Myristoylation and oligonucleotide interaction modulate peptide and

Subscriber access provided by UOW Library

Interfaces: Adsorption, Reactions, Films, Forces, Measurement Techniques, Charge Transfer, Electrochemistry, Electrocatalysis, Energy Production and Storage

Myristoylation and oligonucleotide interaction modulate peptide and protein surface properties. The case of the HIV-1 matrix domain Luis B. P. Socas, and Ernesto Ambroggio Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b01005 • Publication Date (Web): 04 May 2018 Downloaded from http://pubs.acs.org on May 7, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Myristoylation and oligonucleotide interaction modulate peptide and protein surface properties. The case of the HIV-1 matrix domain Luis. B. P. Socas1, 2 and Ernesto E. Ambroggio1, 2* 1-Universidad Nacional de Córdoba. Facultad de Ciencias Químicas. Departamento de Química Biológica-Ranwel Caputto. Córdoba, Argentina. Haya de la Torre y Medina Allende s/n. Córdoba (X5000HUA), Argentina. Telephone: +543515353855 ext. 3465; FAX: +543515353855 2-CONICET. Universidad Nacional de Córdoba. Centro de Investigaciones en Química Biológica de Córdoba (CIQUIBIC), Córdoba, Argentina. Haya de la Torre y Medina Allende s/n. Córdoba (X5000HUA), Argentina. Telephone: +543515353855 ext. 3465; FAX: +543515353855 KEYWORDS: Human immunodeficiency virus, HIV-1 Gag matrix domain, HIV-1 MA-derived peptides, Oligonucleotide interaction, Protein myristoylation, Brewster-angle microscopy and Langmuir monolayers, Interfacial activity

ACS Paragon Plus Environment

1

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 41

ABSTRACT Myristoylated proteins typically develop a tight association with membranes. One example is the matrix domain (MA) of the HIV-1 Gag protein. In addition, MA is able to bind the Sel25 RNA sequence, a ligand that can act as competitor for the interaction with the membrane. These properties make HIV-1 MA an attractive molecule to understand how protein and peptide surface properties can be controlled by myristoylation and oligonucleotide interaction. In this line, we analyzed the stability, thermodynamics and the topography of Langmuir monolayers composed of the myristoylated or unmyristoylated versions of MA in the presence or the absence of a single strand DNA (ssDNASel25) analog of the Sel25 RNA sequence. With a similar approach, we compared the MA surface properties with those obtained from monolayers of myristoylated and unmyristoylated MA-derived peptides (first 21 residues of the MA sequence). Our results show that the protein, or peptide, films are destabilized by the presence of ssDNASel25, inducing solubilization of the monolayer components into the bulk phase. In addition, the oligonucleotide affects the protein-protein or peptide-peptide lateral interactions provoking interfacial topography changes of the monolayers, visualized by Brewster angle microscopy. Furthermore, we also show how the myristoyl group has major effects on the lateral stability and the elasticity of the monolayers. Altogether, here we propose a general model considering the effect of myristoylation and the interaction with oligonucleotides on the interfacial properties of MA and derived peptides. In this model, we introduce a new role of the core region of MA (sequence of MA after the 21st residue) that confers higher lateral interfacial stability to the protein.


2

Page 3 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

INTRODUCTION Several proteins, covering different biological functions, are targeted to the membrane through a covalent attachment of a myristic group at their amino-terminal, involving a specific Gly residue1. The HIV-1 Gag protein is one of these lipidated proteins. Gag contains four structural domains that become independent proteins in the mature virus2. The myristoylated N-terminal domain of Gag is named the matrix domain (MA) and it is proposed to mediate the viral assembly process at the cell membrane2-7. MA myristoylation confers stability to proteinphospholipid interactions and an incorrect trafficking of MA is observed in its absence8. In addition, it has been reported that MA strongly binds specific RNA oligonucleotides sequences, such as the 25mer RNA Sel259, thorough a highly basic region (HBR). This interaction is suggested to be part of a regulatory mechanism to avoid protein unspecific union to other cellular membranes10-11. However, there is not a clear understanding on how myristoylation and oligonucleotide interaction may control the surface properties of proteins. To tackle this question, we explored the surface behavior of films made of the HIV-1 MA protein, or derived peptides, using the Langmuir monolayer method. With this technique, it is possible to achieve interfacial protein concentrations in line with those observed in cellular membranes12-13. In addition, it also allows efficiently controlling the interfacial composition, lateral packing and external conditions. Coupled to Brewster angle microscopy (BAM), this setup permits to topographically characterize the protein monolayer. At the Brewster angle, light with a particular polarization is totally transmitted through a transparent dielectric surface (i.e. air-water interface) with no reflection. When there is a monomolecular film, the interfacial refractive index changes and reflection appears. This signal could be correlated to the thickness of a film when the refractive index is known14.


