Morpholino-Functionalized Nanochannel Array for Label-Free Single

Mar 3, 2015 - The sensitive identification of single nucleotide polymorphisms becomes increasingly important for disease diagnosis, prevention, and pr...
0 downloads 0 Views 321KB Size
Download PDF
Subscriber access provided by KUNGL TEKNISKA HOGSKOLAN

Article

A morpholino-functionalized nanochannel-array for label-free SNPs detection Hong-Li Gao, Min Wang, Zeng-Qiang Wu, Chen Wang, Kang Wang, and Xing-hua Xia Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/ac504830e • Publication Date (Web): 03 Mar 2015 Downloaded from http://pubs.acs.org on March 8, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

A morpholino-functionalized nanochannel-array for label-free SNPs detection Hong-Li Gao1,2‡, Min Wang1‡, Zeng-Qiang Wu1, Chen Wang1, Kang Wang1, and Xing-Hua Xia1* 1.

State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Collaborative Innovation Center of Chemistry for Life Sciences, Nanjing 210093, China. 2.

Food and Bioengineering College, Henan University of Science and Technology, Luo-yang 471023, China.

ABSTRACT: The sensitive identification of single nucleotide polymorphisms becomes increasing important for disease diagnosis, prevention and practical applicability of pharmacogenomics. Herein, we propose a simple, highly selective, label-free SNPs sensing device by electrochemically monitoring the diffusion flux of ferricyanide probe across probe DNA/morpholino duplex functionalized nanochannels of porous anodic alumina. When perfectly matched or mismatched target DNA flows through the nanochannels modified with probe DNA/morpholino duplex, it competes for the probe DNA from morpholino, resulting in change of the surface charges. Thus, the diffusion flux of negatively charged electroactive probe ferricyanide is modulated since it is sensitive to the surface charge due to the electrostatic interactions in electric double layer-merged nanochannels. Monitoring of the change in diffusion flux of probe enables us to detect not only single base or two bases mismatched sequence, but also the specific location of the mismatched base. As demonstration, SNPs in the PML/RARα fusion gene, known as a biomarker of acute promyelocytic leukemia (APL), have been successfully detected.

Single nucleotide polymorphisms (SNPs), the variation of a single nucleotide in the same gene (alleles), account for 90% of human genetic variation which is significantly affected by environmental conditions.[1] As the most abundant genetic polymorphisms, SNPs are responsible for many inherited diseases[2] and cancers.[3] Therefore, it is essential to identify SNPs sensitively for disease diagnosis,[4] prevention and practical applicability of pharmacogenomics.[5] Up to now, a variety of methods and technologies for SNPs detection have been developed, such as, allele-specific polymerase chain reaction,[6] electrophoresis,[7] optical methods,[8] and electrochemistry.[9] They have provided invaluable information in SNPs and genotyping studies. By combining PCR with capillary sequencing, Liu et al[6b] proposed an Au nanoparticlesenhanced allele-specific sequencing strategy to identify several DNA variations on significant regions of human genomic DNA with high-throughput and quick analysis. This method requires rigid temperature control, which largely limits its potential applications in clinical analysis. Soh et al[8f] designed a triple-stem DNA structure for parallel SNP analysis of multi-target in a homogeneous and room temperature system. Unfortunately, the sensitivity of this method is severely limited by the signal interference from fluorophores or quenchers, and multiple probe modifications may increase the complexity and cost of probe design. As a main means in molecular genetic laboratories, electrophoresis could also carry out highthroughput detection of SNPs. However, this method usually requires the markers and should be operated with

