Molecular Machine Powered Surface Programmatic Chain Reaction

Article Cite This: Anal. Chem. XXXX, XXX, XXX−XXX

pubs.acs.org/ac

Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein Jing Zhu, Haiying Gan, Jie Wu, and Huangxian Ju* State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023, People’s Republic of China ABSTRACT: A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer−target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1−H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.

I

tethered on the affinity ligand, it can only swing along a certain area nearby its foothold, which limits sensitivity improvement of electrochemical biosensors. To overcome this drawback, a molecular machine-based amplification has been designed on a three-stranded DNA complexes modified electrode for amplified electrochemical sensing of protein.23 Here a surface programmatic chain reaction (SPCR) triggered with a bipedal molecular machine (BMM) via proximity-dependent hybridization (PDH) is proposed on a sensing surface modified with accurately designed hairpin DNA to develop a novel amplification strategy for highly sensitive electrochemical biosensing. PDH has been extensively used for protein detection24,25 via the recognition of antibody or aptamer to targets to bring the tail DNA pairs into close proximity.26−28 Compared with conventional protein assays, PDH-based assays/biosensors are simpler and faster because they take the simplicity and variousness of DNA assembly to achieve one-step protein detection. In addition, by combining with DNA-based signal amplification strategies, such as polymerase chain reaction,29 rolling circle amplification,30 exonuclease/endonuclease-mediated cycle amplification,31,32 hybridization chain reaction,33 and catalytic hairpin assembly,34 the sensitivity of these PDH-based assays/biosensors is also guaranteed. Here, the SPCR was achieved on an electrochemical biosensor that was fabricated by

nspired by molecular machines in living systems, a variety of artificial molecular machines have recently been designed to perform precise cargo transport or biosynthesis. Due to the simplicity and programmable ability of nucleotide assembly, DNA-based molecular machines have well been developed. Different types of DNA molecular machines including DNA walkers,1,2 tweezers,3 spiders,4 and gears5 have been constructed and applied for organic synthesis,6 molecular transporter7,8 and molecular imaging.9 Typically, DNA molecular machines make use of DNA footpaths,6,10 DNA origami,4,8,11 or DNA−Au nanoparticle12,13 tracks to guide their movements following a burnt-bridge mechanism, which leads to programmatic DNA assembly by toehold-mediated strand displacement1,2,8,14,15 or DNAzyme/nuclease-mediated hydrolysis of the fuel strand.12,16,17 Recently, the design of swing arm-based DNA molecular machines has attracted considerable attention in biosensing13,18−20 and intracellular molecular imaging9 fields. In these DNA machines, the DNA tracks are normally constructed on nanoparticle surfaces functionalized with a high ratio of signal oligonucleotides and affinity ligands. Through a targetbased affinity reaction, the DNA swing arm is brought to the nanoparticle surface and swings autonomously along the surface via enzymatic cleavage13,16 or displacement hybridization21 to circularly release signal oligonucleotides. A swing arm-based DNA machine has also been used to construct sensitive electrochemical aptasensors via specific target binding and endonuclease-powered swing movement on an electrode surface.16,22 However, as the swing arm-based DNA machine is © XXXX American Chemical Society

Received: March 18, 2018 Accepted: April 4, 2018 Published: April 4, 2018 A

DOI: 10.1021/acs.analchem.8b01217 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