3

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 41

From these bases, we present this work in where we study how the existence of the myristoyl group and the interaction with a specific oligonucleotide sequence impact to the surface behavior of MA. The oligonucleotide used as a model is a single strand DNA analog of the abovementioned Sel25 RNA whose only difference is the lack of the hydroxyl group on the 2’ carbon of the sugar, making it a more stable molecule to work with in our experimental setup (since RNA is very susceptible to degradation)15 and in line with the exact sequence, the calculated secondary folding for this DNA molecule was the same as that for Sel25 (not shown). In our experiments, we analyzed the lateral compression-expansion isotherms of protein Langmuir monolayers, at the air/buffer interface, measuring the change of the lateral surface pressure and the surface potential for myristoylated (myrMA) or unmyristoylated MA. With the use of the BAM technique, we directly visualized how the topography of these films depends on the previously mentioned variables. In addition, we used the same approach for myristoylated and unmyristoylated peptides (myrMANT and MANT, respectively) with a primary sequence equal to the first 21 residues of the N-terminus of Gag, since this N-terminal part of MA presents the main membrane-binding region (myristoylated N-terminus) plus a part of the HBR region

16

.

From our results, we propose a model that generalizes how protein myristoylation and oligonucleotide binding regulate the interfacial properties of the Gag matrix domain.


4

Page 5 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

EXPERIMENTAL SECTION Materials and reagents HIV-1 MA, as well as the myristoylated version (myrMA), were expressed in Escherichia coli strain BL21 (DE3) transformed with pET-11a-based vectors kindly provided by Michael F. Summers (University of Maryland Baltimore County) and purified as described in previous works

17-18

. Briefly, MA was co-expressed along with the Saccharomyces cerevisiae N-

myristoyltransferase and, in this case, myristic acid was included in the bacterial growth media during the induction phase. Both, MA and myrMA proteins, contain a 6His tag in order to use a Ni-NTA affinity chromatography as a capture step, which was followed with an intermediate purification by either an SP-HiTrap cation exchange chromatography for MA or a butyl-HiTrap hydrophobic interaction chromatography for myrMA. Before each experiment, a final purification step by molecular exclusion chromatography was performed using a Superdex 75 HR column equilibrated with 20 mM Tris buffer 500 mM NaCl, pH 7.4. The production of unmyristoylated and myristoylated proteins was corroborated by mass spectrometry (see supporting information, Fig. S5 and S6). MANT

[GARASVLSGGELDKWEKIRLR-NH2]

and

myrMANT

[myr-

GARASVLSGGELDKWEKIRLR-NH2] peptides were purchased from Biomatik USA, LLC (USA, DE). The purity of the peptides, judged by HPLC, was greater than 95%. The samples used for the experiments were prepared diluting the peptides in 30% acetonitrile (ACN, as recommended by the provider) and the final concentration was determined by UV absorption spectroscopy ( = 5690 · ). The

single

strand

DNA

sequence

used

in

this

work

(ssDNASel25;

5’GGACAGGAAUUAAUAGUAGCUGUCC3’) was designed based on the sequence of Sel25 RNA, a ligand that binds to the HIV-1 Gag matrix protein with high affinity

9, 17

. This


5

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 41

oligonucleotide was obtained from Invitrogen (USA) and it has the exact same nucleotide sequence (uracil included) but lacks on the 2’-hydroxyl group of the ribose sugar, which makes it less susceptible for RNases activity. In addition to the untagged ssDNASel25, we procured a FITC tagged version of ssDNASel25, covalently linked in the 5' extreme. For the experiments presented in this work, the oligonucleotide was diluted in DNase-free and RNase-free water. In order to corroborate the binding of ssDNASel25 to MA and myrMA we measured the anisotropy of FITC-ssDNASel25 in the absence and presence of different amounts of protein. On the other hand, the interaction of ssDNASel25 with the N-terminal MA-derived peptides was detected setting up a peptide/oligonucleotide electrophoretic mobility shift assay in agarose gels (see supporting information).