suitable detection technologies. In addition, electrochemical methods with high sensitivity have been extensively used in SNPs detection. However, they may involve expensive labeled-probes or tedious assay processes and exhibit poor ability to eliminate false signal from nonspecific binding of the redox probes. Recently, some novel SNPs detection technologies have been developed based on biological/synthetic nanopores or nanochannels.[10] Single-stranded DNA (ssDNA) with single-base mismatch could be identified by monitoring the change of the ion current when ssDNA molecules flow through a “DNA-nanopore” formed by the α-hemolysin pore.[10a] Unfortunately, the application of the natural αhemolysin nanopore in bioanalysis is limited by its nontunable size and poor stability.[11] In order to explore a robust, size- and shape-controlled device with an improved stability toward external stimulus (i.e., temperature, pH and ionic strength), artificial nanoporous membranes have been developed and extensively used for SNPs detection. Martin et al successfully detected singlebase mismatched DNA based on Au nanotubes within polycarbonate membranes with a hairpin DNA as a molecule recognition agent.[10b] In this approach, the gold plating procedure is multi-step and time-consuming and the proposed method shows poor reproducibility, stability and selective functionality.[12] Kim et al detected SNPs using a DNA- functionalized nanochannel-array in which a block copolymer with di-COOH end groups was used as the substrate.[10d] Although the strategy can precisely de-

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 8

tect SNPs during continuous flowing, its practical application is limited by both the labeled probe DNA and the hydrophobic block copolymer. Porous anodic alumina (PAA) membrane is a representative material for biosensing devices because of its controlled channel density, radius and ease of surface modification.[13] Liu et al[13c] proposed a PAA nanochannel-based electrochemical platform for facial detection potassium ions and adenosine triphosphate by monitoring the current changes of indicator molecules due to the conformational change of aptamers confined in the nanochannels in the presence of target molecules. Merkoçi et al[13d] reported a PAA nanochannel-based biosensor for antigen detection by detecting the conductivity changes of the redox indicator. Herein, we propose a probe DNA/morpholino duplexfunctionalized nanochannel-array of porous anodic alumina (PAA) as a sensitive and label-free SNPs detection device by monitoring the diffusion flux of electrochemical probe ferricyanide across the nanochannel-array. The diffusion flux of ferricyanide ions is electrochemically detected as the Faradaic current at a gold film electrode (Figure S1) sputtered at one side of PAA membrane at 0 V vs. Ag/AgCl in 0.5 mM PBS (pH 8.0). The low electrolyte concentration is used to significantly exaggerate the influence of nanochannel wall charges on the flux of negatively charged ferricyanide ions and thus improve the detection sensitivity.[13a,13b] The DNA neutral analogue morpholino is previously assembled at inner surface of PAA nanochannels using silane and glutaraldehyde as the linkers (Scheme 1A). Then, the partially matched probe DNA is introduced and hybridizes with the morpholino, forming a functional nanochannel-array (Scheme 1B(b)). When the target DNA, perfectly matched or mismatched with the probe DNA, flows through the functional nanochannels, it competes for the probe DNA with morpholinos and the resultant probe DNA/target DNA duplex flows out of nanochannels (Scheme 1B(c)). The hybridization and competition processes are accompanied by the change of the nanochannel surface charges, which in turn results in the change of diffusion flux of the highly charged Fe(CN)63- probe since it is very sensitive to the change of surface charges due to the strong electrostatic interactions within the electric double layer-merged nanochannels. Therefore, sensitive and label-free SNPs detection can be achieved by monitoring the change in diffusion flux of ferricyanide via a homemade two-cell electrochemical system (Figure S2). The proposed strategy shows high sensitivity for detection of both single base/two bases mismatched sequence and the specific location of the mismatched base. Moreover, SNPs in PML/RARα fusion gene, which is vital to the early diagnosis of acute promyelocyticleukemia, have also been successfully detected.

