Mutagenesis of the Microcystin Tailoring and Transport Proteins in a

Subscriber access provided by UNIV AUTONOMA DE COAHUILA UADEC

Article

Mutagenesis of the microcystin tailoring and transport proteins in a heterologous cyanotoxin expression system Tianzhe Liu, Rabia Mazmouz, Leanne A. Pearson, and Brett A. Neilan ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.9b00068 • Publication Date (Web): 01 May 2019 Downloaded from http://pubs.acs.org on May 2, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Mutagenesis of the microcystin tailoring and transport proteins in a heterologous cyanotoxin expression system Tianzhe Liu†, Rabia Mazmouz‡, Leanne A. Pearson‡ and Brett A. Neilan*† ‡ †School

of Biotechnology and Biomolecular Sciences, The University of New South Wales, NSW 2052, Sydney, Australia ‡School of Environmental and Life Sciences, The University of Newcastle, NSW 2308, Callaghan, Australia * Corresponding author. E-mail: [email protected] Abstract The microcystins are a large group of cyclic peptide hepatotoxins produced by several genera of freshwater cyanobacteria. The genes responsible for microcystin biosynthesis are encoded within a large (~55 kbp) gene cluster, mcyA-J. The recent establishment of a cyanotoxin heterologous expression system in Escherichia coli has provided the means to study microcystin biosynthesis in a genetically tractable, rapidly-growing host. Using this system, we demonstrate that deletion of the ABC-transporter, mcyH, and dehydrogenase, mcyI, abolishes microcystin production, while deletion of the O-methyltransferase, mcyJ, results in the production of the demethylated (DM) toxin [D-Asp3, DMAdda5]microcystin-LR. Both methylated and DM toxin variants were heterologously produced at high titers and efficiently exported into the extracellular medium, enabling easy purification. The results show that the mcy gene cluster can be engineered in E. coli to study the function of its individual components and to direct the synthesis of particular microcystin variants. This technology could potentially be applied to other natural products of ecological and biomedical significance. Key words: cyanobacteria; hepatotoxin; microcystin; nonribosomal peptide; polyketide; mutagenesis; biosynthetic gene cluster The cyclic heptapeptide microcystins are the most frequently detected and abundant class of freshwater cyanobacterial toxins.1–4 Microcystins are transported to the liver by the organic anion transport system and elicit their toxicity by binding to and inhibiting eukaryotic protein phosphatase types 1 and 2A.5,6 Acute doses of toxin can lead to hemorrhagic shock,7,8 while repeated ingestion of sub-lethal doses may cause chronic liver injury and hepatocellular carcinoma.9,10 The common structure of microcystin can be described as cyclo (D-Ala-X-D-MeAsp-Z-AddaD-Glu-Mdha) (Figure 1), where X and Z, at positions 2 and 4, are variable L amino acids; DMeAsp, at position 3, is D-erythro-β-methyl-aspartic acid; Adda, at position 5, is (2S,3S,8S,9S)-3-amino-9-methoxy-2,6,8-trimethyl-10-phenyldeca-4,6-dienoic acid; and Mdha, at position 7, is N-methyldehydroalanine.1,11,12 To date, 246 microcystin variants have been reported, differing in amino acid composition and functional group decorations.13 The most common structural variations arise from amino acid substitutions within positions 2 and 4, however, substitutions within every position have been reported.14,15 Microcystin-LR, one of the most common and toxic variants, contains leucine and arginine at positions 2 and 4 (Figure 1).12

ACS Paragon Plus Environment

1

ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 15

Figure 1. Structure of microcystin-LR. X and Z at positions 2 and 4, represent variable amino acids; D-MeAsp, at position 3, is D-erythro-β-methyl-aspartic acid; Adda, at position 5, is (2S,3S,8S,9S)-3-amino-9-methoxy-2,6,8-trimethyl-10-phenyldeca-4,6-dienoic acid; Mdha, at position 7, is N-methyldehydroalanine. Microcystins are synthesized by a hybrid pathway involving non-ribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs). These multifunctional enzyme complexes sequentially assemble amino acid and small carboxylate derived precursor building blocks, respectively, into their products in an assembly-line fashion.16,17 The backbone and side chains of the cyclic peptides usually undergo several modifications, such as methylation and epimerization, before the mature product is released from the megasynthase complex.18,19 These modifications may be catalyzed by domains within the PKSs/NRPSs or by stand-alone tailoring enzymes. Individual tailoring enzymes encoded within the microcystin biosynthesis gene cluster include an aspartate racemase, McyF, and a methyl-malate dehydrogenase, McyI, putatively responsible for the synthesis of the Me-D-Asp residue at position 3 (Sielaff et al., 2003, Pearson et al., 2007, Figure 2),20,21 and a methyltransferase, McyJ, putatively responsible for the O-methylation of the Adda moiety at position 5.22 The cluster additionally encodes an ATP-binding cassette (ABC) transporter, McyH, putatively responsible for transporting microcystin across the cell membrane.23