Langmuir monolayer For the Langmuir monolayer studies, a control unit Monofilmmeter (with Film Lift, Mayer Feintechnique, Germany) was used. The surface pressure (Π) was measured using the Wilhelmy method with a Platinized-Pt plate and the surface potential (∆V) was detected with an airionizing

241

Am plate and calomel electrode pair using a milli-Voltmeter. The data were

continuously and simultaneously registered with a double channel X-YY recorder. The total surface area range of the Langmuir trough was 12 - 80 cm2. Monolayers were formed by spreading ~3.3 nmol of protein/peptide directly onto the surface of a 75mL aqueous sub-phase (20 mM Tris buffer 145 mM NaCl, pH 7.4). For the experiments in the presence of ssDNASel25, the samples were pre-incubated with ~16.6 nmol of oligonucleotide. Monolayer experiments under denaturing conditions were performed by adding urea to the desired concentration into both sample and sub-phase buffers. Control measurements for the clean surface, the peptide/protein solvents and the ssDNASel25 alone were carried out and neither case showed


6

Page 7 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

surface activity. Several compression-expansion cycles were performed at a fixed rate of ~0.0475 nm2·molecule-1·s-1. The temperature of the laboratories is maintained by airconditioning and all experiments were performed at 23 ± 2 °C. All data presented is the average of, at least, 3 independent experiments. The surface compressional modulus (KS, in-plane elasticity) and the resultant dipole moment perpendicular to the interface (μ ) for each mean molecular area (A) were directly calculated from the Π and ∆V isotherms according to14, 19: = − × =

Π

1 × × Δ! 12

From these curves, we define three parameters used to characterize different aspects of the monolayers: •

The maximum value of the surface compressional modulus (K &#$% ) and its respective molecular area (A(,

)*+

), which represents the point of highest lateral response of the

monolayer against the change in area (i.e. the inflection point of the Π – A isotherm) and, therefore, indicates the highest elasticity of the film. •

The highest value of the dipole moment perpendicular to the interface (μ#$% ), whose variations can be related to: an interfacial reorientation of the molecules, to structural changes of the proteins/peptides and/or to molecular interactions.

•

The Π – A isotherm critical point (ΠC and its respective area AC) that characterizes a reorganization of the film due to a transition, either on the two-dimensional space (molecular phase transition) or from the two-dimensional to the three-dimensional space (collapse). The ΠC and AC values correspond to the point in which the following


7

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 41

expression reaches a global minimum (i.e. highest negative curvature of the compression isotherm):

3

- .1 + 0 1 2 In addition, the Π – A isotherms allow to calculate the free energy of hysteresis, defined as the difference between the free energy of the monolayer expansion (∆5678 ) and compression (∆59:; ), according to 20: ∆5

Π?@678 A − > Π?@9:; A BD

BD

In this work, we quantify the difference of two Π – A compression isotherms performing a nonlinear fitting between the curve of interest (INT) and a reference (REF) isotherm according to: EFG ?Π@ = Λ × I6J ?Π@

Here we define Λ as a “distance” factor between the curves, while the coefficient of determination of the fitting (r2) can be used as a measure of the difference in the shape of the curves. For example, if the interest compression isotherm is the result of molecular solubilization respect to the reference curve, r2 should be close to 1 and Λ < 1.

Brewster angle microscopy The evaluation of the monolayer topography was carried out by BAM with an auto-nulling imaging ellipsometer (Nanofilm EP3sw imaging ellipsometer, Accurion GmbH, Germany) equipped with a 532 nm laser, 20X objective and a CCD camera, at room temperature. Because a p-polarized light is used, the equipment can be calibrated to find the actual Brewster angle of the sub-phase by measuring the intensity of reflected light at several angles of incidence. The light


8

Page 9 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

reflectivity (denoted RP) can be associated with the film thickness14 and for within the same image, a relative thickness can be defined as: LMNOPQRM PℎQTUMVV =

WL8

WL8I6J

where L8I6J is a defined reference reflectivity. In this work, we use as L8I6J the minimum value for each interest region of the images analyzed. The brightness and contrast of the shown images have been modified in order to have a better visualization of the topography of the films, but all the analysis discussed were made with the raw images using the ImageJ software.

Fluorescence measurements In order to characterize the MA and myrMA protein denaturation we measured the changes in the tryptophan emission fluorescence upon different amounts of urea (chaotropic agent). These experiments were carried out with a Cary Eclipse Spectrofluorimeter (USA) using an excitation wavelength of 295 nm and recording the emission spectrum from 300 to 450 nm, at room temperature. The samples were prepared by pre-incubating the proteins with different concentration of urea (from 0 to 8 M). The maximum of the emission spectra is calculated by single-peak Gaussian function fitting. All measurements were independently repeated three times. The procedures for the fluorescence anisotropy assay to detect protein/DNA interaction and light scattering performed to monitor peptide aggregation are described in the supporting information.

