mTORC2 in Cell Adhesion

Subscriber access provided by University of South Dakota

Article

Quantitative proteomics implicates Rictor/mTORC2 in cell adhesion HAO WANG, Xianfeng Shao, Qian He, Chunqing Wang, Linhuan Xia, Dan Yue, Guoxuan Qin, Chenxi Jia, and Ruibing Chen J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.8b00218 • Publication Date (Web): 29 Aug 2018 Downloaded from http://pubs.acs.org on August 30, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Quantitative proteomics implicates Rictor/mTORC2 in cell adhesion Hao Wang1, #, Xianfeng Shao2, #, Qian He3, #, Chunqing Wang1, Linhuan Xia1, Dan Yue4, Guoxuan Qin5, Chenxi Jia6 and Ruibing Chen1, * 1. Department of Genetics, School of Basic Medical Sciences, Tianjin Medical University, Tianjin 300070, P.R. China. 2. Tianjin Medical University Eye Hospital, Eye Institute &School of Optometry and Ophthalmology, Tianjin, 300384, P.R. China. 3. Tianjin Medical University General Hospital, Tianjin 300052, P.R. China. 4. School of Medical Laboratory, Tianjin Medical University, Tianjin 300070, China. 5. School of Microelectronics, Tianjin University, Tianjin 300072, P.R. China. 6. National Center for Protein Sciences-Beijing, State Key Laboratory of Proteomics, Beijing Proteome Research Center, Beijing Institute of Radiation Medicine, Beijing, 102206, P.R. China. #

These authors contribute equally to this study.

*Correspondence to: Dr. Ruibing Chen, [email protected], Phone: 86-022-83336531, Fax: 86-022-83336560, Department of Genetics, School of Basic Medical Sciences, Tianjin Medical University, Tianjin 300070, China.

1

ACS Paragon Plus Environment

Journal of Proteome Research 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT The mammalian target of rapamycin complex 2 (mTORC2) plays critical roles in various biological processes. To better understand the functions of mTORC2 and the underlying molecular mechanisms, we established a stable cell line depleted of Rictor, a specific component in mTORC2, and investigated the quantitative changes of the cellular proteome. As a result, we observed that 101 proteins were down-regulated and 50 proteins were up-regulated in Rictor knockdown cells. A protein-protein interaction network regulated by Rictor/mTORC2 was established, showing that Rictor/mTORC2 was involved in various cellular processes. Intriguingly, gene ontology analysis indicated that the proteome regulated by Rictor/mTORC2 was significantly involved with cell adhesion. Rictor knockdown affected the expressions of multiple cell adhesion associated molecules, e. g. integrin α-5 (ITGA5), transforming growth factor beta-1-induced transcript 1 protein (TGFB1I1), lysyl oxidase homolog 2 (LOXL2), etc. Further study suggested that Rictor/mTORC2 may regulate cell adhesion and invasion by modulating the expressions of these cell adhesion molecules through AKT. Taken together, this study maps the proteome regulated by Rictor/mTORC2, and reveals its role in promoting renal cancer cell invasion through modulating cell adhesion and migration.

Key Words, Rictor, mTORC2, Akt, cell adhesion, TMT labeling, quantitative proteomics, mass spectrometry, gene expression, renal cancer, cell migration

2


Page 2 of 40

Page 3 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION The mammalian target of rapamycin (mTOR) plays important roles in many biological processes involved in various diseases, such as cancer, diabetes, obesity, cardiovascular disease, among many others.1,2 mTOR can form two distinct multi-component protein complexes, including a Raptor containing rapamycin-sensitive mTORC1 complex and a Rictor containing rapamycin-insensitive mTORC2 complex.3, 4 mTORC1 is a central regulator of intracellular and extracellular signaling, and controls cell growth, proliferation, survival, and metabolism.1-3 Meanwhile, mTORC2 plays important roles in cell growth and proliferation.4 In addition, mTORC2 promotes the activation of protein kinase B (PKB/Akt) signaling by phosphorylating Akt at Ser473 and regulates cell migration by modulating the dynamics of the actin cytoskeleton.5-7 mTORC2 has been associated with tumorigenesis and progression of many different types of cancer.4 For example, Rictor deletion was reported to profoundly delay tumorigenesis in pancreatic cancer.8 Rictor knockdown could also inhibit progression and metastasis of breast cancer.9,10 Currently, targeting mTOR is one of the major anti-cancer drug development strategies for cancer treatment, with many mTOR kinase inhibitors in preclinical and clinic trials.11,12 However, these studies have met with great challenges because of the drug resistance caused by feedback activation of the PI3K-Akt pathway. To overcome such obstacle, it is crucial to further clarify the underlying molecular mechanisms of the actions of mTOR. Treatment with a dual mTORC1/2 inhibitor may effectively suppress tumorigenesis for rapamycin 3



insensitive cancers and increase survival.8,13,14 Furthermore, recent cancer biology studies indicate that mTORC2 may be a promising target for effective cancer treatment, and it is possible to avoid the mTORC1- dependent negative feedback loops by specifically targeting mTORC2.15 Therefore, a comprehensive understanding of the biological functions and molecular mechanisms of mTORC2 would facilitate the development of new cancer therapy strategies with high efficacy. To further understand the biological roles of mTORC2, we studied the overall proteome changes induced by Rictor knockdown in renal cancer cells by TMT based quantitative proteomics. The results provide a comprehensive understanding of the potential biological functions of Rictor/mTORC2, suggesting its roles in multiple cellular activities, such as cell adhesion, matrix organization, cellular metabolism, etc. Interestingly, the proteome associated with Rictor were highly involved with cell adhesion. Furthermore, the function of Rictor/mTORC2 in the regulation of cell adhesion and invasion was explored by cell assays.

