Multifunctional Oligonucleotide-Functionalized Conjugated Oligomer

Subscriber access provided by McMaster University Library

Article

Multifunctional oligonucleotide-functionalized conjugated oligomer nanoparticles for targeted cancer cell imaging and therapy Lingyun Du, Jiangyan Zhang, Xuange Zhang, Yaru Li, Qi Jiang, Yonggang Wu, and Yongqiang Cheng ACS Appl. Bio Mater., Just Accepted Manuscript • DOI: 10.1021/acsabm.9b00035 • Publication Date (Web): 08 Feb 2019 Downloaded from http://pubs.acs.org on February 8, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Bio Materials

Multifunctional oligonucleotide-functionalized conjugated oligomer nanoparticles for targeted cancer cell imaging and therapy Lingyun Du, Jiangyan Zhang*, Xuange Zhang, Yaru Li, Qi Jiang, Yonggang Wu*, Yongqiang Cheng* Key Laboratory of Medicinal Chemistry and Molecular Diagnosis, Ministry of Education, Key Laboratory of Analytical Science and Technology of Hebei Province, College of Chemistry and Environmental Science, Hebei University, Baoding, 071002, P. R. China

ACS Paragon Plus Environment

1

ACS Applied Bio Materials 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 26

ABSTRACT A novel and multifunctional oligonucleotide-functionalized conjugated oligomer nanoparticle (CON) is developed for effective cancer cell imaging and therapy by integration of fluorescence imaging, target recognition, photodynamic therapy (PDT), and chemotherapy. The CON itself possesses the high fluorescence emission efficiency for imaging and can generate reactive oxygen species for PDT. Due to its excellent biocompatibility, easy functional modification, and efficient drug loading and release ability, oligonucleotide enable CON to be functionalized in many forms. For the target recognition, the CONs are functionalized with oligonucleotides labeled with folate molecule, which can specifically bind the CONs to the tumor cells overexpressing folate receptors. Moreover, the designed oligonucleotide on the CON hybridizes with its complementary sequence to form double-stranded DNA, which enables a sequence-specifically loading with doxorubicin for chemotherapy. For different situations, the therapy of chemotherapy and PDT can be used solely or combinatorially. Therefore, this study provides a facile strategy for the multifunctional modification of CONs with oligonucleotides and opens a new avenue for targeted cell imaging and tumor treatment.

KEYWORDS

Conjugated

oligomer

nanoparticles;

Oligonucleotide

functionalization;

Fluorescence imaging; Photodynamic therapy; Chemotherapy


2

Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Due to the unique photoelectric and physicochemical properties, fluorescent nanomaterials have been studied widely and applied in cancer cell imaging and therapy.1-3 Several nanostructures such as gold nanoclusters, quantum dots (QDs), and upconversion nanoparticles (UCNPs) showed significant potential for imaging and killing of cells because of their tunable fluorescence emission, high photostability, and photoexcited therapy characteristics.4-7 However, these metal-based nanomaterials have some limitations in biochemical and biomedical researches resulting from their low emission rates, poor biocompatibility, and intrinsic toxicity caused by leaching of heavy metal ions.8,9 Alternatively, fluorescent organic nanoparticles have attracted intense interest owing to their unique optoelectronic properties, simple synthesis procedures, and easy separation steps.10-12 Currently, conjugated polymer nanoparticles (CPNs) have been widely developed with the high brightness, excellent photostability, low cytotoxicity, and versatile surface modification.13-16 More recently, conjugated oligomer nanoparticles (CONs) were demonstrated to have the high fluorescent quantum yields, drug delivery ability, stability and surface modification features similar to CPNs.17-19 CONs are prepared by the small molecular monomers, which are easy to be synthesized and purified with well-defined molecular weight as compared with those polymeric monomers of CPNs.19 Therefore, CONs with unique conjugated structures and properties provide great potential for bioimaging and therapy. It is desired to further develop the CONs-based multifunctional materials for extending their biomedical applications.


3


Page 4 of 26

In general, poly(ethylene glycol) (PEG) is mostly used for functional modification of organic nanoparticles to improve the biocompatibility and increase the function of organic nanoparticles.12 In contrast to the PEG, oligonucleotide has more advantages for the modification of nanomaterials.20 First, oligonucleotides are apt to provide the targeted functional group by folding into unique conformation structures or conjugating with multiple functional molecules, such as folate and antibody.21,22 Second, some particular oligonucleotides can be designed with embedding some anticancer drugs, such as Protoporphyrin IX (PpIX) and doxorubicin (Dox).23-25 Third, oligonucleotide can be synthesized controllably and degraded by enzymes, which facilitate drugs loading and release. However, there are few reports on oligonucleotide modification of organic nanoparticles. It is of great significance to study oligonucleotide functionalization of CONs and its related applications. Herein, we develop a multifunctional oligonucleotide-functionalized CON that possesses