Scheme 1. (A) Covalent functionalization of the PAA nanochannels with aminated morpholino by using silane and glutaraldehyde as the linkers. (B) Schematic representation of the principle for label-free SNPs detection based on a morpholinofunctionalized PAA nanochannel-array integrated with an electrochemical detector. Experimental Section Materials. Porous alumina membranes (PAA, 60 μm thickness) with 200 nm pores in one side (59 μm in depth) and 20 nm pores in the other side (1 μm in depth) was purchased from Whatman International Ltd. (Maidstone, England). 3-aminopropyl-trimethoxysilane (APTMS) and 25% glutaraldehyde (GA) aqueous solution were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Phosphate buffer solution (PBS) was prepared using analytical grade chemicals and deionized water (>18.2 MΩ, Millipore, USA). Morpholinos (5’NH2GCT TAG GAT CAT CGA GGT CCA ACC A-3’, 5’NH2-GCT AAG ATT GTT CAGGA GGC AG-3’) were ordered from Gene Tools LLC (Oregon, USA). All the other oligonucleotides were purchased from Sangon Biotech (Shanghai, China) and used as received without further purification. Their sequences are shown as follows: 25-base probe DNA-I: GATGATCCTAAGCTGGTTGGACCTC-3’, matched target DNA-C: GAGGTCCAACCAGCTTAGGATCATC -3´

5’perfectly 5´-

25-base probe DNA-II: 5’GTAACATCGTGCTATGGTGGTTGGA-3’, perfectly matched target DNA: 5’TCCAACCACCATAGCACGATGTTAC-3’, target DNA with

ACS Paragon Plus Environment

Page 3 of 8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

single mismatched base: TCCAACCACCATAGCACGATGATAC-3’, TCCAACCACCATTGCACGATGTTAC-3’

5’5’-

22-base probe DNA for SNPs detection in PML/RARα fusion gene: 5’-ATTGGTCTCAATGGCTGCCTCC-3’, the perfectly matched target DNA (PML/RARα fusion gene): 5’-GGAGGCAGCCATTGAGACCAAT-3’, the target DNA with single mismatched base: 5’-GGA GGCAGCCACTGAGACCAAT-3’ Surface Modification. The surface of PAA membrane is full of Al-OH groups. Coupling with amine silane and glutaraldehyde, the Al-OH groups can be transformed into reactive aldehyde groups which are used for the covalent binding of morpholinos. Porous anodic alumina membrane from Whatman with 20 nm pore diameter and 60 μm thickness was first cleaned as described elsewhere[17]. The cleaned PAA was then immersed into a 10 mL acetone solution containing 1% APTMS for 4 h to graft aminopropyl functional groups. Then, excess silane solution was removed from the PAA nanochannels by rinsing with copious amounts of acetone and deionized water. The samples were then baked at 120 oC for 1 h. The remaining modifications with glutaraldehyde and morpholino were performed after sputtering an Au film at the 200 nm side of the commercial PAA membranes. The membranes were assembled in the electrochemical detection cell (Figure S2). Fabrication of Au Film Working Electrode on PAA Membrane. An Au film working electrode on PAA membrane was fabricated as follows: A 100 nm thick Au film was sputtered on the 200 nm side of the commercial PAA membrane by using a current of 15 mA in a vacuum chamber with a pressure of 5×10-4 mbar (Ar plasma) for 600 s. As shown in Figure S1, the sputtered Au film does not change the size of the channel opening. Comparing Figure S1A with Figure S1B, it shows that the Au film sputtered on the 200 nm side exhibits good uniformity. Such Au film electrode shows good stability in our experiments even being routinely used for two weeks. This detection design enables real time monitoring of the electroactive ion flux. To handle the Au film electrode with ease, the Au filmcoated PAA membrane was sandwiched between two poly(ethyleneterephthalate) (PET) sheets (100 µm thick, DIKA Official Limited Company, Suzhou, China) with prepunched 2 mm holes. The holes decide the area of the membrane exposing to the solution phase. Then, a 0.2 mm diameter of Au wire was placed in electrical contact with the Au film coated PAA membrane. Finally, the membrane assembly was laminated together by a heating laminator (Beijing Zhongtian Feiniao Science and Technology Limited Company, Beijing China) at 150 ºC with the two prepunched holes well aligned. Cell Assembly and Electrochemical Measurements. The APTMS-grafted PAA membrane with an Au film electrode was put into a 5% aqueous solution of glutaraldehyde overnight, followed by water rinsing and subsequent drying. After that, the membrane was put into a buffer