4


Page 4 of 40

Page 5 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


EXPERIMENTAL PROCEDURES Antibodies and reagents Rabbit polyclonal antibody against Rictor was from Cell Signaling Technology (Danvers, MA, USA). Rabbit monoclonal antibodies against lysyl oxidase homolog 2 (LOXL2) and junction plakoglobin (JUP) were purchased from Abcam (Cambridge, MA, USA). Rabbit polyclonal antibody against protein CYR61, integrin α-5 (ITGA5), and transforming growth factor beta-1-induced transcript 1 (TGFB1I1) were bought from Proteintech (Chicago, IL, USA). Mouse monoclonal antibody against β-actin was purchased from Santa Cruz (Santa Cruz, CA, USA). Lipofectamine 2000, BCA reagents, Protein A magnetic beads, ProLong® Gold anti-fade reagents were purchased from Invitrogen (Grand Island, NY, USA). Enhanced chemiluminescence reagents were purchased from Millipore (Billerica, MA, USA). Matrigel matrix was purchased from Corning (Corning, NY, USA). Bovine fibronectin was purchased from R&D Systems (Minneapolis, MN, USA). Recombinant human epidermal growth factor (EGF) was purchased from Peprotech (Rocky Hill, NJ, USA). Protease Inhibitor Cocktail tablets were purchased from Roche Diagnostics (Indianapolis, IN, USA). Dithiothreitol (DTT), iodoacetamide (IAA), and urea were from Sigma (St. Louis, MO, USA). Sequencing grade modified trypsin was purchased from Promega (Madison, WI, USA). TMT sixplexTM isobaric label reagents, high pH reversed-phase peptide fractionation kit, and quantitative colorimetric peptide assay kit were purchased from ThermoFisher Scientific (Waltham, MA, USA). Acetonitrile was from Merck (White-house Station, NJ, USA). Water used in this study was deionized 5



using a Milli-Q purification system (Millipore, Billerica, MA, USA). Akt inhibitor A-674563 was purchased from MedChemExpress (Monmouth Junction, NJ, USA).

RNA isolation and quantitative real-time PCR (qRT-PCR) Total RNA was isolated from the cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and complementary DNA (cDNA) was synthesized using a FastQuant RT kit (TianGen, Beijing, China) according to the manufacturer's instructions. Quantitative mRNA expression analysis targeting gene and the reference gene was performed on a 7500 Fast Real-Time PCR System (ABI, Foster City, CA, USA) using the SuperReal SYBR Green PreMix (TianGen, Beijing, China) following the manufacturer’s protocol. The primer sequences used in this study were listed in Supplemental Table S1.

Cell culture, shRNA and transfection The ACHN cells were obtained from the American Type Culture Collection. The cells were cultured in the Minimum Essential Medium (MEM) supplemented with 10% fetal bovine serum (FBS) and 1% glutamine Pen-Strep solution at 37oC and 5% CO2. For Rictor knockdown, a shRNA (shRictor-Sense: 5′-CCGGTACTTGTGAAGAATCGTATCTTCTCGAGAAGATACGATTCTTCACA AGTTTTTTG-3′; shRictor-Antisense: 5′-AATTCAAAAAACTTGTGAAGAATCGT ATCTTCTCGAGAAGATACGATTCTTCACAAGTA-3′) expression plasmid and a control vector containing a scrambled (scr) sequence were inserted into the pLKO.1-puro plasmid individually. HEK 293T cells were transfected with the 6


Page 6 of 40

Page 7 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


plasmids using LipofectamineTM 2000. The culture supernatant was harvested 48 h after transfection and centrifuged at 1000 rpm for 5 min to remove cellular debris. For stable clones, ACHN cells were infected with the collected lentivirus. Five days later, puromycin was added into the culture medium at a final concentration of 20 ng/mL. Drug-resistant clones were collected and expanded. The expression levels of Rictor in the studied cells were evaluated using Western blotting and qRT-PCR.

Protein extraction and TMT labeling Cells were disrupted using 8M urea solution in 50mM TEAB supplemented with 1 mM NaF, 1 mM Na3VO4 and protease inhibitor cocktail, and the cell debris was removed by centrifugation at 16, 000 rcf for 30 min. Cellular proteins were quantified using BCA assay. The proteins were reduced by 10 mM DTT for 30 min at 37 oC and alkylated by 40 mM IAA for 45 min at room temperature in dark, and then the proteins were diluted with 50 mM TEAB and digested with trypsin by protease: protein ratio of 1:50 at 37 oC overnight. The digested peptides were further quantified using quantitative peptide assay. For proteomics analysis, 50 µg of tryptic peptides from three biological replicates of control cells were labeled with 0.4 mg of 126、127、 128 TMT tags, and 50µg of tryptic peptides from three biological replicates of shRictor cells were labeled with 0.4 mg of 129、130 and 131 tags, respectively. After incubated for 1 h at room temperature, the reaction was quenched by adding 5% hydroxylamine, and the six samples were mixed and dried with Savant SpeedVac (ThermoFisher Scientific). The mixed sample was resuspended in water and fractionated into eight fractions by a high pH reversed-phase peptide fractionation kit 7



(ThermoFisher Scientific) following the manufacturer’s instructions.