four

capacities

including

fluorescence

imaging,

target

recognition,

photodynamic therapy (PDT), and chemotherapy (Figure 1). The CONs themselves possess the high fluorescence emission efficiency for imaging and can generate reactive oxygen species (ROS), which can kill adjacent tumour cells by PDT. For the targeted cancer cell imaging, we design the oligonucleotide-functionalized CONs labeled with folate molecule (Oli-CON-FA), which can specifically bind to folate receptors overexpressed in cancer cells. Moreover, another oligonucleotide sequence with GCGC bases is designed complementary to the oligonucleotide linked to CONs. The two oligonucleotides hybridize with each other to form double-stranded DNA (dsDNA), which enables an anticancer drug Dox to be inserted into the GCGC base pairs for


4

Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


chemotherapy. Benefited from the oligonucleotide functionalization, the Oli-CON-FA with multiple functions can be applied to cell targeting, imaging and PDT as well as chemotherapy.

Figure 1. (a) Schematic illustration of preparation of the Oli-CON-FA:Dox and the multiple function of Oli-CON-FA:Dox. (b) The structures of BFTB, PSMA and Dox. 2. MATERIAL AND METHODS 2.1 Materials


5


Page 6 of 26

Poly (styrene-co-maleic anhydride), cumene terminated (PSMA), dimethyl sulfoxide (DMSO), MES,

N-(3-dimethylamino-prophy)-1-ethylcarbodiimide

hydrochloride

(EDC),

N-

hydroxysuccinimide (NHS) were purchased from Sigma-Aldrich. 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium

bromide

(MTT) was purchased from Beyotime Institute of Biotechnology. Doxorubicin hydrochloride (Dox), mPEG-amine (PEG-NH2, 95%, average M.W. 5000), tetrahydrofuran (THF, 99.5%) were purchased from J&K. 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA), SYTOX@Blue dye were purchased from Thermo Fisher. The sequences of the oligonucleotides were listed in Table 1. All the oligonucleotides were synthesized by Takara Biotechnology Co., Ltd. (Dalian, China). Dulbecco’s Modified Essential Medium (DMEM), fetal bovine serum (FBS), trypsin and Dulbecco’s phosphate-buffered saline without calcium and magnesium (DPBS) were purchased from HyClone. Milli-Q water was supplied by a Milli-Q system. PBS (pH 12) for the EDC/NHS coupling reaction was prepared by Na2HPO412H2O (100 mM), NaH2PO42H2O (100 mM), NaCl (100 mM), and NaOH. Table 1. The oligonucleotides used in this experiment. Oligonucleotides

Sequences (5-3)

NH2-oligo-FA

NH2-TCAGTAAGGTCAGCGCAATCGGAACACT-FA

NH2-oligo

NH2-TCAGTAAGGTCAGCGCAATCGGAACACT

Comp-oligo

GTTCCGATTGCGCTGACCTTAC

Note. FA and oligo represented folate molecular and oligonucleotide, respectively. Comp-oligo was the complementary oligonucleotide. 2.2 Characterization


6

Page 7 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Transmission electron micrographs (TEM) were obtained with an electron microscope (Tecnai G2 F20 S-TWIN, FEI, USA). Dynamic light scattering (DLS) measurements were carried out on a Dynamic light scattering instrument (ZEN3700, Malvern, UK). The UV–vis spectra were obtained via UV–visible spectrophotometer (UV-1901, Beijing Purkinje General Instrument Co. Ltd., Beijing, China). The fluorescence emission spectra were measured by a FS5 fluorescence spectrometer (Edinburgh, UK). Images of treated cells were captured by Olympus FV1000 confocal laser scanning microscope (Olympus, Tokyo, Japan). 2.3 Preparation of CONs The CONs with carboxyl groups were prepared according to previously reported reprecipitation method.11 First, conjugated oligomer 4,7-bis(2-9,9,9,9-tetraoctyl-9H,9H-2,2bifluorene-2-yl-5-thienyl)-2,1,3-benzothiadiazole (BFTB) was synthesized as described in Supplementary Information. BFTB and PSMA were dissolved in THF to make a stock solution with a concentration of 1 mg mL−1, respectively. Subsequently, the PSMA solution and BFTB solution were diluted and mixed in THF to produce a 5 mL mixture with BFTB concentration of 50 g mL−1 and PSMA concentration of 20 g mL−1. Next, the mixture was sonicated for 1 min to form a homogeneous solution and rapidly poured into 10 mL Milli-Q water in a vigorous bath sonicator. Subsequently, through introducing nitrogen to the system continually, the solution was concentrated to 5 mL on a 90 °C hotplate following by filtration through a 0.22 µm syringe filter (Millipore, USA). Then, the CONs were filtered by 50 KD centrifugal filter (Millipore, USA) and diluted to 5 mL, where the concentration was about 50 g mL−1. Last, the CONs were diluted to an optical density OD=1 at 375 nm (1 cm optical path) and the concentration was about 32 g mL−1. The CONs dispersions were clear and stable for 3 months without aggregation. 2.4 Conjugation of the CONs with oligonucleotide