ATR-FTIR ATR-FTIR spectra were recorded on a Nexus IR spectrophotometer (Nicolet) equipped with a single reflection diamond reflectance accessory (Golden Gate, Specac) and purged with dry air to


9

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 41

reduce water vapor distortions. Protein and peptides samples were spread onto the surface of a diamond crystal and flushed with nitrogen. A total of 64 accumulations were recorded using a nominal resolution of 2 cm−1 at room temperature. In order to diminish the buffer/salt distortion to the IR profiles the buffer of MA and myrMA protein samples was diluted 600 times by sequential centrifugations in a 10 KDa cut-off Amicon filter (Millipore). Peptide samples were directly measured from their ACN stock solution and, also, in the presence of 70% 1,1,1,3,3,3hexafluor-2-propanol (HFIP). After subtracting the water vapor and side chain contributions, the spectra were baseline corrected and area normalized between 1600 and 1700 cm−1. The identification of overlapping bands was carried out by Fourier transform self-deconvolution and second-derivative analysis. The position and number of the detected components were used as initial parameter for a least squares iterative curve fitting of the original spectra, using mixed Gaussian–Lorentzian band shapes. Fitting parameters were constrain within physically plausible ranges expected for each type of secondary structure

21

. All data were processed and analyzed

using the Kinetics software (SFMB, Brussels, Belgium).


10

Page 11 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

RESULTS AND DISCUSSION Behavior of MANT and myrMANT peptides Interfacial properties In order to characterize the surface behavior of MANT peptides, in the presence or absence of the ssDNASel25 oligonucleotide, Langmuir monolayer compression experiments were carried out. This approach is widely used to describe molecular properties of peptides and proteins where information about the molecular state, dynamics, structural organization and orientation on the surface, as well as the thermodynamic response to external perturbation, like compression and expansion of the monolayer, can be obtained

19, 22-24

. In addition, the variation of the film

properties through consecutive compression-expansion cycles is indicative of possible changes of the lateral organization, physical state and molecular orientation of the components of the monolayer. Furthermore, this type of analysis is used to corroborate possible solubilization of molecules into the bulk phase, which is related to the monolayer stability 14, 24-25. Fig. 1 shows the change in the lateral pressure (Π, Fig. 1A) and the perpendicular component of the molecular dipole moment (μ , Fig. 1B) for the isothermal lateral compression of monolayers composed of MANT or myrMANT peptides. In absence of ssDNASel25, it is possible to notice that the profile of the lateral pressure during compression is very different between the peptides. Pure MANT monolayers show a small increase of Π where the critical point (Πc) is found at ~9 mN·m-1 (Fig. 1E). Since, after Πc, the isotherm becomes almost flat

20

this indicates that the

monolayer starts collapsing at ~2.8 nm2·molecule-1 (Fig. 1F). Instead, the compression isotherm of the myrMANT peptide monolayer presents a lift-off at a lower molecular area and reaches higher lateral pressure values, collapsing at ~25 mN·m-1 depicting a more stable film against lateral stress (Fig. 1E, F). The analysis of the KS values also shows differences on the surface


11

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 41

behavior, being higher for the myristoylated peptide (~62 mN·m-1) compared to the unmyristoylated (~34 mN·m-1, Fig. 1C). These data indicate that the presence of the myristoyl group favors the formation of a more elastic monolayer. In addition, MANT peptide reaches higher values of μ with respect to myrMANT (Fig. 1D), meaning that either their orientation on the surface or their intrinsic dipole moment are different. In this sense, the observed dissimilarities point out that the presence of the myristoyl group have a major effect on the surface behavior of the peptide, which could be due to its own contribution to the measured surface properties or to an induced structural change. Intriguingly, in the presence of ssDNASel25 the surface behavior of the peptides is markedly different (the peptide-oligonucleotide interaction was corroborated by an electrophoretic motility shift assay; see supporting information section, Fig. S2). The ssDNASel25/MANT monolayers reach a higher collapse pressure value (~13 mN·m-1, Fig. 1E) shifted toward a smaller area (~2.2 nm2·molec-1, Fig. 1F) in comparison to the monolayer of the pure peptide, which could suggest a reduction of the number of molecules on the surface. Additionally, the values of μ also decrease possible due to differences in the global dipole moment of the ssDNA-peptide complex with respect to the pure peptides. On the other hand, a striking effect of the oligonucleotide is perceived when interacts with the myrMANT peptide. The ssDNASel25/myrMANT monolayers develop such a reduction of all the above described properties denoting a total absence of a stable film. This can be interpreted as a maximization of a solubilizing effect caused by the presence of the oligonucleotide. The existence of myrMANT aggregates visualized in our electrophoretic motility shift assay (Fig. S2) let us suggest that soluble particle/nucleotide formation is responsible of the absence of a stable film. The particle formation was also confirmed by light scattering experiments (see supporting information, Fig. S3). In line with our monolayer