Figure 2. Schematic of putative reactions catalyzed by McyF and McyI. (i) Putative pathway to D-Asp and (ii) 3-Me-D-Asp in microcystin (MCYST) biosynthesis, catalyzed by McyI and McyF. Other enzymes putatively involved include malate dehydrogenase (Mdh) and aspartate aminotransferase (Asp-AT). Modified from Pearson et al., 2007. The heterologous expression of whole biosynthetic gene clusters in E. coli is an emerging technology that has recently been applied to the characterization of cyanotoxin pathways,


2

Page 3 of 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


including the lyngbyatoxin and microcystin pathways.24–26 This approach is particularly useful if the native producer is difficult to isolate, grow in culture and/or genetically engineer, as is the case for the lyngbyatoxin producer, Moorea producens.27 We have previously reported the heterologous expression of the complete 55 kb microcystin biosynthetic (mcy) gene cluster from Microcystis aeruginosa PCC7806 in E. coli and demonstrated that microcystin production can be directed by feeding β-methyl-aspartic acid to produce microcystin-LR instead of producing [D-Asp3]microcystin-LR when fed with aspartic acid.25 Here, we engineered three new microcystin expression constructs with mutations in mcyH, mcyI and mcyJ and produced an additional microcystin variant, [D-Asp3, DMAdda5]microcystin-LR. The results confirm the involvement of these genes in toxin biosynthesis and indicate their potential exploitation to direct the synthesis of industrially and biomedically valuable microcystin analogs. Results and discussion Mutagenesis of mcyH, mcyI and mcyJ in E. coli expression strains. The heterologous production of microcystins was detected in two of the four engineered E. coli expression strains; the positive control (GB05-MtaA-pFos-PbiTet-mcy), transformed with the parent vector encoding the entire mcyA-J gene cluster, and the ΔmcyJ mutant (GB05-MtaA-pFos-PbiTet-mcy-ΔmcyJ), transformed with the modified parent vector containing an insertional inactivation in mcyJ. No microcystin, or component thereof, was detected in the ΔmcyH mutant (GB05-MtaA-pFos-PbiTet-mcy-ΔmcyH) or the ΔmcyI mutant (GB05-MtaA-pFos-PbiTet-mcy-ΔmcyI). LC-MS analysis of the ΔmcyJ mutant extracts revealed a compound with m/z = 967.53 at the retention time of 5.80. The 14 m/z difference between this compound and the m/z of [DAsp3]microcystin-LR suggested it was a demethylated variant. This was confirmed by comparing the tandem mass spectra (MS/MS) of this compound with that of [DAsp3]microcystin-LR. The compound with m/z = 967.53 possessed all characteristic ions of [D-Asp3]microcystin-LR except one ion of m/z = 135.08, corresponding to a fragmentation ion of the Adda group. These results suggested that the microcystin produced by the ΔmcyJ mutant was [D-Asp3, DMAdda5]microcystin-LR (Figure 3 and 4), which is not naturally produced by M. aeruginosa PCC7806.


3


Page 4 of 15

Figure 3. LC-MS analysis of [D-Asp3, DMAdda5]microcystin-LR produced by the ΔmcyJ mutant E. coli strain, GB05-MtaA-pFos-PbiTet-mcy-ΔmcyJ. (A) Extracted ion chromatograms of heterologously produced [D-Asp3, DMAdda5]microcystin-LR, m/z = 967.53; (B) Mass spectrum of heterologously produced [D-Asp3, DMAdda5]microcystin-LR at 5.80 min; (C) Tandem mass spectra (MS/MS) of ion 967.53 from heterologously produced


4

Page 5 of 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


[D-Asp3, DMAdda5]microcystin-LR; (D) Tandem mass spectra (MS/MS) of heterologously produced [D-Asp3]microcystin-LR (Liu et al., 2017) for comparative analysis; The masses of [D-Asp3, DMAdda5]microcystin-LR are highlighted in yellow; The ion corresponding to the methylated Adda fragment in [D-Asp3]microcystin-LR, is highlighted in red.