7


Page 8 of 26

250 L of freshly-prepared EDC solution (5 mg mL−1 in MES buffer) and 50 L of freshlyprepared NHS solution (5 mg mL−1 in MES buffer) were added to 1 mL CONs (32 g mL−1) and shaken for 60 min on a vortex. Then 660 L of PBS (pH 12) for the EDC/NHS coupling reaction was added to adjust the pH to 8. Afterward, 20 L of PEG-NH2 (80 M) and 20 L of NH2oligonucleotide-folate (20 M) or 20 L of NH2-oligonucleotide (20 M) or 20 L sterile water was added to the mixture. Subsequently, the mixture solution reacted on a vortex for 4 h. Finally, we used centrifugal filter (100 KD) to remove the unreacted NH2-oligonucleotide-folate or NH2oligonucleotide. 2.5 Dox loading in Oli-CON-FA with complementary oligonucleotide Different amount of Dox and 20 L of complementary oligonucleotide (20 M) were added into Oli-CON-FA solution with a volume of 4 mL, where the final concentration of Oli-CON-FA was 8 g mL−1. The concentration of complementary oligonucleotide was 100 nM, and the concentration of Dox was 25 nM, 50 nM, 100 nM, 250 nM, 500 nM, 1000 nM, respectively. Then the system was incubated for 30 min on a vortex at 37 °C. Finally, we used centrifugal filter (100 KD) to separate unloaded complementary oligonucleotide and Dox. The fluorescence intensity of unloaded Dox were measured by fluorescence spectrophotometer. 2.6 Cell culture The A549 human lung cancer cells were cultured in DMEM medium containing 10% FBS, 100 IU mL-1 penicillin and 100 g mL−1 streptomycin, and then incubated at 37 °C with 5% CO2. Before experiment, the cells were pre-cultured until confluence was reached 80%. 2.7 Cells imaging in vitro Firstly, three groups of A549 cells were put on a confocal dish and cultured at 37 °C with 5% CO2. When the density of A549 was up to 80%, Oli-CON-FA and DMEM were added into


8

Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


experimental group where the finally concentration of Oli-CON-FA was 8 g mL−1. In the control experiment, the CON conjugated with NH2-oligonucleotide (Oli-CON) and DMEM were added into control group and the finally concentration of Oli-CON was also 8 g mL−1, and 1000 L DMEM was added into blank group. The cells were cultured for 1 h at 37 °C with 5% CO2. Before imaging, the cells were washed twice by 1x DPBS buffer to remove unreacted bioconjugates. Last, three groups were imaged at same conditions using an Olympus FV1000 confocal laser-scanning microscope (CLSM). 2.8 Cell viability assay of PDT for cells 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays were used to assess the activity of A549 cells. A549 cells were incubated in 96-well plates at an intensity of 100,000 cells mL−1. Then the A549 cells were incubated for 24 h with 10% FBS at 37 °C. Then old medium was replaced by DMEM with 8 g mL−1 Oli-CON or 8 g mL−1 Oli-CON-FA. Following co-incubation for 1 h at 37 °C, being washed by 1x DPBS and reincubated in 1 mL DMEM containing 10% FBS, cells were exposed to the xenon lamp at fluence rate of 10 mW cm−2 for 30 min. Then 10 L of freshly prepared MTT solution (5 mg mL−1) were added into each well and further incubated for 4 h at 37 °C. Subsequently, the MTT medium solution was removed carefully, 100 L DMSO was added into each well and the plate was shaken gently to dissolve all the precipitates. The absorbance of MTT at 520 nm was monitored using a microplate reader. 2.9 CLSM imaging of PDT for cells Firstly, four groups of A549 cells were put on a confocal dish and cultured at 37 °C with 5% CO2 until the density of A549 was up to 80%. Cells were treated with Oli-CON (group b) or Oli-CON-FA (group c and d) and the finally concentration of CON bioconjugates was all 8 g