LC-MS/MS and data analysis The TMT labeled samples were analyzed by a Q Exactive HF mass spectrometer (ThermoFisher Scientific), which was accompanied with an Easy-nLC 1,000 system (ThermoFisher Scientific). About 500 ng peptides were loaded onto a 100 µm×2 cm C18 trap column (particle size 3 µm, SunChrom, Friedrichsdorf, Germany) and separated on a 150 µm×15 cm self-packed C18 analytical column (particle size 1.9 µm, SunChrom) using a 5-35% B gradient (mobile phase A: 0.1% formic acid in water; mobile phase B: 0.1% formic acid in acetonitrile) over 66 min. The mass scan range was set from 300 to 1,400 m/z. The full MS resolution was set as 120,000. The AGC target was set as 3E6 and the maximum injection time was set as 80 ms. The mass spectrometer was operated in the data-dependent mode with the 20 most abundant ions (charge state z ≥ 2) selected for higher-energy collision dissociation (HCD) fragmentation with 27% normalized collision energy. The isolation window for MS/MS was set as 1.6 m/z. The MS/MS spectra were acquired with 15,000 resolution, 5E4 AGC, and 20 ms maximum injection time. For the TMT quantitative analysis, Proteome Discoverer 1.4 (ThermoFisher Scientific) was used to process the MS raw data. Peak list was generated and searched with Sequest HT against the Uniprot human protein database (release December 2016) containing 129,499 sequence entries. Peptide and fragment ion mass tolerance was set to 15 ppm and 0.05 Da respectively. Carbamidomethyl cysteine and TMT 6plex labeling was set as fixed modification, and oxidized methionine was set as a variable 8


Page 8 of 40

Page 9 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


modification. Trypsin was selected as the enzyme with up to three missed cleavage sites. The false discovery rate (FDR) was set to 1% for peptide identifications, and two or more peptides were required for protein identification. The ratios between 126/126, 127 /126, 128 /126, 129 /126, 130 /126, and 131/126 were calculated. Only unique peptides were employed for quantification. ANOVA was employed for statistical analysis, and P < 0.05 was considered as statistically significant. The proteomic data has been deposited to the ProteomeXchange Consortium via the PRIDE16 partner repository with the dataset identifier PXD008356.

Bioinformatic analysis Principal component analysis (PCA) was performed by the Past 3 software. The heatmap containing the 151 proteins identified with expression changes was constructed by R package pheatmap (http://www.r-project.org). Gene ontology (GO) annotation information was acquired through DAVID database analysis (https://david.ncifcrf.gov/). Known protein-protein interactions (PPIs) were retrieved from the String 10.5 (https://string-db.org/) and integrated in the Cytoscape 3.1.1 for network construction. Gene set enrichment analysis (GSEA) was performed with GSEA 3.0 software (http://www.gsea-msigdb.org/gsea/index.jsp)17 and the Molecular Signatures Database (MSigDB) GO biological process category (c5.bp.v6.1.symbols.gmt) was used for GSEA. The enrichment map of the 151 proteins with expression changes was visualized by a Cytoscape application Enrichment Map18 with P < 0.05, FDR < 0.25, and similarity overlap coefficient > 0.26 as cutoff values. Transcription factor binding sites (TFBSs) analysis were 9



conducted by R package gProfileR.19

Western blotting Cells were harvested and lysed with Triton X-100 buffer (40 mM Tris, 120 Mm NaCl, 1% Triton X-100, 1 mM NaF, and 1 mM Na3VO4). The cell lysates were centrifuged at 13, 000 rpm at 4 oC for 30 min and the pellets were removed. The total protein concentrations of the cell lysates were measured with the BCA assay. Proteins were resolved by SDS-PAGE, and transferred to the Immobilon-P membrane (0.45µm pore size, Millipore). Primary antibodies were incubated with the membranes at 4°C overnight in 5% skim milk (BD Biosciences, San Jose, CA, USA). Blots were later developed by enhanced chemiluminescence by using horseradish peroxidase–conjugated secondary antibody (Santa Cruz Biotechnology). β-actin was used as the internal standard for cell lysates.

Cell adhesion assay The adhesion assay was performed in 35 mm plates. The plates were pre-coated with 1 mL of fibronectin (5 µg/mL) at 4°C overnight. Then, cells were seeded into the coated plates at a density of 105 cells/well with or without EGF (50 mg/mL), then allowed to adhere at 37°C for 5 min. Non-adherent cells were washed off with PBS, and the adherent cells were fixed in 4% paraformaldehyde and stained by Richard-AllanTM Scientific Three-Step stain kit (ThermoFisher Scientific). The adherent cells were photographed and counted under microscope.

Wound healing and invasion assays 10


Page 10 of 40

Page 11 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In the wound healing assay, cells were seeds in 6-well plates and grown to 80-90% confluence. The cells were scratched with a pipette tip in the middle of the plate, and then washed with PBS to remove the detached cells. Then, the plates were incubated in MEM containing 1% FBS. The wound closure was monitored microscopically at different time-points (0, 3, 6, 9, 12, 24 h) and photographed at 0 and 24 h respectively. Invasion assay was performed using Matrigel-coated transwell inserts (Millipore) containing polycarbonate membranes with 8 µm pores. Serum starved cells were trypsinized and counted. Then 5×104 cells in serum-free medium were added to the upper chamber, and 600 µL of MEM supplemented with 10% FBS was added to the lower chamber. After incubated for 24 h at 37°C, non-migrating cells on the upper membrane surface were removed with a cotton swab. The migrating cells on the under surface were fixed and stained Richard-AllanTM Scientific Three-Step stain kit (ThermoFisher Scientific). The migrating cells were counted in 6 random regions at 200× under microscope.

Statistical evaluation Statistical analyses were performed using the SPSS version 17.0 software. For the comparisons, student’s t-test was performed. All statistical tests were two-sided and P values < 0.05 were considered as statistically significant.