Figure 4. Structure of [D-Asp3, DMAdda5]microcystin-LR produced by the ΔmcyJ mutant E. coli strain, GB05-MtaA-pFos-PbiTet-mcy-ΔmcyJ. Molecular weight = 966.52 g/mol. These results are consistent with bioinformatic data suggesting that McyJ belongs to the Sadenosyl-L-methionine (SAM)-dependent methyltransferase superfamily28 as well as a previous study by Christiansen and co-workers22 who observed that inactivation of mcyJ in the cyanobacterium, Planktothrix agardhii CYA 126, led to the production of microcystin variants with reduced mass-to-charge ratios (m/z -14) corresponding to the loss of a methyl group, however, the position of the demethylation could not be established. Our MS/MS data clearly indicate that inactivation of mcyJ results in the demethylation of the Adda residue at position 5, confirming the role of McyJ as an Adda O-methyltransferase.28 The demethylated microcystin variant produced by our E. coli ΔmcyJ mutant, [D-Asp3, DMAdda5]microcystinLR, is not naturally produced by cyanobacteria and has reduced inhibition of PP2A activity compared to [D-Asp3]microcystin-LR (see below). The loss of microcystin production following inactivation of mcy genes, including mcyH, has been observed previously in the native producer, M. aeruginosa.23,28–30 This phenomenon is not due to polar effects of the mcyH deletion on downstream genes as mcy transcripts were detected in all mutant strains tested.23 Similarly, in the present study, mcy transcripts were detected in all three genetically engineered E. coli mutants (Figure 5).


5


Page 6 of 15

Figure 5. Transcriptional analysis of mcy genes in E. coli expression strains. PCR amplification of mcy genes from cDNA reverse transcribed from mRNA in E. coli. (1) positive control (GB05-MtaA-pFos-PbiTet-mcy); (2) ΔmcyH mutant (GB05-MtaA-pFosPbiTet-mcy-ΔmcyH); (3) ΔmcyI mutant (GB05-MtaA-pFos-PbiTet-mcy-ΔmcyI); (4) ΔmcyJ mutant (GB05-MtaA-pFos-PbiTet-mcy-ΔmcyJ); M = molecular weight marker (2-log DNA ladder, New England Biolabs). An alternative explanation for the lack of toxin production in ΔmcyH mutants, relates to the stability of the microcystin synthetase enzyme complex. Being a putative membrane-bound protein, McyH may play a role in stabilizing the megasynthase by anchoring it to the membrane. Therefore, disruption of McyH via mutagenesis could lead to dissociation of the complex and degradation of its individual protein components.23 Previous biochemical analyses suggested that McyI catalyzes the interconversion of 3-methyl malate to 3-methyl oxalacetate, the precursor of the 3-methyl-D-aspartate residue at position 3 in the microcystin molecule.21 While nearly all mcy gene clusters characterized encode mcyI, several natural variants with D-Asp substitutions in this position have been described.15 We therefore hypothesized that mutation of McyI would lead to the production of [DAsp3]microcystin-LR. However, LC-MS analysis and the PP2A inhibition assay (see below) were unable to detect any microcystins in the E. coli ΔmcyI cultures. Similar results have been recorded for Microcystis strains with naturally occurring deletions in mcyI, which were unable to synthesize microcystins.31 McyI may therefore contribute to the stabilization of the microcystin synthase complex, as proposed for McyH. Alternatively, it may catalyze a different but nevertheless essential step in toxin biosynthesis compared to that proposed.21 Site-directed mutagenesis of the 2-hydroxy acid binding site of McyI could be used to resolve this question.


6

Page 7 of 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Export of microcystins from E. coli expression strains. Up to 95% of the total microcystin pool produced by the positive control and ΔmcyJ mutant was found in the extracellular medium. To investigate whether this was the result of cell lysis or an active transport mechanism, growth and intra/extracellular toxin levels in the control were monitored over the 5-day fermentation period. Cells grew exponentially from 0-6 h at 30°C. Reduction of the cultivation temperature to 18°C and induction of expression (at 6 h) corresponded to a reduction in growth rate. By 84 h the culture reached a maximum optical density (at 600 nm) of 2.22±0.02 and entered stationary phase. After 48 h, >85% of the total microcystin in the culture was located in the extracellular medium. The ratio of extracellular to intracellular microcystin steadily increased thereafter. By 72 h, 95% of the total microcystin in the culture was located in the extracellular medium (Figure 6).

Figure 6. Relationship between growth and extra/intracellular toxin concentration in the positive control strain, GB05-MtaA-pFos-PbiTet-mcy. OD600 = optical density of culture at 600 nm. While knock-out mutagenesis was unable to confirm the putative role of McyH in toxin export, these heterologous expression studies suggest that a microcystin export pathway was functional in the positive control and ΔmcyJ mutant. Significant cell lysis, measured by reduction in OD600, was not observed during the incubation period, suggesting export of the toxin, rather than its leakage from dead or damaged cells. The efficient export of microcystin by these strains is in contrast to previous observations of the lyngbyatoxin heterologous expression strain, GB05-MtaA-pCC-Ptet-ltx, which displayed a high intracellular to extracellular toxin ratio under similar laboratory conditions (Ongley et. al., 2013a).24 It should be noted that the lyngbyatoxin expression construct does not encode an equivalent cyanotoxin transporter gene.24 The efficient export of microcystin exhibited by our positive control and ΔmcyJ mutant strains enabled the rapid downstream purification of heterologously produced compounds. This approach also minimized contamination from cellular compounds, such as nucleic acids, proteins and lipids. In contrast, in M. aeruginosa, microcystin is primarily located inside the cell15,32 and must be purified from a complex cellular matrix, which may include other low molecular weight peptides.33