9


Page 10 of 26

mL−1. Group a was untreated as control. The cells were cultured for 1 h at 37 °C, and then washed twice by 1x DPBS, and the old medium was replaced by 1 mL DMEM containing 10% FBS. Subsequently, group b and d were exposed to xenon lamp at fluence rate of 10 mW cm−2 for 30 min. After irradiation, 0.2 L SYTOX@Blue dye (5 mM) was added into each group with finally concentration of 1 M, respectively. Then, four groups were cultured at 37 °C for 20 min. Before imaging, the cells were washed twice by 1x DPBS buffer to remove excessive SYTOX@Blue dye. Last, four groups were imaged at same conditions using an Olympus FV1000 CLSM. 2.10 Chemotherapy of Oli-CON-FA:Dox for cells A549 cells were incubated in 96-well plates at an intensity of 100,000 cells mL−1. Then the A549 cells were incubated for 24 h with 10% FBS at 37 °C. For the optimization of coincubation time with nanoparticle, media were replaced with media containing 8 g mL−1 OliCON-FA or 8 g mL−1 Oli-CON-FA with 500 nM Dox. The cells were incubated at 37 °C for different time. For the optimization of the amount of Dox, media were replaced with media containing 8 g mL−1 Oli-CON-FA with different concentration of Dox. The cells were incubated at 37 °C for 8 h. After co-incubation with nanoparticle, 10 L of freshly prepared MTT solution (5 mg mL−1) were added into each well and further incubated for 4 h at 37 °C. Subsequently, the MTT medium solution was removed carefully, 100 L DMSO was added into each well and the plate was shaken gently to dissolve all the precipitates. The absorbance of MTT at 520 nm was monitored using a microplate reader. 3 RESULTS AND DISCUSSION 3.1 Preparation and characterization of the CONs


10

Page 11 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


We first synthesized a conjugated fluorene oligomer that consisted of two thienyl and four fluorene units connected by a 2,1,3-benzothiadiazole core (BFTB, Figure 1b). The oligomer showed excellent absorbance and fluorescence emission (Figure S1) and could perfectly dissolve in nonpolar solvents THF. The CONs were prepared with the BFTB and amphiphilic PSMA by the reprecipitation method. During nanoparticles formation, the hydrophobic polystyrene backbones in PSMA are most embedded inside the CONs while the hydrophilic functional carboxyl groups extend outside into the aqueous environment. Therefore, the prepared CONs are water-soluble with the functional carboxyl groups on the nanoparticle surface. The size and morphology of the CONs were characterized by DLS and TEM. The hydrodynamic diameter of CONs is about 50 nm in aqueous solution (Figure S2a). TEM shows that the CONs have a spherical morphology with size from 20 to 30 nm (Figure S2b), which is lower than hydrodynamic diameter in aqueous solution by DLS. The difference in diameters measured by DLS and TEM is attributed to the different surface states of the samples under the test conditions. Figure S2c shows that the prepared CONs have two typical absorption maxima at 375 nm and 527 nm, respectively, and a maximum fluorescence emission at 655 nm with a fluorescence quantum yield (20%). The ROS generation ability of CONs was evaluated using the 2,7dichlorodihydrofluorescein diacetate (DCFH-DA) under light irradiation (Figure S2d). Although DCFH itself undergoes self-oxidation by air to some extent, the fluorescence intensity from DCFH with CONs (Line 4) is much higher than that from DCFH (Line 3). The results indicate that CONs can generate ROS, which oxidizes DCFH to DCF with the strong fluorescence emission (Figure S2d). 3.2 Oligonucleotide functionalization of CONs


11


Page 12 of 26

To construct the multifunctional CONs, NH2-terminated oligonucleotide labeled with folate was conjugated onto the surface of the CONs through the EDC/NHS coupling reaction between amino group of NH2-oligonucleotide and carboxylic acid of CONs to obtain Oli-CON-FA. As a comparison, NH2-terminated oligonucleotide without folate was used to obtain Oli-CON. PEG-NH2 was all introduced to reduce non-specific protein adsorption. To prove that the CONs were modified by oligonucleotide, we measured the Zeta () potentials of the CONs with different molecules modification. As shown in Table S1, the  potential of CONs with PEG only was measured with 15.90.7 mV, originated from the carboxyl groups on the surface of CONs. By comparison, the  potential value 30.80.9 mV of Oli-CON was obviously lower than that of CONs, suggesting that oligonucleotides with negative charges were linked to the surface of CONs. Moreover, Oli-CON-FA showed the more negative  potential value 31.81.1 mV in comparison with Oli-CON, owing to the introduction of folate molecule. In addition, the oligonucleotide in Oli-CON-FA was designed specifically with GC bases. Then after adding

the

complementary

oligonucleotide,

the

Oli-CON-FA

could

load

the

chemotherapy drug Dox to form Oli-CON-FA:Dox through the intercalative binding of Dox with two base pairs GC in dsDNA. We demonstrated that 8 g mL−1 Oli-CON-FA can load 500 nM Dox (Figure S3). 3.3 Targeted cell imaging of Oli-CON-FA Despite the nanoparticles can be delivered into cells by cell endocytosis, the amount of nanoparticles is usually tremendous, leading to the nonspecific interaction with different cells and side-effect. Therefore, researchers pay more attention to the targeted cell imaging and therapy by using some targeted functional groups, such as specific antibody,