11



RESULTS AND DISCUSSION Quantitative analysis of protein expression regulated by Rictor/mTORC2. Rictor is a specific component of mTORC2 as compared with mTORC1. A number of studies demonstrate that Rictor is required for the assembly, stability, substrate recognition and subcellular localization of mTORC2.4 Knockdown or knockout of Rictor has been widely applied to investigate the functions of mTORC2.20,21 To further decipher the biological roles of mTORC2, we knocked down Rictor from ACHN renal cancer cells using shRictor lentivirus, and investigated its effect on the cellular proteome. Western blotting and qRT-PCR confirmed that Rictor was efficiently down-regulated in the ACHN-shRictor cells as compared with the control cells transfected with vector containing a scrambled sequence (Supplemental Fig. S1). We first evaluated the reproducibility of the mass spectrometric analysis by analyzing a TMT labeled ACHN cell extract sample twice. As shown in Supplemental Fig. S2, the two technical replicates were highly similar to each other (R2=0.97). Next, we investigated the cellular protein expression changes induced by Rictor knockdown employing a TMT based quantitative proteomics strategy (Fig. 1). PCA showed that the data from Scr and shRictor cells formed two different clusters on the basis of protein expression profile (Fig. 2A). Overall, 4864 proteins were quantified, and majority of these proteins were observed with no expression changes as shown in the volcano plot (Fig. 1B). By using P value < 0.05 and fold change > 1.5 as threshold, 50 proteins were observed to be up-regulated in Rictor knockdown cells, and 101 proteins were down-regulated (Fig. 2B, 2C and Supplemental Table S2). Several 12


Page 12 of 40

Page 13 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


transcriptomic or proteomic studies on tissues lacking Rictor have been reported previously.22-24 These studies were performed using genetic modified mice with Rictor depleted specifically in different tissues, including muscle, liver, and adipose tissues, and a number of differently expressed genes were identified to be potentially regulated by Rictor/mTORC2 (Supplemental Table S3). Glutaminase kidney isoform (GLS) identified in this study to be down-regulated in ACHN-shRictor cells was also observed to be reduced in the mice muscle with Rictor knockout,22 but no other overlaps were observed. Interestingly, none of the previous studies showed any similarities between each other in their results, suggesting that the role of mTORC2 in regulating gene expression may be highly specific in different types of cells or tissues.

Biological functions of the proteins regulated by Rictor/mTORC2 Systematic gene ontology analysis was performed using the DAVID database (P < 0.01 as cutoff). The analysis revealed that reduction of Rictor could affect the expressions of many genes involved with a number of cellular processes. In addition, the up-regulated and down-regulated proteins were involved with highly different biological processes. The biological process analysis indicated that many of the down-regulated proteins induced by Rictor knockdown were related to cell adhesion. The other significantly involved biological processes included protein folding, matrix organization, collagen catabolic process, etc. Only one biological process, neutral amino acid transport, was observed to be significantly associated with the up-regulated proteins (Fig. 3A). Three molecules associated with amino acid transport were detected to be up-regulated in Rictor knockdown cells, i. e. neutral amino acid 13



transporter B (SLC1A5), 4F2 cell-surface antigen heavy chain (SLC3A2), and large neutral amino acids transporter small subunit 1 (SLC7A5). For protein class analysis, the down-regulated proteins were involved with protein binding, integrin binding, collagen binding, etc, and the up-regulated proteins were related to neutral amino acid transmembrane transporter activity (Fig. 3B). Functions as a kinase for the Akt pathway, mTORC2 has been well known for its role in the regulation of cytoskeleton.5-7 In this study, multiple cytoskeleton associated proteins were observed to be down-regulated in Rictor knockdown cells, e. g. gelsolin (GSN) dihydropyrimidinase-related protein 3(DPYSL3), etc, suggesting Rictor/mTORC2 may also be involved with cytoskeleton organization through regulating gene expression. Meanwhile, it is surprising that several up-regulated proteins induced by Rictor knockdown are involved with cellular metabolism. mTORC1 has been long recognized as the central modulator of cellular metabolism in cancer; however, the studies regarding mTORC2 in this area are quite limited. A recent study shows that mTORC2 is involved in amino acid metabolism through phosphorylation of the cystine-glutamate antiporter xCT.25 Our study provides a new evidence for the involvement of Rictor/mTORC2 in the process of amino acid metabolism via regulating the expressions of multiple amino acid transporters. Moreover, GSEA was employed to investigate the cellular processes that were activated or deactivated by Rictor/mTORC2. Enrichment map nodes associated with down-regulated proteins included cell adhesion, extracellular structure organization, cell death, etc (Fig. 3C). GSEA terms associated with up-regulated proteins clustered 14


Page 14 of 40

Page 15 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in small molecule metabolism, lipid metabolism and anion transport (Fig. 3C). Several studies have implicated mTORC2 in lipid metabolism,26-28 and it’s been proposed that mTORC2 may regulate lipid metabolism through its downstream substrate Akt.29 GSEA network in this study shows the enrichment of Rictor regulated genes in lipid metabolism, providing a new clue to further understand the function of Rictor/mTORC2 in lipid metabolism and to unveil the underlying molecular mechanisms. The PPIs between these proteins regulated by Rictor/mTORC2 was obtained from the STRING database, and the PPI network was constructed using Cytoscape. As shown in Fig.4, a highly connected network composed of 108 protein nodes and 203 connections was mapped (disconnected nodes were not shown). Based on GO analysis and information from Uniprot protein database, these proteins can be grouped into seven sub-clusters, including gene expression, cytoskeleton organization, cell division and proliferation, cell adhesion and cell matrix organization, etc. Majority of the proteins in the “cytoskeleton organization” and “cell adhesion and cell matrix organization” sub-clusters were down-regulated upon Rictor knockdown, suggesting a positive regulatory role of mTORC2 in the regulation of these two processes. The established PPI network provides a comprehensive view of the various biological functions of Rictor/mTORC2.