7


Page 8 of 15

The intracellular localization of microcystin in M. aeruginosa supports putative intracellular physiological roles of the toxin in carbon-nitrogen metabolism and/or redox maintenance.34,35 In this scenario, McyH would transport the toxin across the inner cell membrane or thylakoid membrane, rather than the outer membrane. While the observed export of microcystin by E. coli in this study was probably mediated by McyH, the possibility of an endogenous efflux system in E. coli cannot be dismissed. Sitedirected mutation of the active site (Walker motifs)36 of the ABC-transporter may address this issue, leading to the production of inactive but correctly folded McyH and hence the build-up of microcystin inside the cell. Inhibition of PP2A by heterologously produced microcystins. The inhibition of PP2A was detected in methanolic extracts of the induced positive control strain, GB05-MtaA-pFos-PbiTet-mcy, cultured with25 or without β-methyl-aspartic acid and the ΔmcyJ mutant. Extracts from the ΔmcyJ mutant, producing [D-Asp3, DMAdda5]microcystin-LR, had slightly reduced PP2A inhibition activity compared to extracts from the positive controls, producing microcystin-LR and [D-Asp3]microcystin-LR (Table 1). These results are in consistence with previous studies where the reduction of PP2A inhibitory activity were found for microcystin variants with demethylated Asp3 and Adda5.22,37 PP2A inhibition activity was not detected in methanolic extracts of the ΔmcyH or ΔmcyI mutants. Table 1. Protein phosphatase 2A (PP2A) inhibition by heterologously produced microcystins. Inhibition PP2A by methanolic extracts of the positive control, GB05-MtaApFos-PbiTet-mcy, cultured with (1)25 or without (2) β-methyl-aspartic acid and the ΔmcyH, ΔmcyI and ΔmcyJ mutants. ± indicates standard deviation from the mean of three replicates. E. coli strain Toxin PP2A activity (%)

+ control 1

+ control 2

MCYSTLR 20.1±0.7

[D-Asp3]MCYST-LR

ΔmcyH

ΔmcyI

-

-

33.5±0.5

100

100

ΔmcyJ [D-Asp3,

DMAdda5]MCYSTLR 37.05±0.25

Conclusion While several strains of hepatotoxic cyanobacteria are naturally competent, including M. aeruginosa and P. agardhii, in situ genetic manipulation of the mcy biosynthesis gene cluster in these strains has proven to be technically challenging due to their slow growth rate and low transformation efficiencies. We sought to circumvent these challenges by engineering a heterologous expression platform for microcystin in E. coli. Thus far, three different microcystin variants (microcystin-LR, [D-Asp3]microcystin-LR and [D-Asp3, DMAdda5]microcystin-LR) have been produced using the GB05-MtaA-pFosPbiTet-mcy genetic construct by altering the growth medium and mutating individual biosynthetic pathway tailoring enzymes. In theory, this platform could be further reprogrammed to generate a virtually limitless variety of microcystins for use as toxin standards for water quality analysis or as compounds of therapeutic value. For example, [DMAdda5]microcystin-LR could be generated by feeding the ΔmcyJ mutant β-methylaspartic acid). Additionally, the efficient exportation of microcystin by these E. coli strains makes them ideal for fed-batch fermentation, which could be used to produce valuable compounds on an industrial scale.