solution for at least 30 min to ensure complete wetting. The fabricated PAA membrane was clamped between two thin poly(dimethylsiloxane) (PDMS) films and then placed between two 2 mL homemade-half cells. The two holes of both half cells were aligned to the exposed holes of the PAA membrane (effective transport area, 3.14 mm2). Importantly, the Au film coated side of the PAA membrane was contacted with the permeating cell. The Au film working electrode on the PAA membrane, a Pt wire counter electrode and the Ag/AgCl reference electrode in the permeating cell form a three-electrode electrochemical system for electrochemical detection. After the two cells (feeding cell and permeating cell) were filled with 1.5 mL of PBS solution (0.5 mM, pH 8.0), a constant magnetic stirring was applied to the feeding cell. Meanwhile, a potential of 0.0 V for electrochemical detection of ferricyanide ions was applied to the Au film working electrode using a CHI800b electrochemical work station to monitor the current response of the transported ferricyanide ions. At this detection potential, the electrochemical reaction of Fe(CN)63- is diffusion controlled, and the current response is directly proportional to the concentration of Fe(CN)63-. Once 0.3 mM of ferricyanide was added in the feeding cell, a significant current increase can be observed at 100 s because of ferricyanide ions flowing through the nanochannels to the Au film electrode surface. Noting: It is well-known that the surface charge effect could be tuned by ionic strength in PAA nanochannels, which shows a significant effect on quantitative label-free DNA analysis.[13] Only in a low ionic strength environment, the charge effect can play a dominant role in 20 nm PAA nanochannels where the electric double layer thickness is comparable to the diameter of PAA nanochannels.[13a,13b,18,19] Therefore, a low ionic strength (0.5 mM PBS, pH 8.0) is used to signify the electrostatic interaction between the probe ferricyanide and the negatively charged DNA. Immobilization of Morpholino and Hybridization of Probe DNA. After the membrane was assembled into the cell, the permeating cell was filled with 2 mL of 100 mM PBS solution and then sealed. Subsequently, 20 μL of 75 μM amined-morpholino solution in deionized water was dripped on the exposed 20 nm side of PAA surface in the feeding cell and then sealed for overnight. This technique prevents a small quantity of morpholino solution from evaporation. The remaining aldehyde groups on the nanochannel surface were blocked with 10-5 M propyamine solution for preventing non-specific binding of nucleic acids in the following modification processes. After that, the PAA membrane was washed by copious amounts of 100 mM NaCl and deionized water, respectively. For DNA hybridization, 30 μL of 10 μM probe DNA in 100 mM PBS containing 100 mM NaCl (pH 8.0) was incubated at morpholino-modified PAA membrane for 2 h at room temperature. After that, the PAA membrane was washed by copious amounts of 100mM NaCl to remove unhybridized and physically adsorbed probe DNA and then washed by deionized water.