Rictor/mTORC2 regulates the expressions of multiple cell adhesion associated molecules GO analysis showed that the proteome regulated by Rictor/mTORC2 was highly 15



involved with cell adhesion. Multiple proteins involved with cell adhesion were down-regulated in Rictor knockdown cells as detected by TMT quantitative proteomics (Fig. 4). To validate the mass spectrometric results, Western blotting was performed to examine the expression levels of five cell-adhesion-related proteins, including JUP, TGFB1I1, LOXL2, ITGA5 and CYR61. The results showed that all these five proteins were down-regulated in Rictor knockdown cells consistent with the quantitative proteomics data (Fig. 5A). qRT-PCR analysis indicated that these cell adhesion related molecules were all significantly reduced at mRNA levels in Rictor knockdown cells (Fig. 5A), suggesting that Rcitor/mTORC2 may regulate the expressions of these proteins through transcription and/or RNA processing. TFBSs analysis of the differently expressed genes by using g:Profiler showed that many of the down-regulated proteins, such as JUP, TGFB1I1, LOXL2, ITGA5 and CYR61, may be regulated by several transcription factors, such as early growth response (EGR1) (Supplemental Table S4). The studied proteins play very important roles in the regulation of cell adhesion. For example, LOXL2 is a muli-functional protein, when secreted into the extracellular matrix, promotes cross-linking of extracellular matrix proteins by mediating oxidative deamination of peptidyl lysine residues in fibrous collagen and elastin precursors.30 Overexpression of LOXL2 in a number of different cancers promotes tumor progression through enhancing the epithelial to mesenchymal transition (EMT) process.31,32 Therefore, LOXL2 is considered as a potential therapeutic target against tumor progression.30,31 Integrins are transmembrane receptors that facilitate both 16


Page 16 of 40

Page 17 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cell-cell and cell-ECM adhesion.33,34 Integrins are heterodimers formed by α and β subunits, and each subunit has a number of isoforms depending on the cell type.33 Upon ligand binding, integrins activate signal transduction pathways that mediate various cellular processes. The quantitative proteomic analysis showed the expressions of multiple integrin isoforms were down-regulated upon Rictor depletion (Fig. 4 and Supplemental Table. S2), suggesting integrins as major targets for Rictor/mTORC2 to exert its functions as cell adhesion regulator. The results from mass spectrometric analysis and Western blotting indicated that Rictor/mTORC2 may be involved in the regulation of cell adhesion through modulating the expression levels of different cell adhesion molecules. To confirm such hypothesis, we examined the adhesion of ACHN cells to the fibronectin coated surface. The results showed that down-regulation of Rictor significantly suppressed both the basal and EGF-stimulated cell-ECM adhesion (Fig. 5B). Since Akt is one of the most important downstream substrates of mTORC2,2,7 we further investigated whether mTORC2 may regulate the expressions of cell adhesion associated genes through Akt by testing the effects of Akt inhibitors on ACHN cells. Treatment with Akt inhibitor MK-2206 or Akt-inhibitor VIII reduced the phosphorylation of Akt at S473, the phosphorylation site regulated by mTORC2 (Fig. 5C). In addition, the five cell adhesion associated molecules down-regulated in shRictor cells were also reduced with Akt inhibition (Fig. 5C). Furthermore, inhibition of Akt also suppressed both the basal and EGF-stimulated cell-ECM adhesion (Fig. 5D). The results showed that the inhibition of Akt had similar effects as observed for 17



Rictor knockdown, and Rictor/mTORC2 may regulate the transcriptions of the cell adhesion associated molecules through Akt. A number of other signaling molecules have been known to be phosphorylated by mTORC2 besides Akt, e.g. protein kinase C α (PKCα), serum/glucocorticoid-regulated kinase (SGK), glycogen synthase kinase 3 β (GSK3β).2 It has been reported that PKCα could phosphorylate several cell adhesion related molecules, such as fascin, integrins and syndecans.35, 36 It’s likely that mTORC2 may affect cell adhesion through regulating the crosstalk between multiple downstream pathways, and the detailed molecular mechanism requires further investigation. Taken together, this study demonstrates Rictor/mTORC2 is involved in cell adhesion in renal cancer cells and reveals the underlying mechanisms whereby it regulates cell adhesion via modulating the expressions of multiple cell adhesion associated molecules. Alterations in the expression or function of cell adhesion associated molecules have been implicated in all steps of tumor progression, including EMT transformation, detachment of tumor cells from the primary site, intravasation and malignant cell attachment to foreign tissue.37, 38 Our results suggest that the modulation of cell adhesion may be an important mechanism whereby Rictor/mTORC2 regulates cancer progression.

Rictor/mTORC2 modulates cell migration and invasion To further evaluate the functions of Rictor/mTORC2 in renal cancer cells, we examined its role in the regulation of cell migration, another important characteristic of cancer cells that contributes to metastasis. The wound healing assay showed that 18


Page 18 of 40

Page 19 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


knockdown of Rictor greatly reduced the migratory ability in ACHN cells (Fig. 6A). Furthermore, knockdown of Rictor significantly reduced the invasiveness of the studied cells as measured by the invasion assay (Fig. 6B). Metastasis is a major hallmark for malignancy, and it refers to the spread of tumor cells from their primary site to other parts of the body. During metastasis, cytokines stimulate the intravasation of tumor cells from primary sites into circulation and mediates their extravasation to the secondary sites where new cell adhesion is established. Metastasis is a complex biological process that requires the dynamic regulation of cell migration and cell adhesion. Our results suggest that Rictor/mTORC2 affects gene expressions of multiple cell adhesion associated proteins through Akt, and enhances cancer cell invasion through the regulation of both cell adhesion and migration (Fig.6C).

