pair opening in deoxynucleotide duplexes using catalyzed exchange of the imino proton. J

Mol Biol 1988, 200(2), 223–238. 53.

Nonin, S.; Leroy, J. L.; Gueron, M., Terminal Base Pairs of Oligodeoxynucleotides:

Imino Proton Exchange and Fraying. Biochemistry 1995, 34, 10652–10659. 54.

Pettersen, E. F.; Goddard, T. D.; Huang, C. C.; Couch, G. S.;Greenblatt, D. M.; Meng,

E. C.; Ferrin, T. E., UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 2004, 25(13), 1605–1612. 55.

Williams, L. D.; Egli, M.; Gao, Q.; Rich, A., DNA intercalation: Helix unwinding and

Neighbor-Exclusion. Adenine Press 1992; Vol. Volume 1: Nucleic Acids, ISBN 0-94003037-3. 56.

Nielsen, C. B.; Petersen, M.; Pedersen, E. B.; Hansen, P. E.; Christensen, U. B., NMR

Structure Determination of a Modified DNA Oligonucleotide Containing a New Intercalating Nucleic Acid. Bioconjug Chem 2004, 15 (2), 260-269.


Page 37 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


57.

Chapter 2: DNA and RNA Structure. In Nucleic acids in chemistry and biology

Blackburn, G. M.; Gait, M. J.; Loakes, D.; Williams, D. M., Eds. RSC publishing: UK, 2006; p 54.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 38

GRAPHIC ABSTRACT


Molecular Dynamics of Double Stranded Xylo-Nucleic Acid - Journal

Recommend Documents