H2-Fc: AGATGTCG TCTACACATGG CGACATCTAACCTAGC CCATGTGTAGA-Fc P1: GGTTGGTGTGGTTGG (T)n CGACATCTAACCTAGCTCA P2:AGTCCGTGGTAGGGCAGGTTGGGGTGACT (T)n CGACATCTAACCTAGCTCA Here n represents 5, 10, 15, and 20, and the stem regions of H1 and H2-Fc and aptamer bases for thrombin recognition are shown in italics and bold, respectively. Apparatus. Electrochemical measurements were performed on a CHI 660D electrochemical workstation (CH Instruments Inc., U.S.A.) at room temperature with a conventional threeelectrode system composed of a platinum wire as counter, Ag/ AgCl as reference, and the AuE with 2 mm diameter as working electrodes. Electrochemical impedance spectroscopic (EIS) measurements were carried out on a PGSTAT 12 system (Autolab, The Netherlands). Fabrication of the Electrochemical Sensor. The gold electrode was treated according to a previous procedure.35 Briefly, after it was immersed in freshly prepared piranha solution (H2SO4/H2O2, 3:1) for 30 min and sonicated successively in water, ethanol, and water, the electrode was carefully polished with a mirror surface with 0.05 μm diameter alumina slurry. Then, this electrode was electrochemically activated by scanning the potential from −0.2 to +1.6 V in 0.5 M H2SO4 at a scan rate of 0.1 V s−1 for 40 cycles. The cleaned electrode was thoroughly washed with water and dried under flowing nitrogen. After H1 (10 μM) was annealed at 95 °C for 5 min and slowly cooled down to room temperature, equal volumes of annealed H1 (10 μM) and TCEP (1 mM) were mixed for 1 h to reduce disulfide bonds, following a dilution with Tris−HCl buffer to get H1 at 0.3 μM. An amount of 6 μL of H1 (0.3 μM) was then dropped on electrode surface to incubate at 37 °C for 2 h. After rinsing with 10 mM PBS (pH 7.4, 0.1 M NaCl) and drying with nitrogen, 6 μL of MCH (1 mM) was dropped on the electrode to incubate for 1 h for blocking the unmodified sites. After washing with PBS and drying with nitrogen, the electrochemical biosensor was obtained and stored at 4 °C before use. Measurement Procedure. Prior to measurement, a mixture of 50 nM P1, 50 nM P2, 0.8 μM H2-Fc, and various concentrations of thrombin in Tris−HCl buffer was prepared and incubated for 15 min at room temperature. An amount of 6 μL of the mixture was dropped on the biosensor surface to incubate for 80 min at room temperature. After washing with 10 mM PBS (pH 7.4), the electrochemical biosensor was immersed in 10 mM PBS (pH 7.4) containing 0.1 M NaClO4 for alternating current voltammetric (ACV) detection from 0 to +0.6 V with a step potential of 4 mV, a frequency of 25 Hz, and an amplitude of 25 mV, which was reported to be an efficient method to obtain the extremely small voltammetric signal of ferrocene on the electrode.36 Chronocoulometric (CC) measurements were carried out at a pulse period of 500 ms and pulse width of 700 mV in 10 mM Tris−HCl buffer containing 50 μM RuHex.

the self-assembly of hairpin DNA 1 (H1) on a gold electrode surface (Figure 1). Upon the mixing of target protein with two

Figure 1. Schematic diagram of the electrochemical biosensing platform using BMM-powered SPCR for signal amplification and sensitive detection of thrombin.

DNA-based affinity probes (P1 and P2), the BMM was first formed through aptamer−target specific recognition. The formed BMM could hybridize with the surface-tethered H1 to expose its prelocked toehold domain for subsequent hybridization with ferrocene-labeled hairpin DNA 2 (H2-Fc) via toehold-mediated strand displacement, resulting in the attachment of H2-Fc on the electrode and the release of BMM. The free BMM could then be recycled for continuous operation of SPCR and eventually traverse the sensing surface, along with the introduction of a large number of H2-Fc onto the electrode surface for signal amplification and sensitive detection of target. In principle, the proposed electrochemical sensing protocol was particularly simple due to the one-incubation and enzyme-free design. Different from previous DNA machine-based electrochemical signal-off detection,16,17 the proposed signal-on sensing platform showed superior sensitivity with a detection limit at the sub-picomolar level for thrombin. Moreover, this strategy possessed very good extensibility by using corresponding DNA-based affinity probes to recognize the targets for formation of BMM, indicating its promising application in biosensing.