8

Page 9 of 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


This study has highlighted the limitations of a gene “knock-out” approach for studying complex biosynthesis in genetically intractable microorganisms such as cyanobacteria. Our heterologous expression platform is highly flexible and amenable to more subtle forms of genetic manipulation and regulation, including site-directed mutagenesis and promoter exchange, making it a valuable tool for studying and directing the synthesis of cyanotoxins and other ecologically and biomedically important secondary metabolites. Materials and methods Bacterial strains and culture conditions E. coli strains were cultured in lysogeny broth (LB) medium supplemented with appropriate antibiotics and incubated at 18-37°C with shaking (200 rpm). The GB2005 strain24 was used for general cloning procedures, the GB05-Red strain was used for linear-circular homologous recombination38 and the GB05-MtaA strain (with promiscuous PPTase MtaA chromosomally integrated) was used for heterologous expression studies.24 Insertional mutagenesis of mcy genes Mutagenesis of mcyH, mcyI and mcyJ in the previously engineered microcystin expression construct (pFos-PbiTet-mcy)25 was performed via the insertion of a spectinomycin resistance cassette into the gene of interest (Figure 7). Gene knock-outs were derived via linear-circular homologous recombination (Red/ET method) as described.38 Briefly, GB05-Red cells were transformed with the parent construct, pFos-PbiTet-mcy, via electroporation. Positive colonies were selectively grown on LB agar plates containing 15 µg mL–1 chloramphenicol and 20 µg mL–1 apramycin. 1.4 mL of LB medium containing 15 µg mL–1 chloramphenicol was inoculated with 40 µL of overnight GB05-Red-pFos-PbiTet-mcy starter culture and incubated at 37°C, with shaking (950 rpm), for 1.5-2 h. The expression of recombinases was induced via the addition of L-arabinose (0.1% final concentration) and the culture was incubated for an additional 45 min. PCR products incorporating a spectinomycin resistance cassette and homology arms to mcyH mcyI or mcyJ were amplified using primers listed in Table 2 and Velocity polymerase (Bioline). Approximately 0.2-0.3 µg of the purified PCR products were used to transform E. coli GB05-Red-pFos-PbiTet-mcy cells. Positive colonies were selectively grown on LB agar plates containing 15 µg mL–1 chloramphenicol and 15 µg mL–1 spectinomycin. Insertional mutagenesis of mcyH, mcyI or mcyJ was confirmed via colony PCR and DNA sequencing. The newly constructed plasmids were designated pFos-PbiTet-mcy-ΔmcyH, pFos-PbiTetmcy-ΔmcyI and pFos-PbiTet-mcy-ΔmcyJ, respectively.


9


Page 10 of 15

Figure 7. Construction of microcystin expression constructs with single gene knock-out mutations. Three new expression constructs were engineered from the parent pFos-PbiTetmcy construct25 with knock-out mutations in mcyH, mcyI and mcyJ, respectively. Mutants were achieved via the insertion of a spectinomycin resistance cassette into the gene of interest, mediated by linear-circular homologous recombination. Table 2. List of primers used for engineering mcy knock-out constructs Primers Nucleotide Sequences (5’-3’) Primers for linear circular homologous recombination HR-mcyH-SpecR-Fwd TCAAGGCATTTCCTAAAAGTTACCCTATATTCAA ACTATGCAAACTCCATCCAGCCAGGACAGAAAT GC HR- mcyH-SpecR-Rev TGAGGTTTAGCAATGAAACAGTTACAGAGCTTTT GAGGCTCGATAATCATTTATTTGCCGACTACCTT GGTG HR-mcyI-SpecR-Fwd TCATTGCTAAACCTCAATTTAGGAAAAATTACGA TGACTACTACTTCACCCCAGCCAGGACAGAAATG C HR-mcyI-SpecR-Rev ACTAACCGAATCCCTGAGATTCTCTAGATGCTTT AAAAAAGATTCCACGCTTATTTGCCGACTACCTT GGTG HR-mcyJ-SpecR-Fwd ACAATTTATCCTTAATCCGGTTCGAGAAATGGCG TTTTTGCAAGATCAGTCCAGCCAGGACAGAAATG C HR-mcyJ-SpecR-Rev ACATCAATCTGCTTAAACCGAACTCAGTTTAATT TAGGCTTTTCTGCCGATTATTTGCCGACTACCTTG GTG Primers for sequencing Seq-SpecR-Fwd GCTTACGAACCGAACAGG