19



Conclusions In this study, we applied quantitative proteomics to study the cellular proteome regulated by Rictor/mTORC2. The results presented here provide a comprehensive view of mTORC2 functions and highlight its potential roles in various cellular activities such as amino acid metabolism. In addition, the quantitative proteomic analysis implicates Rictor/mTORC2 in the regulation of cell adhesion via affecting the expressions of multiple cell adhesion associated molecules. The overexpression of mTORC2 in cancer cells may facilitate their migration and adhesion to the secondary sites, which in turn contribute to tumor invasion and metastasis. This study reveals the biological functions of Rictor/mTORC2 in cell adhesion, and further confirms its role as a potential drug target to treat cancer metastasis.

20


Page 20 of 40

Page 21 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


SUPPORTING INFORMATION The following supporting information is available free of charge at ACS website http://pubs.acs.org. Table S1. Sequences of the DNA primers used for qRT-PCR. Table S2. List of the identified differently expressed proteins. Table S3. List of genes reported to be affected by Rictor knockout in mice tissues. Table S4. Transcription factors associated with the identified differentially expressed genes as predicted by g:Profiler. Figure S1. Validation of Rictor knockdown in the ACHN renal cancer cell line. Figure S2. Evaluation of the reproducibility of the mass spectrometric analysis.

ACKNOWLEDGMENTS This work is supported by National Natural Science Foundation of China (21575103 and 81772945), National Key Research and Development Program (2016YFC0900100), Tianjin Natural Science Foundation (18JCYBJC25200), Young Elite Scientists Sponsorship Program by Tianjin (TJSQNTJ-2017-10), and National Students’ Innovation and Entrepreneurship Training Program.

Author Contributions R.C. designed the study and supervised the research; H.W. carried out the molecular and cellular biology experiments with assistance from D. Y., C.W., Q.H. and L. X; X.S. performed the mass spectrometric analyses; X.S., G.Q., and R.C. analyzed the 21



results and performed the bioinformatics analysis; C. J. supervised the mass spectrometric experiments.

Competing Financial Interests Statement The authors declare no competing financial interests.

22


Page 22 of 40

Page 23 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES 1.

Cornu, M.; Albert, V.; Hall, M. N. mTOR in aging, metabolism, and cancer. Curr Opin Genet Dev. 2013, 23, 53-62.

2.

Saxton, R. A.; Sabatini, D. M. mTOR signaling in growth, metabolism, and disease. Cell. 2017, 168, 960-76.

3.

Kim, D. H.; Sarbassov, D. D.; Ali, S. M.; King, J. E.; Latek, R. R.; ErdjumentBromage, H.; Tempst, F.; Sabatini, D. M. mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell. 2002,110, 163–75.

4.

Kim, L. C.; Cook, R. S.; Chen, J. mTORC1 and mTORC2 in cancer and the tumor microenvironment. Oncogene. 2017, 36, 2191-201.

5.

Sarbassov, D. D.; Ali, S. M.; Kim, D. H.; Guertin, D. A.; Latek, R. R.; Erdjument-Bromage, H.; Tempst, P.; Sabatini, D. M. Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptorindependent pathway that regulates the cytoskeleton. Curr. Biol. 2004, 14, 1296–302.

6.

Jacinto, E.; Loewith, R.; Schmidt, A.; Lin, S.; Ruegg, M. A.; Hall, A.; Hall, M. N. Mammalian tor complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat. Cell Biol. 2004, 6, 1122–8.

7.

Jacinto, E.; Facchinetti, V.; Liu, D.; Soto, N.;Wei, S.; Jung, S. Y.; Huang, Q.; Qin, J.; Su, B. SIN1/MIP1 maintains rictor mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell. 2006, 127, 125–37.

8.

Driscoll, D. R.; Karim, S. A.; Sano, M.; Gay, D. M.; Jacob, W.; Yu, J.; Mizukami, 23



Y.; Gopinathan, A.; Jodrell, D. I.; Evans, T. R.; Bardeesy, N.; Hall, M. N.; Quattrochi, B. J.; Klimstra, D. S.; Barry, S. T.; Sansom, O. J.; Lewis, B. C.; Morton, J. P. mTORC2 signaling drives the development and progression of pancreatic cancer. Cancer Res. 2016, 76, 6911-23. 9.

Morrison Joly, M.; Hicks, D. J.; Jones, B.; Sanchez, V.; Estrada, M. V.; Young, C.; Williams, M.; Rexer, B. N.; Sarbassov dos, D.; Muller, W. J.; Brantley-Sieders, D.; Cook, R. S. Rictor/mTORC2 drives progression and therapeutic resistance of ER2-amplified breast cancers. Cancer Res. 2006, 76, 4752-64.

10. Zhang, F.; Zhang, X.; Li, M.; Chen, P.; Zhang, B.; Guo, H.; Cao, W.; Wei, X.; Cao, X.; Hao, X.; Zhang, N. TOR complex component Rictor interacts with PKCzeta and regulates cancer cell metastasis. Cancer Res. 2010, 70, 9360-70. 11. Janes, M. R.; Vu, C.; Mallya, S.; Shieh, M. P.; Limon, J. J.; Li, L. S.; Jessen, K. A.; Martin, M. B.; Ren, P.; Lilly, M. B.; Sender, L. S.; Liu, Y.; Rommel, C.; Fruman, D. A. Efficacy of the investigational mTOR kinase inhibitor MLN0128/ INK128 in models of B-cell acute lymphoblastic leukemia. Leukemia. 2013, 27, 586–94. 12. Bhagwat, S. V.; Gokhale, P. C.; Crew, A. P.; Cooke, A.; Yao, Y.; Mantis, C.; Kahler, J.; Workman, J.; Bittner, M.; Dudkin, L.; Epstein, D. M.; Gibson, N. W.; Wild, R.; Arnold, L. D. Preclinical characterization of OSI-027, a potent and selective inhibitor of mTORC1 and mTORC2: distinct from rapamycin. Mol. Cancer Ther. 2011, 10, 1394–406. 13. Kawata, T.; Tada, K.; Kobayashi, M.; Sakamoto, T.; Takiuchi, Y.; Iwai, F.; 24