■

EXPERIMENTAL SECTION Materials and Reagents. Tris(2-carboxyethyl) phosphine hydrochloride (TCEP), 6-mercapto-1-hexanol (MCH), hexaammineruthenium(III) chloride (RuHex), and thrombin were obtained from Sigma-Aldrich (St. Louis, MO, U.S.A.). Carcinoembryonic antigen (CEA), prostate-specific antigen (PSA), and α-fetoprotein (AFP) were purchased from Keybiotech Co. Ltd. (Beijing, China). Ultrapure water obtained from a Millipore water purification system (18 MΩ, Milli-Q, Millipore) was used in the whole assay. Tris−HCl buffer (20 mM, pH 7.4) contained 140 mM NaCl, 5 mM KCl, 1 mM CaCl2, and 1 mM MgCl2. The serum samples were from Jiangsu Cancer Hospital and stored at −20 °C before use. All oligonucleotides were synthesized by Sangon Biotechnology Co. Ltd. (Shanghai, China), and their sequences are listed as follows (from 5′ to 3′): H1: HS-GTCAGTGA GCTAGGTTAGATGTCG CCATGTGTAGA CGACATCTAA CCTAGC

■

RESULTS AND DISCUSSION Principle of BMM-Powered SPCR. This work constructed a sensitive and simple electrochemical biosensing platform for protein detection through the BMM-powered SPCR for signal amplification. Two hairpin DNA (H1 and H2-Fc) along with two DNA-based affinity probes (P1 and P2) were used to

B

DOI: 10.1021/acs.analchem.8b01217 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

chemical biosensor. The Ret slightly changed after the biosensor was incubated with the mixture of P1, P2, and H2-Fc (Figure 2A, curve d), indicating neither the tail sequences of P1 and P2 nor H2-Fc could hybridize directly with H1. However, in the presence of target protein, Ret was enhanced greatly (Figure 2A, curve e) due to the formation of BMM, which triggered the SPCR for hybridization of H2-Fc with H1 on the electrode surface. The feasibility of the electrochemical biosensing of thrombin was demonstrated by measuring ACV responses under different conditions (Figure 2B). When the biosensor was incubated with Tris−HCl buffer, an ideal background was observed (Figure 2B, curve a). In the absence of thrombin, either H2-Fc (Figure 2B, curve b) or the mixture of P1, P2, and H2-Fc (Figure 2B, curve c) showed negligible response, indicating none of the H2-Fc, P1, and P2 hybridized directly with H1. However, in the presence of 1 nM thrombin, 10 and 80 min incubation led to significant response (Figure 2B, curves d and e), indicating the formation of BMM to trigger the SPCR for the attachment of H2-Fc. Moreover, the response of 80 min of reaction (Figure 2B, curve e) was much bigger than that of 10 min of reaction (Figure 2B, curve d), suggesting the BMM successively migrated on the electrode to open H1 and hybridize with H2-Fc. These results indicated that the SPCR could only be triggered by the BMM formed by specific binding of thrombin with P1 and P2 to produce the amplified electrochemical signal for sensitive detection. Optimization of Experimental Conditions. To achieve the best performance of the electrochemical biosensor, some key experimental parameters were optimized. The density of H1 immobilized on the electrode was first studied by controlling the concentration of H1 added on the electrode surface. Neither high nor low density was conducive to the hybridization of BMM to H1, because the low density suppressed the proximity-dependent hybridization and the high density produced steric hindrance to inhibit the reaction (Figure 3A). A value of 0.3 μM H1 was selected as the optimized concentration for the fabrication of electrochemical biosensor. The density of H1 immobilized on the sensor surface was estimated via CC measurements using RuHex as a redox marker (Figure 3B). According to the Cottrell equation and Faraday’s law:38,39

perform target recognition and signal amplification (Figure 1). H1 was self-assembled on an electrode surface through a Au− thiol bond for preparation of the electrochemical sensing interface, and kinetically locked H2-Fc could not react with H1. Both probes were designed to comprise three functional regions: the aptamer region (Apt15 in P1 and Apt29 in P2) for thrombin binding to form BMM, the T15 poly(T) spacer for avoiding steric hindrance during proximity-dependent hybridization, and the 19-nt tail sequence for BMM hybridization with the surface-tethered H1. Here, P1 and P2 could not open H1 directly because their tail sequences contained only three complementary bases longer than the stem fragment of H1. However, in the presence of thrombin, the BMM was formed through the simultaneous binding of P1 and P2 to one thrombin, resulting in the close proximity of the tail sequences to allow the hybridization of BMM with the surface-tethered H1,23,37 which exposed the prelocked toehold domain of H1 for subsequent hybridization with H2-Fc. Through the toeholdmediated displacement reaction, H2-Fc displaced the tail sequence to associate to H1, making the ferrocene label close to the electrode surface and “turning on” the electrochemical signal. Meanwhile, the released BMM migrated to the neighboring H1 to perform continuous SPCR. In principle, one BMM could traverse the whole sensing surface and open all H1 on the electrode to associate with H2-Fc via the proposed SPCR. Owning to the one-to-all (one target to all reactants on the sensing surface) amplification, a large number of H2-Fc were eventually captured onto the electrode surface through the BMM-powered SPCR strategy for signal amplification and sensitive detection of target protein. Characterization and Feasibility of the Electrochemical Sensing Platform. EIS measurements were performed in 0.1 M KCl containing 5 mM K3Fe(CN)6 and K4Fe(CN)6 to characterize the preparation and assay application of electrochemical biosensor (Figure 2A). The bare electrode showed a