10

Page 11 of 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Seq-SpecR-Rev CCAGTATCAGCCCGTCAT *Underscored sequences correspond to homology arms used for linear-circular homologous recombination (LCHR) recombineering. Analysis of mcy transcripts in E. coli To investigate whether mutagenesis of mcyH, mcyI and mcyJ exerted polar effects on other genes in the mcy operon, a comprehensive transcript analysis was performed. mRNA was extracted from GB05-MtaA E. coli strains transformed with pFos-PbiTet-mcy (positive control), pFos-PbiTet-mcy-ΔmcyH, pFos-PbiTet-mcy-ΔmcyI and pFos-PbiTet-mcy-ΔmcyJ and reverse transcribed via RT-PCR as previously described25 using primers targeting each of the 10 genes in the mcy operon (mcyA-J) (see Liu et al., 2017 for primer sequences).25 Heterologous production of microcystins The GB05-MtaA strain was transformed with pFos-PbiTet-mcy (parent construct), pFosPbiTet-mcy-ΔmcyH, pFos-PbiTet-mcy-ΔmcyI or pFos-PbiTet-mcy-ΔmcyJ for subsequent heterologous expression studies. Fifty mL of LB medium containing 15 µg mL–1 chloramphenicol was inoculated with 0.5 mL of an overnight starter culture and grown at 30°C with shaking (200 rpm) to an OD600 of 0.4. The culture was then incubated at 18°C until it reached an OD600 of 0.5. The expression of mcy genes was induced with tetracycline (0.5 g mL–1 final concentration) and allowed to continue for 4 days. Cells were harvested by centrifugation for 20 min at 3,220 g and stored at -20°C. The supernatant was transferred to a clean flask and amberlite XAD-7 polymeric resin (2% v/v, Sigma-Aldrich) added to adsorb secreted metabolites. The resin mixture was incubated for 24 h at 18°C then fractionated by centrifugation at 3,220 g for 20 min. The sediment containing adsorbed metabolites was stored at -20°C. Extraction and structural analysis of microcystins Extraction and analysis of microcystins by liquid chromatography mass spectrometry (LCMS or LC-MS/MS) was performed according to (Liu et al., 2017).25 Briefly, cell pellets and resin sediments were thawed on ice, resuspended in 30 mL of 80% aqueous methanol solution, vortexed briefly then incubated with shaking (200 rpm) for 1 h at room temperature. The extracts were fractionated by centrifugation at 3,220 g for 20 min, and supernatants were removed and filtered through Whatman No. 1 filters (185 mm), evaporated by a Rotavapor (Welch) and resuspended in 3 mL of HPLC grade methanol. LC-MS/MS analysis of the final methanolic extracts was performed using a Q-Exactive Plus mass spectrometer coupled to a U3000 UHPLC system (ThermoFisher scientific). Protein phosphatase 2A (PP2A) inhibition assay PP2A inhibition by heterologously produced microcystins was measured using a colorimetric microtiter plate assay as described previously25 using 10 µL of methanolic E. coli culture extracts diluted 1:400 in deionized water. Control assays were performed without microcystin to achieve full color development (100% activity), and blank assays contained all components except the PP2A enzyme (0% activity). Author information Corresponding Author *E-mail: [email protected]. Author Contributions


11


Page 12 of 15

T.L., R.M., L.P., and B.A.N. designed the overall project. T.L., performed the mutagenesis, transcriptional analysis of the heterologous expression constructs and chemical analysis of microcystin. T.L., R.M., L.P., and B.A.N. wrote the manuscript. Notes The authors declare no competing financial interest. Acknowledgements The authors would like to thanks R. Müller for the E. coli GB2005, GB05-red, and GB05MtaA strains. This research was supported by Australian Research Council, grant LP140100642 and Diagnostic Technology P/L. T.L. was funded by the China Scholarship Council (CSC). References (1) Carmichael, W. W., Beasley, V., Bunner, D. L., Eloff, J. N., Falconer, I., Gorham, P., Harada, K. ichi, Krishnamurthy, T., Min-Juan, Y., Moore, R. E., et al. (1988) Naming of Cyclic Heptapeptide Toxins of Cyanobacteria (Blue-Green Algae). Toxicon 26, 971–973. (2) Sivonen, K., Jones, G., (1999). Cyanobacterial Toxins. In Toxic Cyanobacteria in Water: A Guide to Their Public Health Consequences, Monitoring and Management; Chorus, I., Bartram, J., Eds.; WHO E & FN Spon: London, UK. (3) Pearson, L., Mihali, T., Moffitt, M., Kellmann, R., Neilan, B. (2010) On the Chemistry, Toxicology and Genetics of the Cyanobacterial Toxins, Microcystin, Nodularin, Saxitoxin and Cylindrospermopsin. Mar. Drugs 8, 1650–1680. (4) Cullen, A., Pearson, L. A., Soeriyadi, A. H., Ongley, S. E., Mazmouz, R., Neilan, B. A. (2018) Natural Product Reports Heterologous Expression and Biochemical Characterisation of Cyanotoxin Biosynthesis Pathways. DOI: 10.1039/C8NP00063H. (5) MacKintosh, C., Beattie, K. A., Klumpp, S., Cohen, P., Codd, G. A. (1990) Cyanobacterial Microcystin-LR Is a Potent and Specific Inhibitor of Protein Phosphatases 1 and 2A from Both Mammals and Higher Plants. FEBS Lett. 264, 187– 192. (6) Honkanen, R. E., Zwiller, J., Moore, R. E., Daily, S. L., Khatra, B. S., Dukelow, M., Boynton, A. L. (1990) Characterization of Microcystin-LR, a Potent Inhibitor of Type 1 and Type 2A Protein Phosphatases. J. Biol. Chem. 265, 19401–19404. (7) Jochimsen, E. M., Carmichael, W. W., An, J., Cardo, D. M., Cookson, S. T., Holmes, C. E. M., Antunes, M. B., de Melo Filho, D. A., Lyra, T. M., Barreto, V. S. T., et al. (1998) Liver Failure and Death after Exposure to Microcystins at a Hemodialysis Center in Brazil. N. Engl. J. Med. 338, 873–878. (8) Carmichael, W. W., Azevedo, S. M. F. O., An, J. S., Molica, R. J. R., Jochimsen, E. M., Lau, S., Rinehart, K. L., Shaw, G. R., Eaglesham, G. K. (2001) Human Fatalities Form Cyanobacteria: Chemical and Biological Evidence for Cyanotoxins. Environ. Health Perspect. 109, 663–668. (9) Nishiwaki-Matsushima, R., Ohta, T., Nishiwaki, S., Suganuma, M., Kohyama, K., Ishikawa, T., Carmichael, W. W., Fujiki, H. (1992) Liver Tumor Promotion by the Cyanobacterial Cyclic Peptide Toxin Microcystin-LR. J. Cancer Res. Clin. Oncol. 118, 420–424. (10) Falconer, I. R. (1991) Tumor Promotion and Liver Injury Caused by Oral Consumption of Cyanobacteria. Environ. Toxicol. Water Qual. 6, 177–184. (11) Botes, D. P., Tuinman, A. A., Wessels, P. L., Viljoen, C. C., Kruger, H., Williams, D.