ACS Paragon Plus Environment

Analytical Chemistry Competition of Target DNA for SNPs Detection. In the competition experiments, the permeating cell was filled with 1.5 mL PBS solution (100 mM, pH=8.0) containing 100 mM NaCl, and the feeding cell was filled with 1.5 mL PBS solution (100 mM, pH=8.0) containing 100 mM NaCl and 2 μM target DNA (perfectly matched and singlebase/two-bases mismatched). The competition experiment was carried out under continuous stirring for 1 h. Then, the electrochemical cell and PAA membrane were washed by copious amounts of 100 mM NaCl to remove the formed probe DNA/target DNA duplex, unreacted and physically adsorbed target DNA, followed by washing with deionized water. Finally, the diffusion flux of ferricyanide was monitored after the competition experiment. Results and Discussion It is worth noting that the neutral morpholino can screen the negative surface charges of PAA nanochannels, which not only facilitates the entrance of negatively charged ssDNA into nanochannels but also provides a stable background signal and thus a higher sensitivity for SNPs detection. The successful modification of morpholino is confirmed by the occurrence of P2p peak in the XPS spectra of morpholino-functionalized PAA membrane (Figure S3). In addition, monitoring the change of Faradaic current instead of ion current through nanochannels shows an improved sensitivity and selectivity, and has been used previously for label-free DNA analysis.[13a,13b] In the present work, the competitive ability of the target DNA for the probe DNA from the morpholino is evaluated by the release ratio β = (i1-i0)/(i-i0)of the probe DNA, defined as the ratio of the amount of released probe DNA from morpholino to the total amount of probe DNA, where, i and i0 are the currents measured before and after hybridization of the probe DNA with morpholino, respectively; i1 is the current measured after the consecutive competition of probe DNA by target DNA. The competitive ability of the target DNA may depend on the difference in thermodynamic stability between the morpholino/probe DNA duplex and the probe DNA/target DNA duplex. Meanwhile, this difference is directly tuned by the number of hybridized base-pairs in duplex. As demonstration, two different DNA sequences are chosen as the probe DNA: probe DNA-I contains 25 bases with 13 bases matching to the morpholino and 12 unhybridized bases; probe DNA-II contains 25 bases with 8 bases matching to morpholino and 17 unhybridized bases. The change in the diffusion flux of ferricyanide ions after different competition time for two probe DNA molecules is shown in Figure S4. The release ratio of the probe DNA-II (76%) is significantly higher than that of the probe DNA-I (32%) (Figure 1). However, the competitive reaction reaches the equilibrium faster for probe DNA-I (ca. 30 min) than probe DNA-II (ca. 70 min). The time required for completing the competitive reaction for the probe DNA-II is ca. 2.33 times longer than that for the probe DNA-I, which is similar to the ratio (ca. 2.37) of the released probe DNA-II to probe DNA-I. This phenomenon indicates that competitive reaction in confined nanochannels occurs much faster as compared to the diffusion of target

DNA into the nanochannels, since the latter process has to overcome the electrostatic repulsion between the negatively charged target DNA and the negatively charged probe DNA assembled at the nanochannel surface. Thus, the time required for completing the competitive reaction is determined by the amount of target DNA entering the nanochannels. In the case of probe DNA-II, more target DNA should enter into the nanochannels for completing the competitive reaction and thus needs longer competitive time because the probability of target DNA entering the nanochannels for both cases is the same due to the same electrostatic environments. In order to detect SNPs more sensitively, the probe DNA-II is chosen as the model probe DNA in the following experiments.

Release ratio of probe DNA/%

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 8

b

80 60 a

40 20 0 0

30

60 90 Time/min

120

Figure 1. Release ratios of the probe DNA-I (a) and probe DNA-II (b) from the morpholino by the corresponding perfectly matched target DNA in the nanochannels of PAA.

In addition, for the same probe DNA, the competitive ability of the target DNA mainly depends on the thermodynamic stability of the formed probe DNA/target DNA duplex which can be affected by the mismatched basepairs in duplex.[14] Both the location and the identity of the mismatched base in the target DNA will change the thermodynamic stability of the duplex and thus the release ratio of the probe DNA. Therefore, label-free discrimination of mismatched bases can be achieved by comparing the release ratio of probe DNA in the presence of mismatched target DNA with perfectly matched one. As shown in Figure 2, different release ratios for different target DNA molecules can be observed, indicating the different competitive ability between the perfectly matched target DNA and the mismatched ones. The order of release ratios is: the perfectly matched target DNA > the target DNA with single mismatched base in the end > the target DNA with single mismatched base in the middle, which is consistent with the order of thermodynamic stability of the corresponding duplexes in the previous literatures.[10d, 14] These results demonstrate that the SNPs can be successfully detected by the proposed label-free strategy. It is notable that the observed competitive reaction reaches a steady state within 80 min which is shorter than that reported.[10d] This phenomenon is attributed to that the morpholino/DNA duplex carries relatively lesser charges compared with the DNA/DNA duplex. It is much easier for the target DNA to flow through the nanochan-

ACS Paragon Plus Environment

Page 5 of 8

nels and hybridize with the probe DNA due to the weaker electrostatic repulsion.