⎛ Dt ⎞1/2 Q = 2FnAC b⎜ ⎟ + Q c + nFA Γ0 ⎝π ⎠ Figure 2. (A) EIS of the bare electrode (a), H1-modified electrode (b), the electrochemical biosensor (c), and the biosensor incubated with the mixture of 50 nM P1, 50 nM P2, and 0.8 μM H2-Fc in the absence (d) and presence (e) of 1 nM thrombin for 80 min. (B) ACV responses of the electrochemical biosensor incubated with Tris−HCl buffer (a), 0.8 μM H2-Fc (b), and a mixture of 50.0 nM P1, 50.0 nM P2, and 0.8 μM H2-Fc in the absence (c) and presence of 1 nM thrombin for 10 min (d) and 80 min (e).

(1)

where F is the Faraday constant (96 487 C/equiv), n is the number of electrons involved in the electrode reaction, A is the electrode area (cm2), Cb is the bulk concentration of RuHex (mol cm−3), D is its diffusion coefficient (cm2 s−1), t is the time (s), Qc is the capacitive charge (C), and Γ0 is the quantity of the adsorbed RuHex (mol cm−2). The saturated surface excess of RuHex could be calculated and converted to the surface density of the DNA probe: ⎛z⎞ ΓDNA = Γ0⎜ ⎟(NA ) ⎝m⎠

relatively small electron-transfer resistance (Ret) (Figure 2A, curve a) due to its fast charge-transfer process. After its modification with H1, Ret greatly increased (Figure 2A, curve b) because the negative-charged phosphate skeletons of the H1 monolayer repelled [Fe(CN)6]3−/4− from the electrode surface. The surface blocking with MCH further increased the Ret (Figure 2A, curve c) owing to the inaccessibility created by MCH, suggesting the successful preparation of the electro-

(2) −2

where ΓDNA is the probe density (molecules cm ), m is the number of bases of the DNA probe, z is the charge of the redox molecule (for RuHex, z is 3), and NA is Avogadro’s number. The density of H1 on the biosensor surface was 2.5 × 1012 molecules/cm2, and the average intermolecular spacing was C

DOI: 10.1021/acs.analchem.8b01217 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 3. (A) Effect of H1 concentration for biosensor preparation on ACV response. (B) CC curves at the MCH-modified electrode (a) and biosensor (b) in 10 μM Tris−HCl buffer containing 50 μM RuHex. The intercept (t1/2 = 0) represents the charge of RuHex adsorbed at the electrode surface. Effects of (C) spacer length of P1 and P2, (D) reaction time, and (E) concentration of H2-Fc on ACV response. Error bars represent standard deviations of three parallel experiments.