12

Page 13 of 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(12)

(13) (14) (15) (16) (17) (18)

(19) (20)

(21) (22) (23)

(24)

(25) (26)

H., Santikarn, S., Smith, R. J., Hammond, S. J. (1984) The Structure of CyanoginosinLA, a Cyclic Heptapeptide Toxin from the Cyanobacterium Microcystis Aeruginosa. J. Chem. Soc. Perkin Trans. 1, 2311–2318. Botes, D. P., Wessels, P. L., Kruger, H., Runnegar, M. T. C., Santikarn, S., Smith, R. J., Barna, J. C. J., Williams, D. H. (1985) Structural Studies on Cyanoginosins-LR, YR, -YA, and -YM, Peptide Toxins from Microcystis Aeruginosa. J. Chem. Soc. Perkin Trans. 1, 2747–2748. Meriluoto, J., Lisa, S. and Codd, G. A., Eds. (2017) Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Wiley. Sivonen, K. (1996) Cyanobacterial Toxins and Toxin Production. Phycologia 35, 12– 24. Chorus, I., Bartram, J., Eds. (2000) Toxic Cyanobacteria in Water. A Guide to Their Public Health Consequences, Monitoring, and Management. World Health Organization. Sieber, S. A., Marahiel, M. A. (2005) Molecular Mechanisms Underlying Nonribosomal Peptide Synthesis: Approaches to New Antibiotics. Chem. Rev. 105, 715–738. Fischbach, M. A., Walsh, C. T. (2006) Assembly-Line Enzymology for Polyketide and Nonribosomal Peptide Antibiotics: Logic Machinery, and Mechanisms. Chem. Rev. 106, 3468–3496. Walsh, C. T., Chen, H., Keating, T. A., Hubbard, B. K., Losey, H. C., Luo, L., Marshall, C. G., Miller, D. A., Patel, H. M. (2001) Tailoring Enzymes That Modify Nonribosomal Peptides during and after Chain Elongation on NRPS Assembly Lines. Curr. Opin. Chem. Biol. 5, 525. Samel, S. A., Marahiel, M. A., Essen, L. O. (2008) How to Tailor Non-Ribosomal Peptide Products-New Clues about the Structures and Mechanisms of Modifying Enzymes. Mol. Biosyst. 4, 387–393. Sielaff, H., Dittmann, E., Tandeau de Marsac, N., Bouchier, C., von Döhren, H., Börner, T., Schwecke, T. (2003) The McyF Gene of the Microcystin Biosynthetic Gene Cluster from Microcystis Aeruginosa Encodes an Aspartate Racemase. Biochem. J. 373, 909–916. Pearson, L. A., Barrow, K. D., Neilan, B. A. (2007) Characterization of the 2Hydroxy-Acid Dehydrogenase McyI, Encoded within the Microcystin Biosynthesis Gene Cluster of Microcystis Aeruginosa PCC7806. J. Biol. Chem. 282, 4681–4692. Christiansen, G., Fastner, J., Erhard, M., Börner, T., Dittmann, E. (2003) Microcystin Biosynthesis in Planktothrix: Genes, Evolution, and Manipulation. J. Bacteriol. 185, 564–572. Pearson, L. A., Hisbergues, M., Börner, T., Dittmann, E., Neilan, B. A. (2004) Inactivation of an ABC Transporter Gene, McyH, Results in Loss of Microcystin Production in the Cyanobacterium Microcystis Aeruginosa PCC 7806. Appl. Environ. Microbiol. 70, 6370–6378. Ongley, S. E., Bian, X., Zhang, Y., Chau, R., Gerwick, W. H., Müller, R., Neilan, B. A. (2013) High-Titer Heterologous Production in E. Coli of Lyngbyatoxin, a Protein Kinase C Activator from an Uncultured Marine Cyanobacterium. ACS Chem. Biol. 8, 1888–1893. Liu, T., Mazmouz, R., Ongley, S. E., Chau, R., Pickford, R., Woodhouse, J. N., Neilan, B. A. (2017) Directing the Heterologous Production of Specific Cyanobacterial Toxin Variants. ACS Chem. Biol. 12, 2021–2029. Liu, T., Mazmouz, R., Neilan, B. A. (2018) An in Vitro and in Vivo Study of BroadRange Phosphopantetheinyl Transferases for Heterologous Expression of