12

Page 13 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


streptavidin and folate, etc.21,22 Herein, in view of the oligonucleotide-modified CONs, we chose folate as the targeted molecule labeled in the oligonucleotide (Oli-CON-FA) for targeting folate receptor on human lung cancer A549 cells. As shown in Figure 2, similar to A549 cells without any treatment (Figure 2a), the A549 cells with Oli-CON shows no fluorescence signal of CON (Figure 2b), indicating that Oli-CON cannot bind to A549 in the absence of folate. In contrast, the fluorescence signal of CON is distinctly observed for the A549 cells with Oli-CON-FA, indicating that the Oli-CON-FA bind specifically to the folate receptor of A549 cells (Figure 2c). These results show that the oligonucleotidemodified CONs can achieve the targeted imaging of cancer cells, which lays the foundation for targeted cell killing.


13


Page 14 of 26

Figure 2. The CLSM imaging of A549 cells treated with oligonucleotide-modified CONs with or without folate. (a) Cells only; (b) Cells treated with Oli-CON. [Oli-CON]= 8 g mL-1; (c) Cells treated with Oli-CON-FA. [Oli-CON-FA]= 8 g mL-1; Scale bars, 40 μm. 3.4 Photodynamic therapy of Oli-CON-FA


14

Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Dose response of Oli-CON-FA for cell viabilities. (a) without irradiation. The concentration of Oli-CON-FA was 1, 2, 4, 8, 16, 32 g mL-1, respectively. Co-incubation time: 24 h. (b) under light irradiation. The concentration of Oli-CON-FA was 0.5, 1, 2, 4, 8 g mL-1, respectively. Co-incubation time: 1 h. Light irradiation: 10 mW cm-2 for 30 min. Error bars were obtained from three replicate measurements. Moreover, as the CONs can generate ROS under light irradiation, it is desirable to use Oli-CON-FA for targeted PDT. To test the PDT capability of Oli-CON-FA, cell viability analysis against A549 cells was performed by using standard MTT method. As shown in Figure 3a, without light irradiation, the lethality of 8 g mL−1 Oli-CON-FA was very little even A549 cells were co-incubated with Oli-CON-FA for 24 h, indicating that OliCON-FA themselves have little cytotoxicity and good biocompatibility in dark. In the following experiment, A549 cells were co-incubated with no more than 8 g mL−1 OliCON-FA for 1 h and then irradiated by using xenon lamp. As shown in Figure 3b, under light irradiation with the optimal experimental conditions (Figure S4 and S5), the cell viability keeps nearly 100% for Oli-CON-FA at 0.5 g mL−1. With the increasing of the


15


Page 16 of 26

concentration of Oli-CON-FA from 0.5 to 8 g mL−1, the cell viability decreases gradually. When the concentration of Oli-CON-FA is 8 g mL−1, the survival percentage is about 20%. In addition, we found that with extending the co-incubation time of OliCON-FA to 2 h, the cell viability decreased (Figure S6). We infer that Oli-CON-FA can bind to the cells via the specific recognition of folate and folate receptor, and with the extension of the co-incubation time, more Oli-CON-FA enter the cells via endocytosis, resulting in more killing of the cells. Furthermore, The PDT effect of Oli-CON-FA was checked by CLSM imaging as well. As shown in Figure 4, the A549 cells treated with Oli-CON (Figure 4b) under light irradiation show the same fluorescence response as the A549 cells without any treatment (Figure 4a). This is ascribed to the fact that Oli-CON without folate can hardly couple with A549 cells and then the ROS produced by Oli-CON under light irradiation cannot damage cells. It is also testified that this light irradiation does not affect cell growth. For the A549 cells with Oli-CON-FA treatment (Figure 4c), the red fluorescence from CONs is clearly observed. However, the blue fluorescence from a SYTOX@Blue dye, which is a nucleus dye for labeling the dead cells, is not found. This result suggests that the cells keep liveness and are not damaged by certain amount of Oli-CON-FA without light irradiation even if Oli-CON-FA can bind to A549 cells. In comparison, both the red fluorescence from CONs and the blue fluorescence from SYTOX@Blue dye are obviously observed under irradiation (Figure 4d). These results show that Oli-CON-FA can damage cancer cells under light irradiation, indicating that Oli-CON-FA has the targeted PDT effect.