12

Page 13 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

analysis, such structures can provoke a massive peptide-DNA interaction increasing the number of peptide molecules dragged into the bulk phase from the interface. Fig. 1G shows the Λ factor calculation for several interest-reference isotherms. When two identical isotherms are compared, Λ is expected to be equal to 1.0 (as so would be the r2 of the fitting). If the isotherms present the same shape (r2 is close to 1) then a deviation of Λ quantitatively indicates a shift of the curves toward less (Λ < 1) or high (Λ > 1) molecular areas. One possible reason to such deviations is a change in the number of molecules on the surface, which could lead to an under or overestimation of the molecular area and, therefore, resulting in the proportional shift of the curve. If the isotherms do not fit well (r < 1), due to differences in the shape of the compared curves, may be an indication of a structural change, lateral rearrangements, molecular transitions, etc. In this case, the Λ value still qualitatively points out an overall shift. In this sense, the first set of bars in Fig. 1G denotes the Λ value obtained for the peptide monolayers using the one in the absence of ssDNASel25 as reference. Here, it is possible to notice that for both peptides the value decreases in presence of the oligonucleotide, which is marked for myrMANT in concordance with the aforementioned solubilization effect. However, as it is expected, the r2 values of those fittings are very low given the already denoted differences between the behavior of the monolayers in presence and absence of ssDNASel25. Another useful information obtained from the Λ factor calculation is the variability of the monolayer behavior through several compression-expansion cycles. The Fig. 1G shows the Λ value for the 2nd, 3rd and 4th compression using the 1st one as reference. For the case of MANT, the value of Λ decreases from cycle to cycle in both, presence and absence of ssDNASel25. This might point out that the number of molecules at the interface is reducing, indicating the formation of less stable monolayers not able to resist lateral compression work. In addition, when


13

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 41

the 1st compression isotherm is used as reference the r2 values are low (around 0.70 – 0.80) but, when the same analysis is made using the 2nd compression as reference, this value is highly improved (above 0.95, not shown). This means that, besides a reduction of the number of molecules, a change of the film properties also occur between the first and further compression, which is confirmed by BAM technique (see below). In the case of pure myrMANT films, the Λ value faintly increases on the first cycles and remains almost invariant later on. This may mean that for the first compressions some myrMANT molecules are not entirely contributing to the measured properties probably because they are forming particles that disaggregate from cycle to cycle (discussed in the BAM section). For ssDNASel25/myrMANT films, where there is a complete absence of a stable monolayer in the first compression, an increase of Λ is determined (Fig. 1G). This suggests that once the peptide/DNA complex is in the bulk phase, some free peptide can partition into the interface (re-adsorption effect). When a monolayer suffers compression-expansion cycles, it can develop a hysteretic behavior because of the balance among molecular lateral interactions and the viscoelastic properties of the interface. If the energy and kinetics processes required for intermolecular cohesion during compression and molecular dispersion upon expansion are different, then diverse molecular arrangements can be obtained. This phenomenon is thermodynamically characterized by the free energy change of the process, ∆GHYS, which is indicative of either the energy trapped as kinetically limited viscoelasticity effects or as cohesive energy in the monolayer, or a combination of both

19, 26

. The MA-derived peptide monolayers develop a high hysteresis

phenomenon (see Fig. S4 on the supporting information), indicating that these molecules are susceptible to interfacial re-arrangements. In the case of MANT films, the hysteresis effect reaches a stable value of ∆GHYS after the 3rd compression-expansion cycle (~ -2 kcal·mol-1). This


14

Page 15 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

fact indicates that, although the film composition might be changing due to solubilization through compression-expansion cycles, the molecular lateral arrangement and cohesive properties are not. In the presence of the ssDNASel25 this hysteresis phenomenon remains similar, which means that its effect on the surface behavior does not affect the thermodynamics of the compression-expansion process. In the case of the myristoylated peptide the highest values of ∆GHYS were observed (more negative), reaching values of ~ -6 kcal·mol-1 from the 3rd cycle on. This remarkable hysteresis occurrence can be attributed to the presence of the myristoyl group, which may increase molecular cohesions and the viscoelasticity of the peptide films.