Release ratio of probe DNA/%

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

a b c

80 60 40 20 0 0

40 80 Time/min

120

160

Figure 2. The release ratios of the probe DNA as a function of displacement time by using the perfectly matched or single-base mismatched target DNA: (a) the target DNA with single mismatched base in the middle, (b) the target DNA with single mismatched base in the end, and (c) the perfectly matched target DNA.

To verify the universality of the proposed strategy, both single-base mismatched target DNA with different location/identity and two-base mismatched target DNA are studied. More specifically, three kinds of SNPs in target DNA are considered: a) single mismatched base at different positions; b) single different mismatched base at the same position, and c) two mismatched bases. Compared with the perfectly matched target DNA, all the target DNA sequences containing mismatched bases show smaller release ratios (Table 1), suggesting that all corresponding DNA/DNA duplexes containing mismatched base-pairs exhibit weaker stability. Especially, the DNA/DNA duplex containing two mismatched base-pair shows the smallest release ratio and thus the weakest stability. In addition, the difference in release ratios for different mismatched DNA sequences suggests the successful detection of both single base/two bases mismatched sequence and the specific location of the mismatched base. These data demonstrate the good selectivity of the present sensing scheme is better than or comparable to the reported ones[10b,10d] which only detected the singlebase mismatched target DNA at different location. Althouth solid-state nanopore based sensing platform reported by Bashir et al[20] shows good selectivity toward single-stranded DNA by detecting the pulse width and blockage current of the target DNA flowing through the solid-state nanopore, it requires special location bases in mismatched target DNA. In order to analyze SNPs more clearly, we define the discrimination factor (η=β0/βm) as the ratio of the release ratio of the probe DNA with perfectly matched target DNA (β0) to the one with the stability of the probe DNA/mismatched DNA duplexes (βm). The stronger the competitive ability of mismatched DNA, and thus the smaller the discrimination factor. Table 1 shows that the mismatched DNA/DNA duplexes containing C/C or T/T

mismatched base-pairs exhibit the weaker stability than those containing T/C or T/G mismatched base-pairs, which is similar to those in the previous studies.[9c, 15] However, the stability order of the mismatched duplexes is slightly different from that in previous studies,[9c, 15] which may be ascribed to the mismatched bases with different surrounding sequences. The results indicate that the stability of a DNA/DNA duplex containing a single mismatched base depends on identities of both the mismatched bases and their surrounding base sequence. Table 1. Release ratios (β) and discrimination factors (η) for different target DNA with perfectly matched or mismatched sequences to the probe DNA (mismatched bases marked in red and underlined) Target DNA sequences

Mismatched

(5’-3’)

base-pairs

TCCAACCACCATAGCAC GATGTTAC

β/%

η

76.5

TCCAACCACCATAGCAC GATGATAC

A-A

35.8

2.14

TCCAACCACCATAGGAC GATGTTAC

G-G

39.1

1.97

TCCAACCACCATACCAC GATGTTAC

C-C

26.4

2.9

TCCAACCACCATTGCAC GATGTTAC

T-T

15.7

4.87

TCCAACCACCATCGCAC GATGTTAC

T-C

47.4

1.61

TCCAACCACCATGGCAC GATGTTAC

T-G

46

1.66

TCCAACCACCAAAGCAC GATGTTAC

A-A

30

2.55

TCCAACCACCATCCCAC GATGTTAC

T-C, C-C

4.7

16.3

In order to validate the practicality of the present strategy, the SNP detection in PML/RARα fusion gene is performed. PML/RARα fusion gene is known as a biomarker of acute promyelocytic leukemia (APL), which plays an important role in early diagnosis and treatment of the disease.[16] Figure 3 shows the steady-state currents of ferricyanide ions through the nanochannels with different modification. Compared with the perfectly target DNA (PML/RARα fusion gene) (curve d), the one with single mismatched base in the middle exhibits a smaller diffusion flux of ferricyanide ions (curve c) and thus a smaller release ratio. The discrimination factor for the single-base mismatched target DNA is calculated as 2.27. These results demonstrate the successful SNPs detection in PML/RARα fusion gene.