16

Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. CLSM imaging of A549 cells. (a) Cells without any treatment; (b) Cell treated with Oli-CON upon light irradiation; (c) Cell treated with Oli-CON-FA without irradiation; (d) Cell treated with Oli-CON-FA upon light irradiation. [Oli-CON-FA]= 8 g mL-1. Light irradiation: 10 mW cm-2 for 30 min. 3.5 Chemotherapy of Oli-CON-FA:Dox


17


Dox is an effective chemotherapeutic agent that inhibits DNA replication.25,

Page 18 of 26

26

However, some cancer cells are resistant to drug efflux, resulting in low intracellular drug accumulation.27, 28 For circumventing Dox resistance, nanoparticle-based delivery system provides an alternative strategy.29,

30

In this study, we conjugated oligonucleotide with

GC base with the CONs to load Dox, and the prepared Oli-CON-FA:Dox can be used for the Dox-based chemotherapy. As shown in Figure 5a, at different co-incubation time, the cell viability of A549 cells treated with Oli-CON-FA without Dox kept about 100% activity. In contrast, the cell viability of A549 cells treated by Oli-CON-FA with Dox decreased gradually to 42% from 1 h to 8 h, indicating that the Dox in Oli-CON-FA:Dox is released and achieves the cell killing. Figure 5b shows that the cell viability of A549 cell decreases gradually with the increase of the concentration of Dox in Oli-CONFA:Dox, suggesting that Oli-CON-FA:Dox has the dose-dependent cell killing effects. Chemotherapy and PDT are different therapeutic method with two distinctively different and supplementing mechanisms. The Dox-based chemotherapy can kill cancer cells through inhibiting nucleic acid synthesis. However, Dox is nearly noneffective to cells with efflux pump resistance.31 PDT leads to a direct physical damage through ROS under irritation and can play roles not only in the cells but also on the cell surface. PDT has broad spectrum anti-cancer ability, but generally limited by the penetration depth of light source.32 The combination of chemotherapy and PDT maybe make up for the deficiency and enhance the cell sensitivity of each other. For different situations, the therapy of chemotherapy and PDT can not only used solely, but also used combinatorially for better therapeutic efficacy.


18

Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. (a) Cell viabilities with Oli-CON-FA with and without Dox in the different coincubation time. [Oli-CON-FA]= 8 g mL-1. Dox concentration: 500 nM. (b) Dose response of Dox for cell viabilities of Oli-CON-FA with Dox. [Oli-CON-FA]= 8 g mL-1. Co-incubation time: 8 h. 4. CONCLUSION In summary, we report a novel and multifunctional Oli-CON-FA system for performing fluorescence imaging, cancer cell targeting recognition, PDT, and chemotherapy. The CONs show distributed small size of 50 nm in aqueous solution with the strong fluorescence emission for imaging. Under light irradiation, the CONs are able to generate ROS efficiently for PDT. Due to the good biocompatibility, easy functional modification, and efficient drug loading and release ability of oligonucleotide, the prepared Oli-CONFA exhibited excellent targeting ability toward cancer cells overexpressing folate receptor. Moreover, after Dox loading, Oli-CON-FA:Dox also has chemotherapy ability. Thus, the prepared CON possesses the multifunctional characteristics for carrying out cell killing, including PDT, chemotherapy, and maybe combination of PDT and chemotherapy. As a result, this study demonstrates a kind of multifunctional Oli-CON for


19


Page 20 of 26

targeted fluorescence imaging and therapy and provides a new strategy for the development of the CON-based multifunctional materials and drug delivery systems for diagnosis and treatment of cancer. ASSOCIATED CONTENT The Supporting Information is available free of charge on the ACS Publications website. Experimental Section; The absorption and emission spectra of BFTB oligomer; The characterization of CONs; Zeta (ζ) Potential of CONs with different modification; Investigation of the Dox loading behavior; Optimization of illumination time; Optimization of illumination intensity; The influence of co-incubation time. AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]. Tel: (+86)312-5079403. Fax: (+86) 312-5079403. *E-mail: [email protected]. *E-mail: [email protected]. ORCID Yongqiang Cheng: 0000-0002-9569-9517 Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. ACKNOWLEDGMENT