13


(27)

(28)

(29)

(30) (31)

(32) (33)

(34) (35)

(36)

(37)

(38)

Page 14 of 15

Cyanobacterial Natural Products. ACS Synth. Biol. 7, 1143–1151. Simmons, T. L., Coates, R. C., Clark, B. R., Engene, N., Gonzalez, D., Esquenazi, E., Dorrestein, P. C., Gerwick, W. H. (2008) Biosynthetic Origin of Natural Products Isolated from Marine Microorganism-Invertebrate Assemblages. Proc. Natl. Acad. Sci. 105, 4587–4594. Tillett, D., Dittmann, E., Erhard, M., Von Döhren, H., Börner, T., Neilan, B. A. (2000) Structural Organization of Microcystin Biosynthesis in Microcystis Aeruginosa PCC7806: An Integrated Peptide-Polyketide Synthetase System. Chem. Biol. 7, 753– 764. Dittmann, E., Neilan, B. A., Erhard, M., von Döhren, H., Börner, T. (1997) Insertional Mutagenesis of a Peptide Synthetase Gene That Is Responsible for Hepatotoxin Production in the Cyanobacterium Microcystis Aeruginosa PCC 7806. Mol. Microbiol. 26, 779–787. Nishizawa, T., Asayama, M., Shirai, M. (2001) Cyclic Heptapeptide Microcystin Biosynthesis Requires the Glutamate Racemase Gene. Microbiology 147, 1235–1241. Noguchi, T., Shinohara, A., Nishizawa, A., Asayama, M., Nakano, T., Hasegawa, M., Harada, K., Nishizawa, T., Shirai, M. (2009) Genetic Analysis of the Microcystin Biosynthesis Gene Cluster in Microcystis Strains from Four Bodies of Eutrophic Water in Japan. J. Gen. Appl. Microbiol. 55, 111–123. Dittmann, E., Fewer, D. P., Neilan, B. A. (2013) Cyanobacterial Toxins: Biosynthetic Routes and Evolutionary Roots. FEMS Microbiol. Rev. 37, 23–43. Humbert, J. F., Barbe, V., Latifi, A., Gugger, M., Calteau, A., Coursin, T., Lajus, A., Castelli, V., Oztas, S., Samson, G., et al. (2013) A Tribute to Disorder in the Genome of the Bloom-Forming Freshwater Cyanobacterium Microcystis Aeruginosa. PLoS One 8, e70747. Alexova, R., Haynes, P. A., Ferrari, B. C., Neilan, B. A. (2011) Comparative Protein Expression in Different Strains of the Bloom-Forming Cyanobacterium Microcystis Aeruginosa. Mol. Cell. Proteomics 10, M110.003749. Zilliges, Y., Kehr, J. C., Meissner, S., Ishida, K., Mikkat, S., Hagemann, M., Kaplan, A., Börner, T., Dittmann, E. (2011) The Cyanobacterial Hepatotoxin Microcystin Binds to Proteins and Increases the Fitness of Microcystis under Oxidative Stress Conditions. PLoS One 6, e17615. Walker, J. E., Saraste, M., Runswick, M. J., Gay, N. J. (1982) Distantly Related Sequences in the Alpha- and Beta-Subunits of ATP Synthase, Myosin, Kinases and Other ATP-Requiring Enzymes and a Common Nucleotide Binding Fold. EMBO J. 1, 945–951. Ikehara, T., Imamura, S., Sano, T., Nakashima, J., Kuniyoshi, K., Oshiro, N., Yoshimoto, M., Yasumoto, T. (2009) The Effect of Structural Variation in 21 Microcystins on Their Inhibition of PP2A and the Effect of Replacing Cys269 with Glycine. Toxicon 54, 539–544. Fu, J., Wenzel, S. C., Perlova, O., Wang, J., Gross, F., Tang, Z., Yin, Y., Stewart, A. F., Müller, R., Zhang, Y. (2008) Efficient Transfer of Two Large Secondary Metabolite Pathway Gene Clusters into Heterologous Hosts by Transposition. Nucleic Acids Res. 36, e113.


14

Page 15 of 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Graphical abstract


15

Mutagenesis of the Microcystin Tailoring and Transport Proteins in a

Recommend Documents