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 8

ACKNOWLEDGMENT This work was financially supported by the Grants from the National 973 Basic Research Program (2012CB933800), the National Natural Science Foundation of China (21035002, 21121091, 21275070, 21275071, 21205141).

REFERENCES 1

2 3

4

Figure 3. Monitoring the diffusion flux of ferricyanide ions across the functionalized PAA nanochannels: (a) morpholino modified PAA nanochannel, (b) after the hybridization of probe DNA with morpholino, (c) after the competition of target DNA with single mismatched base for the probe DNA, and (d) after the competition of the perfectly matched target DNA (PML/RARα fusion gene).

5 6

7

Conclusions In conclusion, a morpholino-modified PAA nanochannel array based competitive strategy has been proposed for the sensitive and label-free detection of SNPs by monitoring the diffusion flux of ferricyanide probe during the hybridization and competition processes. The calculated release ratio and discrimination factor are used for SNPs analysis. The different thermodynamic stability between the probe DNA/target DNA duplexes without/with mismatched base-pairs results in different release ratios and discrimination factors, which enables us to detect both single/two mismatched bases and the specific mismatched-base location. In addition, the proposed competitive strategy has been proven effective in detecting SNPs in human genetype such as PML/RARα fusion gene. The present strategy does not require the redox-labeled or fluorogen-labeled probe DNA and holds great promise for potential applications in the detection of weakly charged or uncharged molecules, clinic diagnosis and drug development.

8

9

10

ASSOCIATED CONTENT Supporting Information Detailed description of SEM image, XPS analysis, electrochemical cell setup and additional experimental data.This material is available free of charge via the Internet at http://pubs.acs.org.

11 12 13

AUTHOR INFORMATION Corresponding Author * E-mail: [email protected](X.H. Xia), Fax: (+86)-2583685947

14

Author Contributions

15

‡These authors contributed equally.