Page 24 of 40

Page 25 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Sakurada, M.; Hishizawa, M.; Shirakawa, K.; Shindo, K.; Sato, H.; Takaori-Kondo, A. Dual inhibition of the mTORC1 and mTORC2 signaling pathways is a promising therapeutic target for adult T-cell leukemia. Cancer Sci. 2018, 109,103-11. 14. Miyahara, H.; Yadavilli, S.; Natsumeda, M.; Rubens, J.A.; Rodgers, L.; Kambhampati, M.; Taylor, I.C.; Kaur, H.; Asnaghi, L.; Eberhart, C.G.; Warren, K.E.; Nazarian, J.; Raabe, E.H. The dual mTOR kinase inhibitor TAK228 inhibits tumorigenicity and enhances radiosensitization in diffuse intrinsic pontine glioma. Cancer Lett. 2017, 400, 110-16. 15. Zou, Z.; Chen, J.; Yang, J.; Bai, X. Targeted inhibition of Rictor/mTORC2 in cancer treatment: a new era after rapamycin. Curr. Cancer Drug Targets. 2016, 16, 288-304. 16. Vizcaíno, J. A.; Csordas, A.; del-Toro, N.; Dianes, J. A.; Griss, J.; Lavidas, I.; Mayer, G.; Perez-Riverol, Y.; Reisinger, F.; Ternent, T.; Xu, Q. W.; Wang, R.; Hermjakob, H. 2016 update of the PRIDE database and related tools. Nucleic Acids Res. 2016, 44, D447-D456. 17. Subramanian, P.; Tamayo, P.; Mootha, V. K.; Mukherjee, S.; Ebert, B. L.; Gillette, M. A.; Paulovich, A.; Pomeroy, S. L.; Golub, T. R.; Lander, E. S.; Mesirov, J. P. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA. 2015, 102, 15545–50. 18. Merico, D.; Isserlin, R.; Stueker, O.; Emili, A.; Bader, G. D. Enrichment map: a 25



network-based method for gene-set enrichment visualization and interpretation. PLoS ONE. 2010, 5, e13984. 19. Reimand, J.; Arak, T.; Adler, P.; Kolberg, L.; Reisberg, S.; Peterson, H.; Vilo, J. g:Profiler-a web server for functional interpretation of gene lists (2016 update). Nucleic Acids Res. 2016, 44, W83-89. 20. Hung, C. M.; Calejman, C. M.; Sanchez-Gurmaches, J.; Li, H.; Clish, C. B.; Hettmer, S.; Wagers, A. J.; Guertin; D. A. Rictor/mTORC2 loss in the Myf5 lineage reprograms brown fat metabolism and protects mice against obesity and metabolic disease. Cell Rep. 2014, 8, 256-71. 21. Thomanetz, V.; Angliker, N.; Cloëtta, D.; Lustenberger, R. M.; Schweighauser, M.; Oliveri, F.; Suzuki, N.; Rüegg, M. A. Ablation of the mTORC2 component rictor in brain or Purkinje cells affects size and neuron morphology. J Cell Biol. 2013, 201, 293-308. 22. Kleinert, M.; Parker, B. L.; Chaudhuri, R.; Fazakerley, D. J.; Serup, A.; Thomas, K. C.; Krycer, J. R.; Sylow, L.; Fritzen, A. M.; Hoffman, N. J.; Jeppesen, J.; Schjerling, P.; Ruegg, M. A.; Kiens, B.; James, D.E.; Richter, E. A. mTORC2 and AMPK differentially regulate muscle triglyceride content via Perilipin 3. Mol Metab. 2016, 5, 646-55. 23. Lamming, D. W.; Demirkan, G.; Boylan, J. M.; Mihaylova, M. M; Peng, T.; Ferreira, J.; Neretti, N.; Salomon, A.; Sabatini, D. M.; Gruppuso, P. A. Hepatic signaling by the mechanistic target of rapamycin complex 2 (mTORC2). FASEB J. 2014, 28, 300-15. 26


Page 26 of 40

Page 27 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


24. Shimobayashi, M.; Albert, V.; Woelnerhanssen, B.; Frei, I. C.; Weissenberger, D.; Meyer-Gerspach, A. C.; Clement, N.; Moes, S.; Colombi, M.; Meier, J. A.; Swierczynska, M. M.; Jenö, P.; Beglinger, C.; Peterli, R.; Hall, M. N. Insulin resistance causes inflammation in adipose tissue. J Clin Invest. 2018, 128, 1538-50. 25. Gu, Y.; Albuquerque, C. P.; Braas, D.; Zhang, W.; Villa, G. R.; Bi, J.; Ikegami, S.; Masui, K.; Gini, B.; Yang, H.; Gahman, T. C.; Shiau, A. K.; Cloughesy, T. F.; Christofk, H. R.; Zhou, H.; Guan, K. L.; Mischel, P. S. mTORC2 regulates amino acid metabolism in cancer by phosphorylation of the cystine-glutamate antiporter xCT. Mol. Cell. 2017, 67, 128-38. 26. Tang, Y.; Wallace, M.; Sanchez-Gurmaches, J.; Hsiao, W. Y.; Li, H.; Lee, P. L.; Vernia, S.; Metallo, C. M.; Guertin, D. A. Adipose tissue mTORC2 regulates ChREBP-driven de novo lipogenesis and hepatic glucose metabolism. Nat. Commun. 2016, 7, 11365. 27. Berchtold, D.; Piccolis, M.; Chiaruttini, N.; Riezman, I.; Riezman, H.; Roux, A.; Walther, T. C.; Loewith, R. Plasma membrane stress inducesrelocalization of Slm proteins and activation of TORC2 to promote sphingolipid synthesis. Nat. Cell Biol. 2012, 14, 542–47. 28. Muir, A.; Ramachandran, S.; Roelants, F. M.; Timmons, G.; Thorner, J. TORC2-dependent protein kinase Ypk1 phosphorylates ceramide synthase to stimulate synthesis of complex sphingolipids. Elife. 2014, 3, doi: 10.7554/eLife.03779. 27



