Chem. Res. Toxicol. 2007, 20, 975-981
975
Mutation of Cysteine Residue 455 to Alanine in Human Topoisomerase IIr Confers Hypersensitivity to Quinones: Enhancing DNA Scission by Closing the N-Terminal Protein Gate† Ryan P. Bender‡ and Neil Osheroff*,‡,§ Departments of Biochemistry and Medicine (Hematology/Oncology), Vanderbilt UniVersity School of Medicine, NashVille, Tennessee 37232-0146 ReceiVed February 20, 2007
Several quinone-based metabolites of industrial and environmental toxins are potent topoisomerase II poisons. These compounds act by adducting the protein, and previous studies suggest that they increase levels of enzyme-associated DNA strand breaks by at least two potential mechanisms. Quinones act directly on the DNA cleavage-ligation equilibrium of topoisomerase II by inhibiting the rate of ligation. They also block the N-terminal gate of the protein, thereby stabilizing topoisomerase II in its “closed clamp” form and trapping DNA in the central annulus of the enzyme. It has been proposed that this latter activity enhances DNA cleavage by increasing the population of enzyme molecules with DNA in their active sites, but a causal relationship has not been established. In order to more fully characterize the mechanistic basis for quinone action against topoisomerase II, the present study characterized the sensitivity of human topoisomerase IIR carrying a Cys455fAla mutation (top2RC455A) toward quinones. Cys455 was identified as a site of quinone adduction by mass spectrometry. The mutant enzyme was ∼1.5-2-fold hypersensitive to 1,4-benzoquinone and the polychlorinated biphenyl quinone 4′Cl-2,5pQ, but it displayed wild-type sensitivity to traditional topoisomerase II poisons. The ability of 1,4benzoquinone to inhibit DNA ligation mediated by top2RC455A was similar to that of wild-type topoisomerase IIR. However, the quinone induced ∼3 times the level of clamp closure with the mutant enzyme. These findings strongly support the hypothesis that the ability of quinones to block the N-terminal gate of the type II enzyme contributes to their actions as topoisomerase II poisons. Introduction Topoisomerase IIR is an essential enzyme that plays important roles in DNA replication and chromosome segregation. The enzyme relaxes, unknots, and untangles DNA by passing a double helix through a transient double-stranded break that it generates in a separate segment of DNA (1-7). To maintain genomic integrity during this process, topoisomerase IIR forms covalent bonds between active-site tyrosyl residues and the 5′DNA termini created by scission of the double helix (8-10). The covalent enzyme-cleaved DNA complex that results is known as the cleaVage complex. When DNA tracking enzymes such as polymerases or helicases collide with these complexes, they convert them to permanent enzyme-linked double-stranded breaks in the genetic material (1-7). These breaks destabilize the genome, leading to illegitimate recombination and the formation of chromosomal aberrations. When present in sufficient concentrations, they trigger programmed cell death pathways (4, 11-17). Agents that increase levels of topoisomerase IIR-mediated DNA strand breaks are called topoisomerase II poisons (4, 15, 18-20). Some topoisomerase II poisons, such as etoposide, doxorubicin, and mitoxantrone, are important anticancer drugs that are used to treat a wide variety of human malignancies. † This work was supported by National Institutes of Health Research Grant GM33944 (N.O.). R.P.B. was a trainee under Grant 5 T32 CA09582 from the National Institutes of Health. * To whom correspondence should be addressed: tel 615-322-4338; fax 615-343-1166; e-mail
[email protected]. ‡ Department of Biochemistry. § Department of Medicine (Hematology/Oncology).
However, a small percentage of patients who receive therapy with these agents eventually develop secondary leukemias that feature aberrations in the mixed-lineage leukemia (MLL) gene at chromosomal band 11q23 (13, 14, 21-26). Other topoisomerase II poisons, such as the bioflavonoids (naturally found in fruits and vegetables), display chemopreventative properties in adults (27-30). In contrast, when ingested during pregnancy, they are believed to increase the risk of infant leukemias that include MLL rearrangements (31-35). In addition to pharmaceutical agents and natural products, quinone metabolites of some industrial and environmental toxins, such as 1,4-benzoquinone [a reactive metabolite of benzene (36)] (37, 38) and a variety of PCB1 (polychlorinated biphenyl) quinone metabolites (39), act as topoisomerase II poisons. These highly reactive compounds are produced in the body as a result of detoxification or metabolism pathways (36, 40, 41). Cellular exposure to 1,4-benzoquinone or PCB quinones generates DNA strand breaks and other chromosomal aberrations and has been linked to a variety of human health problems, including cancer (42-46). Furthermore, the accumulation of 1,4-benzoquinone in the bone marrow is believed to contribute to the leukemogenic properties of benzene, including leukemias that feature MLL rearrangements (43). Quinones are unique among characterized topoisomerase II poisons in that their activity requires covalent attachment to the enzyme (37-39, 47-49). Although adduction inhibits the 1 Abbreviations: PCB, polychlorinated biphenyl; 4′Cl-2,5pQ, 2-(4-chlorophenyl)-[1,4]benzoquinone; DMSO, dimethyl sulfoxide; Tris, tris(hydroxymethyl)aminomethane; PCR, polymerase chain reaction; EDTA, ethylenediaminetetraacetic acid; SDS, sodium dodecyl sulfate.
