Multiplex SERS chemosensing of metal ions via DNA-mediated

Subscriber access provided by Nottingham Trent University

Article

Multiplex SERS chemosensing of metal ions via DNA-mediated recognition Luca Guerrini, and Ramon A. Alvarez-Puebla Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.9b02385 • Publication Date (Web): 14 Aug 2019 Downloaded from pubs.acs.org on August 14, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Multiplex SERS chemosensing of metal ions via DNAmediated recognition Luca Guerrini,#,* and Ramon A. Alvarez-Puebla#,¶,* #

Department of Physical and Inorganic Chemistry and EMaS, Universitat Rovira I Virgili, Carrer de Marcel.lí Domingo s/n, 43007 Tarragona, Spain. ¶ ICREA, Passeig Lluís Companys 23, 08010 Barcelona, Spain. ABSTRACT: The combination of molecular sensors and plasmonic materials is emerging as one of the most promising approaches for ultrasensitive SERS-based detection of metal ions in complex fluids. However, only a very small fraction of the large pool of potential chemosensors described in classical analytical chemistry has been successfully implemented into viable SERS platforms for metal ion determination. This is due to the molecular restrictions that require the chemosensor to adhere onto the plasmonic surface while retaining the capability to undergoing large structural alterations upon metal ion binding. In this work, we demonstrate that the structural and functional plasticity of DNA for interacting with small aromatic molecules can be exploited to this end. DNA coating of silver nanoparticles modulates the interaction of the commercially available alizarin red S (ARS) chemosensor with the nanomaterial, translating its recognition capabilities from bulk solution onto the plasmonic surface, while simultaneously directing the particle assembling into highly efficient SERS clusters. The sensing approach was successfully applied to the multiplex, quantitative determination of Al(III) and Fe(III) in tap water in the sub-ppb level.

The quantification of metal ions at low concentrations is an extremely active area of interdisciplinary research due to their environmental and biological key roles.1 In modern analytical labs, metal ions are mainly quantified using spectroscopic techniques such as atomic absorption and atomic emission (i.e., ICP).2 Although the detection limits of these techniques are in the ppm/ppb regimes, they can be improved to the ppb/ppt levels by coupling them to a graphite furnace or a mass detector, in the cases of atomic absorption and emission, respectively. These techniques, however, are destructive, require a considerable amount of sample, use toxic and expensive gases and cannot be employed remotely. Optical methods, especially those in combination with nanotechnology, have shown the ability to overcome intrinsic limitations of traditional analytical tools, allowing for the non-destructive, fast, sensitive, selective, low-cost and remote sensing of inorganic ions3 in complex milieus such as environmental4 and biological fluids5 or even in living organism such as cells.6 Surface-enhanced Raman scattering (SERS) spectroscopy is an ultrasensitive molecular technique that relies on the excitation of localized surface plasmon resonances in metal nanostructures to dramatically enhance the Raman signals from molecules adsorbed onto, or in close proximity to, the metallic surface.7 Profiting from the outstanding sensitivity, specificity, ease of implementation, and rapidity, a continuously growing number of SERS-based sensors is emerging in the literature, finding countless applications in the most diverse fields.7-10 As atomic species, metal ions do not possess vibrational spectra; thus, SERS detection of these compounds has been relying on indirect approaches.11 In particular, indirect SERS sensing based on the use of molecular chemoreceptors offers important advantages. Most notably, since the SERS read-out is directly correlated with the complexation to the inorganic ion,