calculated to be 6.4 nm. This density of H1 was not high enough to produce steric hindrance to inhibit the reaction between BMM and H1.40 The spacer lengths of P1 and P2 were also optimized to gain the best performance of BMM (Figure 3C). They should be longer than the average intermolecular spacing of H1 (6.4 nm). Thus, the current response increased sharply before the spacer length of 10T (according to a freedom of ∼6.8 nm for BMM) and reached a maximum value at 15T (according to a freedom of ∼10.2 nm for BMM). This result indicated the spacer length of 15T was enough for BMM to avoid steric hindrance and simultaneously hybridize with two H1, which was thus selected for P1 and P2. In principle, one BMM could open all H1 on the electrode to associate with H2-Fc by taking a relatively long reaction time. Thus, the time of BMM-powered SPCR was investigated. As shown in Figure 3D, the signal response increased with the prolonging of reaction time and reached a plateau after incubation for 80 min. Therefore, a reaction time of 80 min was chosen for BMM-powered SPCR. Furthermore, the concentration of H2-Fc was also optimized to be 0.8 μM for achieving high analytical performance of this sensing system (Figure 3E). Assay Performance. The analytical performance of the proposed electrochemical assay using BMM-powered SPCR was investigated under optimal experimental conditions. As shown in Figure 4A, the ACV response rose up as the concentration of thrombin increased. The plot of the response versus the logarithm of thrombin concentration showed good linearity in the range from 2 pM to 20 nM following the linear regression equation of I = 31.58 log C + 8.78 with a correlation coefficient of 0.9968 (Figure 4B). The detection limit was calculated to be 0.76 pM corresponding to the signal of blank plus 3 times the standard deviation (SD). Benefiting from the wonderful amplification ability of BMM-powered SPCR, this detection limit was superior to those of other electrochemical sensing methods, for example, 130 times lower than the aptasensor using exonuclease for background reduction and

Figure 4. (A) ACV responses of the biosensor to 0, 0.2, 1, 2, 10, 20, 100, 200, 1000, 2000, 10 000, and 20 000 pM thrombin under optimal conditions (from a to l) and (B) plot of peak current vs logarithm of thrombin concentration. Error bars represent standard deviations of three parallel experiments.

hemin for direct electron transfer,41 7 times lower than the electrochemical aptasensor integrating with proximity binding and metal ion-dependent DNAzyme recycling amplification,42 6 times lower than the electrochemical impedimetric sensor based on poly(pyrrole-nitrilotriacetic acid)−aptamer film,43 and 3 times lower than those using swing arm-based DNA machine16 and proximity binding-triggered molecular machine23 for electrochemical signal amplification. The reproducibility was tested by detecting 1.0 nM thrombin with five biosensors. The relative standard deviation of the five duplicate measurements was 4.2%, suggesting good reproducibility of the proposed electrochemical biosensor. The stability of the biosensor was challenged by storing it in 4 °C for 14 days. The biosensor still retained 94.6% of its initial response to 1 nM thrombin, indicating a robust stability of the biosensor. To evaluate the specificity of the assay, nontarget proteins including AFP, CEA, and PSA at 10-fold concentration were employed as interfering substances. As expected, except the target protein thrombin, none of the interfering substances gave rise to response compared with the blank (Figure 5). This result indicated the proposed assay exhibited excellent D

DOI: 10.1021/acs.analchem.8b01217 Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

■

detection specificity toward target protein, suggesting the assay possessed good validity and reliability.

Article

AUTHOR INFORMATION

Corresponding Author

*Phone/Fax: +86-25-89683593. E-mail: [email protected]. ORCID

Jie Wu: 0000-0003-1379-122X Huangxian Ju: 0000-0002-6741-5302 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (21635005, 21575063, and 21361162002).

Figure 5. Specificity of the biosensor against 10 nM AFP, CEA, and PSA, 1 nM thrombin, and their mixture. Error bars represent standard deviations of three parallel experiments.

■

Furthermore, recovery tests were performed to test the applicability of the biosensor for detecting thrombin in physiological environment. Four different concentrations of thrombin were spiked in 10-fold diluted healthy serum to serve as samples. As listed in Table 1, the range of the recovery for Table 1. Results for Thrombin Determination in Diluted Serum Samples

a

samples

added (pM)

found (pM)

recovery (%)

RSD (%)a

1 2 3 4

10 200 500 1000

10.25 191.9 488.7 1036

102.5 95.95 97.74 103.6

6.20 4.63 2.96 3.21

The mean of three measurements.

thrombin was from 95.95% to 103.6%, and the RSDs were between 2.96% and 6.20%. These results indicated that the proposed biosensor along with BMM-powered SPCR had potential applications for detection of proteins in clinical samples.