10.1021/tx700062t CCC: $37.00 © 2007 American Chemical Society Published on Web 05/22/2007
976 Chem. Res. Toxicol., Vol. 20, No. 6, 2007
ability of topoisomerase IIR to ligate DNA molecules, this inhibition cannot completely account for the increase in enzymeassociated DNA strand breaks. During the strand passage event, topoisomerase II closes an N-terminal protein gate and thereby forms a protein clamp that encircles the DNA within the central annulus of the enzyme (3-7). Quinone treatment blocks the N-terminal protein gate of topoisomerase IIR (39). It has been suggested that this latter effect contributes to the increase in topoisomerase II-associated strand breaks by trapping DNA in the active site of the enzyme (39, 49). However, evidence supporting this hypothesis is circumstantial. Recently, four sites of quinone adduction on human topoisomerase IIR, Cys170, Cys392, Cys405, and Cys455, were identified by mass spectrometry (49). While mutation of Cys170 to Ala had no effect on quinone sensitivity, parallel mutation of Cys392 or Cys405 resulted in enzymes that were partially (∼50%) resistant to 1,4-benzoquinone and the PCB quinone 4′Cl-2,5pQ (49). In both cases, mutation decreased the inhibitory effects of quinones on DNA ligation but did not affect sensitivity to clamp closing. The present study characterized topoisomerase IIR that carried a Cys f Ala mutation at residue C455 (top2RC455A). Top2RC455A was hypersensitive to 1,4-benzoquinone and the PCB quinone 4′Cl-2,5pQ. Mechanistic studies strongly suggest a causal link between the ability of quinones to close the N-terminal protein gate of topoisomerase IIR and their ability to increase levels of enzyme-generated doublestranded DNA breaks.
Experimental Procedures Enzymes and Materials. Human topoisomerase IIR was expressed in Saccharomyces cereVisiae and purified as described previously (50-52). Negatively supercoiled pBR322 DNA was prepared by use of a Plasmid Mega Kit (Qiagen) as described by the manufacturer. 1,4-Benzoquinone, etoposide, and genistein were obtained from Sigma, prepared as 20 mM stock solutions in 100% DMSO, and stored at 4 °C. The PCB quinone, 4′Cl2,5pQ (the generous gift of Dr. Hans J. Lehmler and Dr. Larry W. Robertson, University of Iowa) was synthesized by coupling 4′-chloroaniline with 1,4-benzoquinone (53). The compound was prepared as a 20 mM stock in 100% DMSO and stored at -20 °C. Amsacrine was obtained from Bristol-Myers Squibb, prepared as a 20 mM stock solution in 100% DMSO and stored at 4 °C. The quinolone CP-115,953 was the gift of Pfizer Global Research, dissolved as a 40 mM solution in 0.1 N NaOH and stored at -20 °C. Immediately prior to use, the quinolone was diluted to 8 mM with 10 mM Tris, pH 7.9. All other chemicals were of analytical reagent grade. Generation of Human Topoisomerase IIR Protein Carrying a Cys455 f A Mutation (top2RC455A). The C455A mutation in the topoisomerase IIR PCR substrate was generated by cloning a SalI-KpnI fragment of YEpWob6 (54) that encoded the N-terminus of the human enzyme into pUC18. Sitedirected mutagenesis was performed by use of the QuickChange II PCR system (Stratagene). The sequence of the forward and reverse primers used to generate the C455A mutation were CAGGGGGCCGAAACTCCACTGAGGCTACGCTTATCC and CCCTCAGTCAGGATAAGCGTAGCCTCAGTGGAGTTTCGGCCC, respectively. The mutagenized codons are underlined. The mutation was verified by sequencing and the SalI-KpnI fragment was cloned back into YEpWob6. The mutant human topoisomerase IIR enzyme (top2RC455A) was purified as described above. Cleavage of Plasmid DNA. DNA cleavage reactions were carried out by the procedure of Fortune and Osheroff (55).