Topographical properties BAM is a technique based on the reflection of light at interfaces and it has been mainly used to observe and characterize the lateral organization and topography of Langmuir monolayers

27

.

BAM also gives direct information about the density of the interfacial layer and the change of the monolayer thickness within other optical properties 14, 19, 23. The BAM experiments observing MANT peptide monolayers, in the presence or the absence of ssDNASel25, show a continuous interfacial topography with no significant change of its reflectivity during the first compression cycle (Fig. 2). However, from the first expansion on, a major change of the topography occurs, where “fiber-like” domains with marked reflectivity appear. These results are in concordance with the high free energy of hysteresis and the low values obtained for r2 in the Λ factor calculation, demonstrating that there is a molecular configurational change between the first and second compression. In the presence of the oligonucleotide, the same effect is noticed although, in this case, the fibrillary domains look slightly bigger and smoother. In order to quantify this effect, we calculated the counting-box fractal dimension for the contour of these domains from several images, obtaining values of 1.45


15

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 41

± 0.05 and 1.58 ± 0.04 for the presence and absence of the oligonucleotide, respectively. The smaller value of this parameter indicates the lesser roughness of the contour 28. Clear-cut differences on the monolayer topography are evidenced for myrMANT peptide monolayers respect to the unmyristoylated one (Fig. 3). In the absence of ssDNASel25 there is an overall reflectivity increase tendency and a continuous topography of the peptide film. Moreover, the presence of small diffuse-shape domains with high reflectivity can be noticed. The relative thickness of these domains is approximately 6-fold higher than the rest of the monolayer and this could be related with the already considered presence of peptide aggregates on the surface. Interestingly, after several compression-expansion cycles there is a reduction of the area occupied by these domains along the cycles (4% in the first compression and 1% in the second). This result agrees with the possibility that interfacial aggregates are reduced on further cycles, accompanied with an increment of the lateral surface pressure (as shown in Fig. 1G with the Λ factor values). In the presence of ssDNASel25, the reflectivity measurements indicate that the monolayer completely vanished during the first compression. Nevertheless, after several compression-expansion cycles, small domains with distinctive reflectivity start to appear (Fig. 3). This might point out a re-adsorption process of peptides from the bulk solution towards the surface as proposed before.

Structural analysis In order to understand if the differences in the surface behavior of the myristoylated and unmyristoylated peptides are due to structural discrepancies, we performed ATR-FTIR experiments. This technique is widely used to study protein and peptide structure in a highly concentrated and poorly hydrated state, similar to the water-air interface of the Langmuir monolayer experiments. The amide I absorption band, located between 1700 and 1600 cm−1 of


16

Page 17 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

light wavenumber, represents predominantly the C=O stretching of the peptide bond and it is sensitive to the secondary structure since the frequency of the vibrations depends on the relative orientations, distances and phases of the coupled oscillating dipoles of neighboring groups 29-32. Fig. 4 shows the amide I region of the ATR-FTIR absorption spectra of MANT and myrMANT peptides where it is possible to observe that their secondary structure is different. The unmyristoylated peptide exhibits a predominant α-helix structure, while the myristoylated one displays mainly an anti-parallel β-sheet structure

21, 31, 33

(Fig. 4 and Table 1). We attribute this

difference to the higher hydrophobicity given by the myristoyl group, driving the aggregation of peptides into particles and allowing an inter-molecular β-sheet arrangement. Similar effects have been described for N-terminal acylated peptides, in where the nature of the modifying group has a key role on the secondary structure assembly34. Furthermore, these structural differences explain the marked dissimilarities detected in the Langmuir monolayer experiments because, as it is already known, β-sheet peptides tend to form more stable films against lateral compression 22

. ATR-FTIR experiments were also performed for both peptides solubilized in 70% HFIP as an

α-helix inductor (Fig. 4). In this case, both peptides show a similar helical structure. This result indicates that the formation of a β-sheet assembly in myrMANT can be reverted by the peptide environment and, therefore, is not a consequence of the poorly hydrated and highly concentrated state given by the ATR-FTIR technique. Remarkably, Langmuir monolayers of myrMANT spread from HFIP solutions did not show major differences compared with that obtained from ACN solution, indicating that the surface behavior is independent of the structural history of the peptide (data not shown).