■

REFERENCES

(1) Jung, C.; Allen, P. B.; Ellington, A. D. Nat. Nanotechnol. 2016, 11, 157−163. (2) Shin, J. S.; Pierce, N. A. J. Am. Chem. Soc. 2004, 126, 10834− 10835. (3) Liu, M. H.; Fu, J. L.; Hejesen, C.; Yang, Y. H.; Woodbury, N. W.; Gothelf, K.; Liu, Y.; Yan, H. Nat. Commun. 2013, 4, 2127−2131. (4) Lund, K.; Manzo, A. J.; Dabby, N.; Michelotti, N.; Johnsonbuck, A.; Nangreave, J.; Taylor, S.; Pei, R. J.; Stojanovic, M. N.; Walter, N. G.; Winfree, E.; Yan, H. Nature 2010, 465, 206−210. (5) Tian, Y.; Mao, C. D. J. Am. Chem. Soc. 2004, 126, 11410−11411. (6) He, Y.; Liu, D. R. Nat. Nanotechnol. 2010, 5, 778−782. (7) Muscat, R. A.; Bath, J.; Turberfield, A. J. Small 2012, 8, 3593− 3597. (8) Wickham, S. F. J.; Endo, M.; Katsuda, Y.; Hidaka, K.; Bath, J.; Sugiyama, H.; Turberfield, A. J. Nat. Nanotechnol. 2011, 6, 166−169. (9) Peng, H. Y.; Li, X. F.; Zhang, H. Q.; Le, X. C. Nat. Commun. 2017, 8, 14378−14390. (10) Yin, P.; Choi, H. M. T.; Calvert, C. R.; Pierce, N. A. Nature 2008, 451, 318−322. (11) Tomov, T. E.; Tsukanov, R.; Glick, Y.; Berger, Y.; Liber, M.; Avrahami, D.; Gerber, D.; Nir, E. ACS Nano 2017, 11, 4002−4008. (12) Qu, X. M.; Zhu, D.; Yao, G. B.; Su, S.; Chao, J.; Liu, H. J.; Zuo, X. L.; Wang, L. H.; Shi, J. Y.; Wang, L. H.; Huang, W.; Pei, H.; Fan, C. H. Angew. Chem., Int. Ed. 2017, 56, 1855−1858. (13) Yang, X. L.; Tang, Y. N.; Mason, S. D.; Chen, J. B.; Li, F. ACS Nano 2016, 10, 2324−2330. (14) Omabegho, T.; Sha, R. J.; Seeman, N. C. Science 2009, 324, 67− 71. (15) Wickham, S. F. J.; Bath, J.; Katsuda, Y.; Endo, M.; Hidaka, K.; Sugiyama, H.; Turberfield, A. J. Nat. Nanotechnol. 2012, 7, 169−173. (16) Ji, Y. H.; Zhang, L.; Zhu, L. Y.; Lei, J. P.; Wu, J.; Ju, H. X. Biosens. Bioelectron. 2017, 96, 201−205. (17) Li, C.; Li, X. X.; Wei, L. M.; Liu, M. Y.; Chen, Y. Y.; Li, G. X. Chem. Sci. 2015, 6, 4311−4317. (18) Zhang, H. Q.; Lai, M. D.; Zuehlke, A.; Peng, H. Y.; Li, X. F.; Le, X. C. Angew. Chem., Int. Ed. 2015, 54, 14326−14330. (19) Chen, J. B.; Zuehlke, A.; Deng, B.; Peng, H. Y.; Hou, X. D.; Zhang, H. Q. Anal. Chem. 2017, 89, 12888−12895. (20) Feng, C.; Wang, Z. H.; Chen, T. S.; Chen, X. X.; Mao, D. S.; Zhao, J.; Li, G. X. Anal. Chem. 2018, 90, 2810−2815. (21) Liang, C. P.; Ma, P. Q.; Liu, H.; Guo, X. G.; Yin, B. C.; Ye, B. C. Angew. Chem., Int. Ed. 2017, 56, 9077−9081. (22) Pu, Q. L.; Li, J. L.; Qiu, J. H.; Yang, X. H.; Li, Y.; Yin, D.; Zhang, X. Y.; Tao, Y. Y.; Sheng, S. C.; Xie, G. M. Biosens. Bioelectron. 2017, 94, 719−727. (23) Yang, J. M.; Dou, B. T.; Yuan, R.; Xiang, Y. Anal. Chem. 2017, 89, 5138−5143. (24) Li, F.; Zhang, H. Q.; Lai, C.; Li, X. F.; Le, X. C. Angew. Chem., Int. Ed. 2012, 51, 9317−9320. (25) Li, F.; Zhang, H. Q.; Wang, Z. X.; Li, X. K.; Li, X. F.; Le, X. C. J. Am. Chem. Soc. 2013, 135, 2443−2446.