20

Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


This work was supported by the National Natural Science Foundation of China (21475031, 21605034 and 21474026), the Natural Science Foundation of Hebei Province (B2016201031, B2017201184 and B2018201049). REFERENCES (1) Jiang, S.; Gnanasammandhan, M. K.; Zhang, Y. Optical Imaging-Guided Cancer Therapy with Fluorescent Nanoparticles. J. R. Soc. Interface 2009, 7, 3–18. (2) Yao, J.; Yang, M.; Duan, Y. Chemistry, Biology, and Medicine of Fluorescent Nanomaterials and Related Systems: New Insights into Biosensing, Bioimaging, Genomics, Diagnostics, and Therapy. Chem. Rev. 2014, 114, 6130–6178. (3) Davis, M. E.; Chen, Z.; Shin, D. M. Nanoparticle Therapeutics: an Emerging Treatment Modality for Cancer. Nature Rev. Drug Discov. 2008, 7, 771–782. (4) Liu, K.; Liu, X.; Zeng, Q.; Zhang, Y.; Tu, L.; Liu, T.; Kong, X.; Wang, Y.; Cao, F.; Lambrechts, S. A. G.; Aalders, M. C. G.; Zhang, H. Covalently Assembled NIR Nanoplatform for Simultaneous Fluorescence Imaging and Photodynamic Therapy of Cancer Cells. ACS Nano 2012, 6, 4054–4062. (5) Huang, P.; Lin, J.; Wang, S.; Zhou, Z.; Li, Z.; Wang, Z.; Zhang, C.; Yue, X.; Niu, G.; Yang, M.; Cui, D.; Chen, X. Photosensitizer-Conjugated Silica-Coated Gold Nanoclusters for Fluorescence Imaging-Guided Photodynamic Therapy. Biomaterials 2013, 34, 4643–4654. (6) Tao, Y.; Li, M.; Ren, J.; Qu, X. Metal Nanoclusters: Novel Probes for Diagnostic and Therapeutic Applications. Chem. Soc. Rev. 2015, 44, 8636–8663.


21


Page 22 of 26

(7) Trofymchuk, K.; Reisch, A.; Shulov, I.; Mély, Y.; Klymchenko, A. S. Tuning the Color and Photostability of Perylene Diimides Inside Polymer Nanoparticles: towards Biodegradable Substitutes of Quantum Dots. Nanoscale 2014, 6, 12934–12942. (8) Derfus, A. M.; Chan, W. C. W.; Bhatia, S. N. Probing the Cytotoxicity of Semiconductor Quantum Dots. Nano Lett. 2004, 4, 11–18. (9) Hu, X.; Cook, S.; Wang, P.; Hwang, H. In Vitro Evaluation of Cytotoxicity of Engineered Metal Oxide Nanoparticles. Sci. Total Environ. 2009, 407, 3070-3072. (10) Wu, C.; Schneider, T.; Zeigler, M.; Yu, J.; Schiro, P. G.; Burnham, D. R.; McNeill, J. D.; Chiu, D. T. Bioconjugation of Ultrabright Semiconducting Polymer Dots for Specific Cellular Targeting. J. Am. Chem. Soc. 2010, 132, 15410–15417. (11) Wu, C.; Hansen, S. J.; Hou, Q.; Yu, J.; Zeigler, M.; Jin, Y.; Burnham, D. R.; McNeill, J. D.; Olson, J. M.; Chiu, D. T. Design of Highly Emissive Polymer Dot Bioconjugates for in vivo Tumor Targeting, Angew. Chem. Int. Ed. 2011, 50, 3430–3434. (12) Feng, L.; Zhu, C.; Yuan, H.; Liu, L.; Lv, F.; Wang, S. Conjugated Polymer Nanoparticles: Preparation, Properties, Functionalization and Biological Applications. Chem. Soc. Rev. 2013, 42, 6620–6633. (13) Yu, J.; Rong, Y.; Kuo, C. T.; Zhou, X. H.; Chiu, D. T. Recent Advances in the Development of Highly Luminescent Semiconducting Polymer Dots and Nanoparticles for Biological Imaging and Medicine, Anal. Chem. 2017, 89, 42–56. (14) Phillips, M. A.; Gran, M. L.; Peppas, N. A. Targeted Nanodelivery of Drugs and Diagnostics, Nano Today 2010, 5, 143–159.