Kong, A.; Gudbjartsson D. F.; Sainz J., Jonsdottir G. M.; Gudjonsson S. A.; Richardsson, B.; Sigurdardottir, S.; Barnard J.; Hallbeck B.; Masson G. Nat. Genet. 2002, 31, 241247. Yue P.; Moult J. J. Mol. Biol. 2006, 356, 1263-1274. a) Imyanitov E. N. Hum. Genet. 2009, 125, 239-246; b) Imyanitov E. N.; Togo A. V.; Hanson K. P. Cancer Lett. 2004, 204, 3-14. Kolpashchikov D. M. J. Am. Chem. Soc. 2008, 130, 29342935. McCarthy J. J.; Hilfiker R. Nat. Biotechnol. 2000, 18, 505-508. a) Beaudet A. L., Belmont J. W. Annu. Rev. Med. 2008, 59, 113-129; b) Chen P., Pan D., Fan C. H., Chen J. H., Huang K., Wang D. F., Zhang H. L., Li Y., Feng G. Y., Liang P. J., He L., Shi Y. Y. Nat. Nanotechnol. 2011, 6, 639-644. a) Brazill S., Hebert N. E., Kuhr W. G. Electrophoresis 2003, 24, 2749-2757; b) Gaunt T. R., Hinks L. J., Rassoulian H., Day I. N. Nucleic Acids Res. 2003, 31, e48; c) Andersen P. S., Jespersgaard C., Vuust J., Christiansen M., Larsen L. A. Hum. Mutat. 2003, 21, 455-465. a) Stoermer R. L., Cederquist K. B., McFarland S. K., Sha M. Y., Penn S. G., Keating C. D. J. Am. Chem. Soc. 2006, 128, 16892-16903; b) Okamoto A., Ichiba T., Saito I. J. Am. Chem. Soc. 2004, 126, 8364-8365; c) Cao Y. C., Jin R., Mirkin C. A. Science 2002, 297, 1536-1540; d) Graham D., Thompson D. G., Smith W. E., Faulds K. Nat. Nanotechnol. 2008, 3, 548551; e) Huh Y. S., Lowe A. J., Strickland A. D., Batt C. A., Erickson D. J. Am. Chem. Soc. 2009, 131, 2208-2213; f) Xiao Y., Plakos K. J., Lou X., White R. J., Qian J., Plaxco K. W., Soh H. T. Angew. Chem. Int. Edit. 2009, 48, 4354-4358; g) Duan X., Li Z., He F., Wang S. J. Am. Chem. Soc. 2007, 129, 4154-4155. a) Liu G., Lin Y. J. Am. Chem. Soc. 2007, 129, 10394-10401; b) Liu G., Lee T. M., Wang J. J. Am. Chem. Soc. 2005, 127, 38-39; c) Xiao Y., Lou X., Uzawa T., Plakos K. J., Plaxco K. W., Soh H. T. J. Am. Chem. Soc. 2009, 131, 15311-15316. a) Howorka S., Cheley S., Bayley H. Nat. Biotechnol. 2001, 19, 636-639; b) Kohli, P.; Harrell, C. C.; Cao Z., Gasparac R., Tan W., Martin C. R. Science 2004, 305, 984-986; c) Zhao Q., Sigalov G., Dimitrov V., Dorvel B., Mirsaidov U., Sligar S., Aksimentiev A., Timp G. Nano Lett. 2007, 7, 1680-1685; d) Yang S. Y., Son S., Jang S., Kim H., Jeon G., Kim W. J., Kim J. K. Nano Lett. 2011, 11, 1032-1035. Kasianowicz J. J., Brandin E., Branton D., Deamer D. W. Proc. Natl. Acad. Sci, U.S.A 1996, 93, 13770-13773. Martin C. R., Siwy Z. S. Science 2007, 317, 331-332. a) Chen W., Wu Z. Q., Xia X. H., Xu J. J., Chen H. Y. Angew. Chem. Int. Ed. 2010, 49, 7943-7947; b) Li S. J., Li J., Wang K., Wang C., Xu J. J., Chen H. Y., Xia X. H., Huo Q. ACS Nano 2010, 4, 6417-6424; c) Yu J. C., Zhang L. Q., Xu X., Liu S. Q. Anal. Chem. 2014, 86, 10741-10748; d) de la Escosura-Muniz, A.; Merkoçi, A. Small 2011, 7, 675-682. Kim W. J., Sato Y., Akaike T., Maruyama A. Nat. Mater. 2003, 2, 815-820. a) FrutosA. G., Pal S., Quesada M., Lahiri J. J. Am. Chem. Soc. 2002, 124, 2396-2397; b) Aboul-ElaF., Koh D., Tinoco I., Martin F. H. Nucleic Acids Res. 1985, 13, 4811-4824; c) Ikuta S., Takagi K., Wallace R. B., Itakura K. Nucleic Acids Res. 1987, 15, 797-811.

ACS Paragon Plus Environment

Page 7 of 8 16

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

17 18 19 20

Analytical Chemistry a) Lin L., Liu Q., Wang L., Liu A., Weng S., Lei Y., Chen W., Lin X., Chen Y. Biosens. Bioelectron. 2011, 28, 277-283; b) Zhong G., Liu A., Chen X., Wang K., Lian Z., Liu Q., Chen Y., Du M., Lin X. Biosens. Bioelectron. 2011, 26, 3812-3817. Vlassiouk I., Krasnoslobodtsev A., Smirnov S., Germann M. Langmuir 2004, 20, 9913-9915. Schoch R. B., Han J., Renaud P. Rev. Mod. Phys. 2008, 80, 839. Yu J. C., Luo P. C., Xin C. X., Cao X. D., Zhang Y. J., Liu S. Q. Anal. Chem. 2014, 86, 8129-8135. Iqbal S. M., Akin, D., Bashir, R. Nat nanotechnol. 2007, 2, 243-248.

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 ACS Paragon Plus Environment

Page 8 of 8