17

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 41

Behavior of MA and myrMA proteins Interfacial properties The isothermal compression of monolayers composed of MA or myrMA proteins, in the presence and absence of the ssDNASel25 oligonucleotide, is shown in Fig. 5. It is possible to notice that along lateral compression and in the absence of the oligonucleotide, the behavior is similar for both proteins (Fig. 5A – F) where the monolayers show a slight reorganization between 24 and 26 mN·m-1 (Fig. 5E) occurring at slightly different molecular areas: ~1.2 nm2·molecule-1 for MA and ~1.5 nm2·molecule-1 for myrMA (Fig. 5F). Similar values of the compressional modulus and the perpendicular component of the dipole moment are also observed (Fig. 5C and D). The decreasing values of μ along compression is consistent for monolayers of unidirectionally oriented peptides

35

and indicates that both myristoylated and

unmyristoylated proteins have the same interfacial dipolar orientation. Remarkably, the presence of ssDNASel25 (the protein-oligonucleotide interaction has been determined by a fluorescence anisotropy assay described in the supporting information section, Fig. S1) provokes a shift of the lateral surface pressure isotherm of MA towards smaller areas, and a reduction of μ values are also noticed (Fig. 5A and B). In addition to this, the Λ factor value is lower in the presence of the oligonucleotide (Fig. 5G, first set of bars), suggesting that ssDNASel25 induces solubilization. Interestingly, this effect is not observed for myrMA monolayers, which behave the same in the presence and the absence of the oligonucleotide. We attribute this difference to the myristoyl group that confers a higher protein interfacial stability counteracting this solubilization effect. Fig. 5G shows the Λ factor values obtained by comparing several compression-expansion cycles of protein monolayers and using as a reference the first cycle. It is possible to notice that for MA and myrMA in either presence or absence of ssDNASel25 the values practically remain


18

Page 19 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

unchanged. This invariance property indicates the formation of rather stable protein monolayers compared to those formed by the peptides. In fact, from pure protein adsorption experiments (data not shown), both myrMA and MA present a high free energy of adsorption into the air/buffer interface with a ∆GADS of about -8.1 kcal·mol-1, indicating a high surface propensity of the molecules. In addition, the MA and myrMA films show less hysteresis with respect to the peptides (with a ∆GHYS around -1 to -2 kcal·mol-1) with no important changes upon several compression-expansion cycles, indicating common molecular arrangements. Nevertheless, ssDNASel25/MA films show less hysteretic behavior than pure MA monolayers (see Fig. S4), indicating that the presence of the oligonucleotide modulates the molecular organization in such a way that there could be less lateral molecular interactions.

Topographical properties The BAM experiment results for the MA and myrMA monolayers are summarized in Fig. 6, where representative images of the protein monolayer topography, in presence or absence of ssDNASel25, are shown. For both conditions, and for each compression-expansion cycle, a continuous topography is always observed for MA monolayers (Fig. 6A). However, during compression a gradual increase of the reflectivity is noticed (Fig. 6A, left panel). Assuming that the refractive index of the film remains constant along lateral compression

36

, this increment in

reflectivity can be related to a higher monolayer thickness. This can be the result of a protein multilayer formation at the interface, giving rise to a thicker film. The fact that this effect is equally maintained on further compression-expansion cycles indicates a rather reversible process. In the same line, during compression of myrMA monolayers in the presence or absence of ssDNASel25, there is an overall tendency of the interfacial reflectivity to augment (Fig. 6B, left


19

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 41

panel). Contrasting MA data, domains with different reflectivity can be visualized and, consequently, a discontinuity on the reflectivity signal is quantified (arrow in Fig. 6B). These domains appear to be approximately 2-fold thicker than the region of lower reflectivity (Fig. 6B, inserted graphs at the right of the images). In the absence of the oligonucleotide, this discontinuity remains equal on further expansions and compressions cycles of the monolayer but, when ssDANSel25 is present, these domains disappear and the monolayer becomes rather continuous.