22

Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(15) Feng, L.; Liu, L.; Lv, F.; Bazan, G. C.; Wang, S. Preparation and Biofunctionalization of Multicolor Conjugated Polymer Nanoparticles for Imaging and Detection of Tumor Cells. Adv. Mater. 2014, 26, 3926–3930. (16) Feng, G.; Fang, Y.; Liu, J.; Geng, J.; Ding, D.; Liu, B. Multifunctional Conjugated Polymer Nanoparticles for Image ‐ Guided Photodynamic and Photothermal Therapy. Small 2017, 13, 1602807. (17) Pennakalathil, J.; Jahja, E.; Özdemir, E. S.; Konu, Ö.; Tuncel, D. Red Emitting, Cucurbituril-Capped, Ph-Responsive Conjugated Oligomer-Based Nanoparticles for Drug Delivery and Cellular Imaging. Biomacromolecules 2014, 15, 3366–3374. (18) Fischer, I.; Kaeser, A.; Peters-Gumbs, M. A. M.; Schenning, A. P. H. J. Fluorescent π‐ Conjugated Polymer Dots Versus Self‐Assembled Small‐Molecule Nanoparticles: What’s the Difference? Chem. Eur. J. 2013, 19, 10928–10934. (19) Cai, X.; Liu, X.; Liao, L. D.; Bandla, A.; Ling, J. M.; Liu, Y. H.; Thakor, N.; Bazan, G. C.; Liu, B. Encapsulated Conjugated Oligomer Nanoparticles for Real ‐ Time Photoacoustic Sentinel Lymph Node Imaging and Targeted Photothermal Therapy. Small 2016, 12, 4873–4880. (20) Liang, H.; Zhang, X. B.; Lv, Y.; Gong, L.; Wang, R.; Zhu, X.; Yang, R.; Tan, W. Functional DNA-Containing Nanomaterials: Cellular Applications in Biosensing, Imaging, and Targeted Therapy. Acc. Chem. Res. 2014, 47, 1891–1901. (21) Steichen, S. D.; Caldorera-Moore, M.; Peppas, N. A. A Review of Current Nanoparticle and Targeting Moieties for the Delivery of Cancer Therapeutics. Eur. J. Pharm. Sci. 2013, 48, 416–427.


23


Page 24 of 26

(22) Brannon-Peppas, L.; Blanchette, J. O. Nanoparticle and Targeted Systems for Cancer Therapy. Adv. Drug Del. Rev. 2012, 64, 206–212. (23) Ai, J.; Li, J.; Ga, L.; Yun, G.; Xu, L.; Wang, E. Multifunctional Near-Infrared Fluorescent Nanoclusters for Simultaneous Targeted Cancer Imaging and Photodynamic Therapy. Sens. Actuators B: Chem. 2016, 222, 918–922. (24) Raeesi, V.; Chou, L. Y.; Chan, W. C. Tuning the Drug Loading and Release of DNA‐ Assembled Gold‐Nanorod Superstructures, Adv. Mater. 2016, 28, 8511–8518. (25) Chang, M.; Yang, C. S.; Huang, D. M. Aptamer-Conjugated DNA Icosahedral Nanoparticles as a Carrier of Doxorubicin for Cancer Therapy, ACS Nano 2011, 5, 6156–6163. (26) Mohan, P.; Rapoport, N. Doxorubicin as a Molecular Nanotheranostic Agent: Effect of Doxorubicin Encapsulation in Micelles or Nanoemulsions on the Ultrasound-Mediated Intracellular Delivery and Nuclear Trafficking, Mol. Pharm. 2010, 7, 1959–1973. (27) Zaman, G. J.; Flens, M. J.; van Leusden, M. R.; de Haas, M.; Mülder, H. S.; Lankelma, J.; Pinedo, H. M.; Scheper, R. J.; Baas, F.; Broxterman, H. J. The Human Multidrug ResistanceAssociated Protein MRP is a Plasma Membrane Drug-Efflux Pump, Proc. Natl. Acad. Sci. USA 1994, 91, 8822–8826. (28) Dong, X.; Mattingly, C. A.; Tseng, M. T.; Cho, M. J.; Liu, Y.; Adams, V. R.; Mumper, R. J. Doxorubicin and Paclitaxel-Loaded Lipid-Based Nanoparticles Overcome Multidrug Resistance by Inhibiting P-Glycoprotein and Depleting ATP, Cancer Res. 2009, 69, 3918–3926.


24

Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(29) Liu, J.; Wei, T.; Zhao, J.; Huang, Y.; Deng, H.; Kumar, A.; Wang, C.; Liang, Z.; Ma, X.; Liang, X. J. Multifunctional Aptamer-Based Nanoparticles for Targeted Drug Delivery to Circumvent Cancer Resistance. Biomaterials 2016, 91, 44–56. (30) Gao, Y.; Chen, Y.; Ji, X.; He, X.; Yin, Q.; Zhang, Z.; Shi, J.; Li, Y. Controlled Intracellular Release of Doxorubicin in Multidrug-Resistant Cancer Cells by Tuning the ShellPore Sizes of Mesoporous Silica Nanoparticles. ACS Nano 2011, 5, 9788–9798. (31) Eckford, P. D.; Sharom, F. J. ABC Efflux Pump-Based Resistance to Chemotherapy Drugs. Chem. Rev. 2009, 109, 2989–3011. (32) Hu, J.; Tang, Y. A.; Elmenoufy, A. H.; Xu, H.; Cheng, Z.; Yang, X. Nanocomposite‐ Based Photodynamic Therapy Strategies for Deep Tumor Treatment. Small 2015, 11, 5860– 5887.


25


Page 26 of 26

Graphical Abstract


26

Multifunctional Oligonucleotide-Functionalized Conjugated Oligomer

Recommend Documents