the chemoreceptor itself can be used as an internal standard enabling ratiometric measurements with improved reliability, sensitivity and quantitative response.12 In this sensing approach, ligands with high SERS cross-section are bound to the plasmonic surface, yielding intense signals which undergo detectable changes upon ion coordination.13-20 Chemosensors have been so far selected among those bearing surface anchoring groups (i.e., thiol or amino groups) which are, however, not involved in the coordination of the ionic species (i.e., the metal coordination site must remain available upon binding of chemosensor to the metallic surface). Thus, although classical qualitative analytical chemistry describes an abundant number of organic reagents with the capability of selectively identifying, and even speciate, almost all the existing metal ions,21 their application to SERS has been largely restricted due to the impossibility of coupling a thiol or amino group to the organic reagent without compromising the selectivity for the metallic species. For instance, anthraquinone (AQ) and flavonoids derivatives, especially those bearing keto and hydroxyl groups, offer a wealth of diverse chemosensors for metal chelation with, often, emissive properties in the visible region which enabled their implementation in a multitude of sensing applications.22-24 However, the binding of these molecules onto silver and gold surfaces takes place, when occurs, through the same coordination sites for metal ion complexation, thus preventing their direct applications as chemoreceptors for SERS. Furthermore, their SERS spectra are typically highly sensitive to the local environment, surface coverage and, in some cases, even time-dependent as surfacecatalyzed degradations have been described onto silver nanoparticles.25 Among others, alizarin red S (ARS) is a wellknown example of 1,2-dihydroxy-9,10-anthraquinone derivative which has been largely exploited for sensing metal

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 1. Schematic description of the interaction of alizarin red S/metal ion complexes (ARS/Mn+) with silver colloids (spermine coated silver nanoparticles, AgSp) without and in the presence of DNA duplex (dsDNA).

ions mostly via fluorescent-based approaches.26-30 On the other hand, similar to other AQ species, it has been reported that ARS can interact with double-stranded DNA (dsDNA), specifically by forming non-covalent complexes via intercalative binding, even when DNA is previously immobilized as a film onto metallic surfaces.31 In this study, we exploit DNA to mediate the interaction of ARS and metallic surface so as to enable the direct application of this molecular ligand as a SERS chemoreceptor in the multiplex detection of Fe(III) and Al(III) in tap water, and Cu(II) in buffered solution (Scheme 1). These metal ions are essential to biological and environmental systems but chronic long-term exposures to abnormal concentrations have been associated with a large set of major health problems, such as damages to the central nervous system, liver and kidneys,1, 32, 33 which makes their detection of great interest. Beyond the specific application described in this work, we foresee that the structural and functional plasticity of DNA for interacting with many small aromatic molecules, via E E and electrostatic interactions and H bonding, could provide a valuable surface tool for directly translating the chelation capabilities of metal ion receptors in bulk solution into efficient SERS chemoreceptors at the plasmonic surfaces.

MATERIALS AND METHODS Materials All materials were of highest purity available and obtained from Sigma Aldrich and Fisher Scientific, with the exception of DNA oligonucleotides which were purchased from Eurofins Genomics. Stock solutions (400 µM) of the complementary 21mer strands (CATCGCAGGTACCTGTAAGAG and GTAGCGTCCATGGACATTCTC) were prepared in Milli-Q

Page 2 of 8

water. Hybridization was then conducted by heating to 90º C for 10 minutes an equimolar solution of the two strands in PBS 0.3 M (pH 7.4) and then let slowly cool down to room temperature. This yielded a 20 µM solution of the corresponding duplex. For SERS measurements, a 1 µM solution of dsDNA in PBS 0.1 M (pH 5.5) and a 30 µM solution of ARS in Milli-Q water were prepared. Tap water pH was adjusted from pH ca. 7.0 to pH 5.5 by addition of a 1% nitric acid solution. Fresh 1 mM solutions of ZnCl2, FeCl2, FeCl3, CoCl2, Ni(NO3)2, Cu(NO3)2, PbCl2, CdCl2, MgSO4, HgCl2, and AlCl3 were prepared in Milli-Q water and diluted into either PBS 0.1 M (pH 5.5) or tap water (pH 5.5) to the appropriate concentrations. Synthesis of silver colloids Positively-charged spermine coated-silver nanoparticles (AgSp) were synthesized as previously described.34 Nanoparticles are characterized by a ca. +38 K and an average size of ca. 23 nm with a plasmon peak centered at ca. 391 nm. Citrate-reduced colloids were synthesized as previously reported.35 Sample preparation SERS analysis was performed by mixing 10 µL of ARS 30 µM with 10 µL of metal ion solutions (either in PBS 0.1 M or tap water, both at pH 5.5) of a given concentration. After approximately one minute, 8 µL of DNA duplex 1 µM in PBS 0.1 M (pH 5.5) was added. Approximately 10 minutes later, 140 µL of AgSp were mixed with the sample. Nanoparticles undergo rapid aggregation mediated by DNA electrostatic linking, with the formation of long-term stable clusters in suspension.34 DNA concentration was selected to fall within a range of DNA/NP molar ratio values yielding colloidally stable and highly SERS active nanoparticle clusters, as previously illustrated.36, 37 Colloids were quickly sonicated before running the SERS measurements. Absorption spectra were registered with 35 µM solutions of ARS in PBS 0.1 M (pH 5.5) in the presence of a given amount of metal ions solutions. Complexation occurs rapidly upon addition of metal ions (< 60 s).26 Instrumentation SERS spectra were acquired using a Renishaw InVia Reflex confocal microscope equipped with a high-resolution grating consisting of 1800 grooves/cm for visible wavelengths, additional band-pass filter optics, and a CCD camera. A green 514 nm laser was focused onto the sample by a lens for macrosampling (30 mm focal length, 0.17 NA) and spectra were typically acquired with 5×10 s exposure time and 5 accumulations. UV-vis spectra were obtained using a Thermo Scientific Evolution 201 UV-visible spectrophotometer.