Bender and Osheroff
Unless stated otherwise, assay mixtures contained 135 nM wildtype topoisomerase IIR or top2RC455A and 10 nM negatively supercoiled pBR322 DNA in a total of 20 µL of 10 mM TrisHCl, pH 7.9, 100 mM KCl, 5 mM MgCl2, 0.1 mM NaEDTA, and 2.5% glycerol that contained 0-200 µM 1,4-benzoquinone, 4′Cl-2,5pQ, or etoposide; 50 µM genistein or amsacrine; or 5 µM CP-115,953. DNA cleavage was initiated by shifting mixtures to 37 °C, and samples were incubated for 6 min to establish DNA cleavage-ligation equilibria. Enzyme-DNA cleavage intermediates were trapped by adding 2 µL of 5% SDS and 1 µL of 375 mM EDTA, pH 8.0. Proteinase K was added (2 µL of 0.8 mg/mL) and reaction mixtures were incubated for 30 min at 45 °C to digest the topoisomerase IIR. Samples were mixed with 2 µL of 60% sucrose in 10 mM Tris-HCl, pH 7.9, 0.5% bromophenol blue, and 0.5% xylene cyanol FF, heated for 15 min at 45 °C, and subjected to electrophoresis in 1% agarose gels in 40 mM Tris-acetate, pH 8.3, and 2 mM EDTA that contained 0.5 µg/mL ethidium bromide. DNA cleavage was monitored by the conversion of negatively supercoiled plasmid DNA to linear molecules. DNA bands were visualized by ultraviolet light and quantified by use of an Alpha Innotech digital imaging system. DNA Binding. Topoisomerase IIR binding to negatively supercoiled pBR322 DNA was assessed by an electrophoretic mobility shift assay (39, 56). Reaction mixtures contained 0-400 nM wild-type topoisomerase IIR or top2RC455A and 5 nM plasmid DNA molecules in 20 µL of 10 mM Tris-HCl, pH 7.9, 30 mM KCl, 0.1 mM NaEDTA, and 2.5% glycerol. Samples were incubated for 6 min at 37 °C. Following the addition of 2 µL of 60% sucrose in 10 mM Tris-HCl, pH 7.9, samples were loaded directly onto a 1% agarose gel and subjected to electrophoresis in 100 mM Tris-borate, pH 8.3, and 2 mM EDTA. Gels were stained for 30 min with 0.5 µg/mL ethidium bromide, and DNA was visualized as described above. DNA Ligation. The DNA ligation reaction of wild-type human topoisomerase IIR or top2RC455A was monitored according to the procedure of Byl et al. (57). Topoisomerase IIR DNA cleavage/ligation equilibria were established by use of a plasmid substrate as described above in the absence or presence of 100 µM 1,4-benzoquinone. DNA ligation was initiated by shifting reaction mixtures from 37 to 0 °C, and reactions were stopped by the addition of 2 µL of 5% SDS followed by 1 µL of 375 mM NaEDTA, pH 8.0. Samples were processed and analyzed as described above for topoisomerase IIR cleavage reactions. Protein Clamp Closing. Filter binding assays were used to analyze the salt-stable closed-clamp form of topoisomerase IIR (39, 58). Briefly, 5 nM wild-type human topoisomerase IIR or top2RC455A and 2 nM pBR322 were incubated for 4 min at 37 °C in a total of 90 µL of clamp closing buffer (50 mM TrisHCl, pH 8.0, 100 mM KCl, 1 mM EDTA, and 8 mM MgCl2). 1,4-Benzoquinone (10 µL of 1 mM solution in 10% DMSO) or an equivalent amount of solvent was added, and mixtures were incubated for an additional 6 min at 37 °C. Binding mixtures were loaded onto glass fiber filters (Millipore) preincubated in clamp closing buffer and filtered in vacuo. Filters were washed three times with clamp closing buffer (low-salt wash), followed by three washes with clamp closing buffer that contained 1 M NaCl (high-salt wash) and three washes with 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, and 0.5% SDS. DNA in the eluates was precipitated with 2-propanol and loaded onto a 1% agarose gel in 40 mM Tris-acetate, pH 8.3, and 2 mM EDTA that contained 0.5 µg/mL ethidium bromide. DNA was visualized and quantified as described above.
Human top2RC455A Is HypersensitiVe to Quinones
Chem. Res. Toxicol., Vol. 20, No. 6, 2007 977
Results Quinone metabolites of some industrial and environmental toxins, including 1,4-benzoquinone and PCB quinones, are potent topoisomerase II poisons in vitro and in cultured human cells (42-46). In contrast to “traditional” topoisomerase II poisons, such as etoposide and other anticancer drugs, the mechanism by which quinones increase levels of topoisomerase II-associated DNA breaks is not well understood. Quinones require adduction to the enzyme in order to act as topoisomerase II poisons, and modification of Cys392 and Cys405 inhibits the ability of topoisomerase IIR to ligate cleaved DNA molecules (37-39, 47-49). However, this inhibition does not completely account for the increase in enzyme-associated DNA strand breaks. Quinone adduction also blocks the N-terminal protein gate of topoisomerase IIR (39, 48, 49). However, the relationship between this activity and effects on DNA cleavage has not been established. Two lines of circumstantial evidence suggest that this latter effect contributes to the increase in enzyme-mediated DNA strand breaks. First, the bisdioxopiperazine, ICRF-193, is a mixed-function inhibitor of topoisomerase II that traps DNA in the central annulus of the enzyme by closing the N-terminal protein gate (59). Although this action inhibits overall catalytic activity, it leads to a modest increase in enzyme-mediated DNA cleavage (