29. Hagiwara, A., Cornu, M., Cybulski, N., Polak, P., Betz, C., Trapani, F., Terracciano, L., Heim, M.H., Rüegg, M.A., Hall, M.N. Hepatic mTORC2 activates glycolysis and lipogenesis through Akt, glucokinase, and SREBP1c. Cell Metab. 2012, 15, 725-38.

30. Nishioka, T.; Eustace, A.; West, C. Lysyl oxidase: from basic science to future cancer treatment. Cell Struct. Funct. 2012, 37, 75-80. 31. Wu, L.; Zhu, Y. The function and mechanisms of action of LOXL2 in cancer. Int. J. Mol. Med. 2015, 36, 1200-4. 32. Nguyen, L.T.; Song, Y.W.; Cho, S.K. Baicalein inhibits epithelial to mesenchymal transition via downregulation of Cyr61 and LOXL-2 in MDA-MB231 breast cancer cells. Mol Cells. 2016, 39, 909-14. 33. Wolfenson, H.; Lavelin, I.; Geiger, B. Dynamic regulation of the structure and functions of integrin adhesions. Dev Cell. 2013, 24, 447-58. 34. De Franceschi, N.; Hamidi, H.; Alanko, J.; Sahgal, P.; Ivaska, J.; Integrin traffic the update. J Cell Sci. 2015, 128, 839-52. 35. Anilkumar, N.; Parsons, M.; Monk, R.; Ng, T.; Adams, J. C. Interaction of fascin and protein kinase C alpha: a novel intersection in cell adhesion and motility. EMBO J. 2003, 22, 5390-402. 36. Morgan, M.R.; Humphries, M.J.; Bass, M.D. Synergistic control of cell adhesion by integrins and syndecans. Nat Rev Mol Cell Biol. 2007, 8, 957-69.

37. Makrilia, N.; Kollias, A.; Manolopoulos, L.; Syrigos, K. Cell adhesion molecules: role and clinical significance in cancer. Cancer Invest. 2009, 27, 1023-37. 28


Page 28 of 40

Page 29 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


38. Li, D. M.; Feng, Y. M. Signaling mechanism of cell adhesion molecules in breast cancer metastasis: potential therapeutic targets. Breast Cancer Res. Treat. 2011, 128, 7-21.

29



Figure Legends Figure 1. The quantitative proteomic workflow employed in this study. The cellular protein expression regulated by Rictor/mTORC2 was analyzed by TMT labeling quantitative proteomics.

Figure 2. Quantitative analysis of the proteome of ACHN cells regulated by Rictor/mTORC2. A. PCA clustering of protein expression in the ACHN-shRictor cells and the corresponding control cells. B. Volcano plot illustrates proteins with statistically significant abundance differences in Rictor knockdown cells. The log2 fold change was plotted on the x-axis and the -log10 P-value was plotted on the y-axis. C. Heatmap of the identified proteins with expression changes in Rictor knockdown cells.

Figure 3. Gene ontology (GO) analysis of the proteome regulated by Rictor/mTORC2. Biological processes (A) and protein classes (B) associated with the identified proteins with abundance changes induced by Rictor knockdown. The annotation information was acquired through analysis using the DAVID database (https://david.ncifcrf.gov/). C. Enrichment map of gene set enrichment analysis (GSEA) of identified proteins with expression changes, node size represents the number of components identified within a gene set and the width of the line is proportional to the overlap between related gene sets. GSEA terms associated with

30


Page 30 of 40

Page 31 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


up-regulated (red) and down-regulated (blue) proteins are colored accordingly and grouped into nodes with associated terms.

Figure 4. The protein-protein interaction network regulated by Rictor/mTORC2. Known protein-protein interactions were acquired through String 10.5 database (https://string-db.org/) and integrated in the Cytoscape 3.1.1 for network construction. Proteins and their interactions were shown as nodes and edges, and proteins without connections were not shown. Proteins up-regulated were shown in red and proteins down-regulated were shown in blue. The identified proteins were grouped based on their known biological functions.

Figure 5. Rictor/mTORC2 modulates the expressions of multiple cell adhesion associated proteins. A. Protein expression validation by Western blotting and qRT-PCR. Left panel: heatmap for the proteins with abundance changes between ACHN-shRictor cells and scr control cells as measured by TMT quantitative proteomics. Middle panel: Western blots of the five cell adhesion associated proteins showing reduced expressions in Rictor knockdown cells. β-actin was used as loading control. Right panel: the relative mRNA levels of the five cell adhesion molecules as detected by qRT-PCR. 18S rRNA was used as internal standard. B. Knockdown of Rictor reduced adhesion of ACHN cell to fibronectin coated surface under normal and EGF-stimulated conditions. Ctrl, control. The right panel shows the histogram plotting the means ± SD of triplicate independent analyses (by Student's t-test, ** 31



P

mTORC2 in Cell Adhesion

Recommend Documents