RESULTS AND DISCUSSION ARS complexation of transition metal ions, Mn+ (n = 2, 3), in non-basic media takes place via coordination of the adjacent keto and hydroxyl groups generating the monodeprotonated ARS ligand (Fig. 1A, inset).38 The electronic absorption spectra highlight the large bathochromic shift of the E E band from ca. 435 nm (yellow ARS) to red alizarinates which absorption maxima range over hundreds of nm.38 Under acidic conditions, ARS displays high affinity for binding of Al(III), Cu(II) and Fe(III), while null/minimal interferences are observed for other common ions (Fig 1A and Fig. S1).26

2 ACS Paragon Plus Environment

Page 3 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60





Page 4 of 8

Page 5 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60




(>75 ppb). Conversely, Al(III) quantification can be achieved in the sub-ppb level (LOD = 0.8 ppb) with a linear response within the ca. 1-25 ppb range (Fig. 6G). Notably, the higher degree of spectral differentiation between the SERS ARS complexes with Fe(III) vs Al(III) significantly reduces the signal overlapping as Al(III) retains the minimal or null impact on the I1443/I1469 and I564/I1159 values used as spectral markers for Fe(III) quantification (Fig. 6D and E, respectively) while the presence of Fe(III) ions now only marginally impact the I1488/I1459 ratio used for Al(III) determination (Fig. 6F). An identical study as that performed for Fe(III)/Al(III) mixtures in buffer (Fig. 5) was carried out for tap water samples. Similarly, metal ion chelation determines approximately 4 times larger signals for Al(III) ions as compared to Fe(III), as well as the negative interference from aluminium ions in Fe(III) detection appears to be tolerable for Fe(III)/Al(III) molar ratios > 15. On the other hand, Fe(III) interference on Al(III) detection becomes detectable only at Al(III) concentrations close to the LOD (Fig. S5B, D and F).

CONCLUSION In summary, we have described a novel approach for devising SERS-based sensors for the ultrasensitive and multiplex detection of metal ions in solution. Here, an antraquinone derivative (ARS) is used to selectively target metal ions in the sample while DNA is simultaneously exploited as a plasmonic surface-mediator for ARS adhesion and molecular linker for efficient generation of highly SERS-active colloidal clusters. The results demonstrate that the DNA-mediated approach unlocked the potential of ARS as an efficient SERS chemoreceptor to be used for the direct determination of Al(III) in tap water and, to a second instance, for the quantification of Fe(III) for low aluminum ion contents (in any case, if needed, masking agents such as EDTA and ascorbic acid for Fe(III), and F- for Al(III) can be used to eliminate the respective interferences27). Beyond the specific case of ARS, we foresee the potential of DNA-derivatization of plasmonic surfaces as an intriguing approach aimed at mediating the interaction of a multitude of molecular ligands and, thus, enabling their exploitation as efficient SERS chemoreceptors for sensing applications.

AUTHOR INFORMATION Corresponding Authors Email: [email protected] Email: [email protected]

ORCID Luca Guerrini: 0000-0002-2925-1562 Ramon A. Alvarez-Puebla: 0000-0003-4770-5756

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT This work was funded by the Spanish Ministerio de Economía, Industria y Competitividad (CTQ2017-88648R, RYC-201620331), the Generalitat de Cataluña (2017SGR883), the Universitat

Page 6 of 8

Rovira i Virgili (2018PFRURV-B2-02), and the Universitat Rovira i Virgili and Banco Santander (2017EXIT-08).