CONCLUSION

A simple and sensitive electrochemical sensing platform has been developed for protein detection by employing a designed BMM-powered SPCR for signal amplification. By means of the proximity-dependent hybridization and toehold-mediated strand displacement, the target-induced BMM operates the SPCR to successively open surface-tethered H1 and capture H2-Fc on the electrode surface, generating an amplified electrochemical signal. Theoretically, one BMM can traverse the whole biosensing surface to open all H1, and the one-to-all amplification endows the assay with high detection sensitivity and provides a detection limit down to the sub-picomolar level. In addition, the assay is enzyme-free and uses fully the DNAbased assembly for signal read-out of protein recognition, making it simple and cost-efficient for clinical application. Moreover, the biosensing platform can be conveniently extended to detect a variety of proteins by using the corresponding aptamers or antibody−DNA pairs. Overall, the proposed assay integrating the BMM-powered SPCR is simple, sensitive, selective, and universal for protein detection, indicating potential application in bioanalysis. E

DOI: 10.1021/acs.analchem.8b01217 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry (26) Ren, K. W.; Wu, J.; Yan, F.; Ju, H. X. Sci. Rep. 2014, 4, 4360. (27) Ren, K. W.; Wu, J.; Yan, F.; Zhang, Y.; Ju, H. X. Biosens. Bioelectron. 2015, 66, 345−349. (28) Zhang, H. Q.; Li, X. F.; Le, X. C. Anal. Chem. 2012, 84, 877− 884. (29) Shu, B.; Zhang, C. S.; Xing, D. Biosens. Bioelectron. 2017, 97, 360−368. (30) Huang, J.; Li, X. Y.; Du, Y. C.; Zhang, L. N.; Liu, K. K.; Zhu, L. N.; Kong, D. M. Biosens. Bioelectron. 2017, 91, 417−423. (31) Yang, K. L.; Huo, M.; Guo, Y. H.; Yang, Y. Z.; Wu, J.; Ding, L.; Ju, H. X. Analyst 2017, 142, 3740−3746. (32) Zhou, W. J.; Su, J.; Chai, Y. Q.; Yuan, R.; Xiang, Y. Biosens. Bioelectron. 2014, 53, 494−498. (33) Dirks, R. M.; Pierce, N. A. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 15275−15278. (34) Li, B. L.; Ellington, A. D.; Chen, X. Nucleic Acids Res. 2011, 39, e110. (35) Xiao, Y.; Lai, R. Y.; Plaxco, K. W. Nat. Protoc. 2007, 2, 2875− 2880. (36) Creager, S. E.; Wooster, T. T. Anal. Chem. 1998, 70, 4257− 4263. (37) Zhang, Y. L.; Huang, Y.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. J. Am. Chem. Soc. 2007, 129, 15448−15449. (38) Yang, H.; Gao, Y.; Wang, S. Q.; Qin, Y.; Xu, L.; Jin, D.; Yang, F.; Zhang, G. J. Biosens. Bioelectron. 2016, 80, 450−455. (39) Yao, B.; Liu, Y. C.; Tabata, M.; Zhu, H. T. Z.; Miyahara, Y. J. Chem. Commun. 2014, 50, 9704−9706. (40) Peterson, A. W.; Heaton, R. J.; Georgiadis, R. M. Nucleic Acids Res. 2001, 29, 5163−5168. (41) Jiang, B. Y.; Wang, M.; Li, C.; Xie, J. Q. Biosens. Bioelectron. 2013, 43, 289−292. (42) Yang, J. M.; Dou, B. T.; Yuan, R.; Xiang, Y. Anal. Chem. 2016, 88, 8218−8223. (43) Xu, H.; Gorgy, K.; Gondran, C.; Le Goff, A.; Spinelli, N.; Lopez, C.; Defrancq, E.; Cosnier, S. Biosens. Bioelectron. 2013, 41, 90−95.

F

DOI: 10.1021/acs.analchem.8b01217 Anal. Chem. XXXX, XXX, XXX−XXX