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Additional absorption spectra of ARS with metal ions. SERS spectra of ARS with ssDNA. Additional SERS spectra of ARS and metal ions in the presence of dsDNA, additional plots of spectral markers vs. metal ion content.

REFERENCES (1) Seiler, H. G.; Sigel, A.; Sigel, H. Handbook on metals in clinical and analytical chemistry; Marcel Dekker, Inc., 1994. (2) Lajunen, L. H. J.; Perämäki, P. Spectrochemical Analysis by Atomic Absorption and Emission: Edition 2; Royal Society of Chemistry: Cambridge, 2004. (3) de Aberasturi, D. J.; Montenegro, J. M.; de Larramendi, I. R.; Rojo, T.; Klar, T. A.; Alvarez-Puebla, R.; Liz-Marzan, L. M.; Parak, W. J. Chem. Mat. 2012, 24, 738-745. (4) Correa-Duarte, M. A.; Pazos Perez, N.; Guerrini, L.; Giannini, V.; Alvarez-Puebla, R. A. J. Phys. Chem. Lett. 2015, 6, 868-874. (5) Carter, K. P.; Young, A. M.; Palmer, A. E. Chem. Rev. 2014, 114, 4564-4601. (6) Rivera_Gil, P.; Vazquez-Vazquez, C.; Giannini, V.; Callao, M. P.; Parak, W. J.; Correa-Duarte, M. A.; Alvarez-Puebla, R. A. Angew. Chem.-Int. Edit. 2013, 52, 13694-13698. (7) Schlücker, S. Angew. Chem.-Int. Edit. 2014, 53, 4756-4795. (8) Zong, C.; Xu, M. X.; Xu, L. J.; Wei, T.; Ma, X.; Zheng, X. S.; Hu, R.; Ren, B. Chem. Rev. 2018, 118, 4946-4980. (9) Laing, S.; Jamieson, L. E.; Faulds, K.; Graham, D. Nat. Rev. Chem. 2017, 1, 0060. (10) Hamon, C.; Liz-Marzan, L. M. J. Colloid Interface Sci. 2018, 512, 834-843. (11) Alvarez-Puebla, R. A.; Liz-Marzan, L. M. Angew. Chem.-Int. Edit. 2012, 51, 11214-11223. (12) Huang, X. L.; Song, J. B.; Yung, B. C.; Huang, X. H.; Xiong, Y. H.; Chen, X. Y. Chem. Soc. Rev. 2018, 47, 2873-2920. (13) Guselnikova, O.; Postnikov, P.; Erzina, M.; Kalachyova, Y.; \ ]*9 V.; Lyutakov, O. Sens. Actuator B-Chem. 2017, 253, 830838. (14) Guerrini, L.; Rodriguez-Loureiro, I.; Correa-Duarte, M. A.; Lee, Y. H.; Ling, X. Y.; Garcia de Abajo, F. J.; Alvarez-Puebla, R. A. Nanoscale 2014, 6, 8368-8375. (15) Szlag, V. M.; Rodriguez, R. S.; He, J.; Hudson-Smith, N.; Kang, H.; Le, N.; Reineke, T. M.; Haynes, C. L. ACS Appl. Mater. Interfaces 2018, 10, 31825-31844. (16) Tsoutsi, D.; Guerrini, L.; Hermida-Ramon, J. M.; Giannini, V.; Liz-Marzan, L. M.; Wei, A.; Alvarez-Puebla, R. A. Nanoscale 2013, 5, 5841-5846. (17) # ^ _ V.; Kupfer, S.; Jahn, M.; Henkel, T.; Weber, K.; Cialla-May, D.; Popp, J. Sens. Actuator B-Chem. 2019, 279, 230237. (18) Docherty, J.; Mabbott, S.; Smith, W. E.; Reglinski, J.; Faulds, K.; Davidson, C.; Graham, D. Analyst 2015, 140, 6538-6543. (19) Zhuang, H. J.; Wang, Z.; Zhang, X. C.; Hutchison, J. A.; Zhu, W. F.; Yao, Z. Y.; Zhao, Y. L.; Li, M. Chem. Commun. 2017, 53, 1797-1800. (20) Lee, S. J.; Moskovits, M. Nano Lett. 2011, 11, 145-150. (21) Vogel, A. I.; Svehla, G. Vogel's qualitative inorganic analysis; Longman Scientific & Technical; Wiley: Harlow, 1987.

6 ACS Paragon Plus Environment

Page 7 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry (22) Langdon-Jones, E. E.; Pope, S. J. A. Coord. Chem. Rev. 2014, 269, 32-53. (23) Kasprzak, M. M.; Erxleben, A.; Ochocki, J. RSC Advances 2015, 5, 45853-45877. (24) Pyrzynska, K.; a9 A. Crit. Rev. Anal. Chem. 2011, 41, 335345. (25) Jurasekova, Z.; Garcia-Ramos, J. V.; Domingo, C.; SanchezCortes, S. J. Raman Spectrosc. 2006, 37, 1239-1241. (26) Supian, S. M.; Ling, T. L.; Heng, L. Y.; Chong, K. F. Anal. Methods 2013, 5, 2602-2609. (27) Ruedas Rama, M. J.; Ruiz Medina, A.; Molina Díaz, A. Talanta 2005, 66, 1333-1339. (28) Wang, Y.; Hou, L. J.; Wu, Y. B.; Shi, L. L.; Shang, Z. B.; Jin, W. J. J. Photochem. Photobiol. A 2014, 281, 40-46. (29) Wang, Y. X.; Xiong, L. M.; Geng, F. H.; Zhang, F. Q.; Xu, M. T. Analyst 2011, 136, 4809-4814. (30) Kubo, Y.; Ishida, T.; Kobayashi, A.; James, T. D. J. Mater. Chem. 2005, 15, 2889-2895. (31) Yang, Z.-S.; Zhang, D.-P.; Long, H.-Y.; Zhao, G.-C. Electroanalysis 2007, 19, 2577-2582. (32) Pithadia, A. S.; Lim, M. H. Curr. Opin. Chem. Biol. 2012, 16, 67-73. (33) Gauthier, E.; Fortier, I.; Courchesne, F.; Pepin, P.; Mortimer, J.; Gauvreau, D. Environ. Res. 2000, 84, 234-246. (34) Masetti, M.; Xie, H.-n.; Y _ Ž.; Recanatini, M.; AlvarezPuebla, R. A.; Guerrini, L. J. Am. Chem. Soc. 2015, 137, 469-476. (35) Lee, P. C.; Meisel, D. J. Phys. Chem. 1982, 86, 3391-3395. (36) Gisbert-Quilis, P.; Masetti, M.; Morla-Folch, J.; Fitzgerald, J. M.; Pazos-Perez, N.; Garcia-Rico, E.; Giannini, V.; AlvarezPuebla, R. A.; Guerrini, L. Adv. Mater. Interfaces 2017, 4, 1700724. (37) Guerrini, L.; Y _ Ž.; van Lierop, D.; Alvarez-Puebla, R. A.; Graham, D. Angew. Chem.-Int. Edit. 2015, 54, 1144-1148. (38) Fain, V. Y.; Zaitsev, B. E.; Ryabov, M. A. Russ. J. Coord. Chem. 2004, 30, 365-370. (39) Torres-Nunez, A.; Faulds, K.; Graham, D.; Alvarez-Puebla, R. A.; Guerrini, L. Analyst 2016, 141, 5170-5180. (40) Legan, L.; Retko, K.; Ropret, P. Microchem J. 2016, 127, 3645. (41) Cañamares, M. V.; Garcia-Ramos, J. V.; Domingo, C.; Sanchez-Cortes, S. J. Raman Spectrosc. 2004, 35, 921-927. (42) de Souza, M. L.; Corio, P. Vib. Spectrosc. 2010, 54, 137-141. (43) Mitrovic, B.; Milacic, R.; Pihlar, B.; Simoncic, P. Analusis 1998, 26, 381-388.

7



Table of Content 165x89mm (150 x 150 DPI)


Page 8 of 8

Multiplex SERS chemosensing of metal ions via DNA-mediated

Recommend Documents