Structural analysis In order to understand if the modulation of the surface behavior of MA and myrMA proteins is related to structural aspects we performed ATR-FTIR experiments. Fig. 7A shows the ATRFTIR spectra of the amide I region of both proteins. As expected, a predominant α-helix secondary structure is detected (Table 2), in concordance with the known structure of the protein18, 37. Interestingly, these results indicate that the presence of the myristoyl group does not promote any structural change, contrary to those observed for the peptides. We questioned if the protein structure remains stable once the molecules are conforming a monolayer at the air-water interface. To challenge this interrogation, we performed protein denaturation experiments either for proteins in solution or at the air-water interface. For bulk experiments, we measured the tryptophan fluorescence emission for protein solutions with different amounts of urea, since this signal is highly sensitive to changes in the polarity of the environment

38

. Fig. 7B shows tryptophan fluorescence analysis under increasing urea

concentration where red-shifted values of the maximum emission are observed, characteristic of tryptophan being exposed to a water milieu. From these results it is possible to observe that


20

Page 21 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

myrMA is less susceptible for denaturation than MA, which is in concordance with the already know stabilization effect of the myristoyl group 37. In the same line, Langmuir monolayer experiments indicate that there is a differential interfacial behavior when the concentration of urea is increased observing an overall increment of the mean molecular area (Fig. 8). These changes of the compressional properties of the protein monolayers correlate to what is observed in the tryptophan fluorescence analysis, since slight differences are detected at low urea concentration (3M, low fraction of denatured proteins) while there are marked changes at high urea amounts (6M, high fraction of denatured proteins). In addition, urea also affects the tendency of the proteins to remain at the surface since the values of the Λ factor decrease through compression-expansion cycles (Fig. 8G). Therefore, all this data indicate that both MA and myrMA proteins are not denatured at the air/water interface.

General discussion Lipidation is a crucial modification for several proteins that allows the molecules to be located at membrane interfaces to exert their biological activity. Once the proteins reach the membrane, the specific interaction with lipids, small ligands or oligonucleotides are necessary to achieve such a function1. To date, there is a narrow knowledge of how this modification controls the surface properties of the proteins and how it can be complemented or contrasted by the protein sequence itself and by interactions with ligands. The myristoylation of the HIV-1 Gag matrix domain and its interaction with RNA is essential for a perfect viral assembly at the PM

10, 17, 39-41

. Based on

our results, here we propose a compelling model (Fig. 9) that summarizes the modulation of the interfacial properties of MA and MA-derived peptide monolayers by three factors: the interaction with nucleic acids, the presence of the myristoyl group (myr) and the core of MA (sequence of MA after the 21st residue).


21

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 41

The main effect mediated by ssDNASel25 is the change of the equilibrium between soluble MAderived molecules and those present at interface. From our data, an increase of solubility is concluded since the molecular area found in the presence of the oligonucleotide are always smaller than those found in its absence (smaller Ʌ factor). A clear-cut example is the total abolishment of myrMANT monolayer formation. This increment in solubility can be associated to an unstable interfacial protein/oligonucleotide complex with higher net charge and, for this reason, being more water-soluble. In addition, the oligonucleotide can have a molecular reorganization effect itself, as observed for the myrMA protein, where the surface properties do not change in presence of ssDNASel25 (Fig. 5) but its topography does (Fig. 6B). This indicates a fine modulation of the protein-protein or the peptide-peptide lateral interactions within the monolayer by ssDNASel25. These data perfectly fit with the effect found in cells that overexpress small microRNA molecules. In this case, there is an evident miss-trafficking of HIV-1 Gag when interacts with the oligonucleotide molecules

42

. Even further, it has been

recently reported that HIV-1 particles can efficiently package non-viral RNA 43. Along this view, the design of specific oligonucleotidic molecules, such as ssDNASel25, may be useful to target and impair this crucial process of HIV-1 particle formation and viral genome wrapping. The myr group presents major effects on the stability of the monolayers since peptide films collapse at a higher lateral surface pressure and protein films are more resistant to molecular solubilization due to the lateral compression work. The presence of acyl groups in proteins and peptides increases their hydrophobicity and contribute to structural changes

44

that can lead to

different surface properties respect to the non-acylated case. Additionally, it is known that myristoylation promotes the formation of peptide aggregates 45. This aggregation effect is clearly observed for myrMANT (Fig. S2 and S3). In fact, our study clearly shows how myristoylation


22

Page 23 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

stabilizes such peptide auto-aggregated particles and how it impacts on the peptide secondary structure where an anti-parallel β-sheet structure is observed, conferring to the peptide higher lateral stability against compression but a complete monolayer solubilization when interacting with the oligonucleotide. Our microscopy data (Fig. 3) show that myrMANT aggregates, transiently present at the monolayer, can be recruited by ssDNASel25 provoking a massive solubilization outcome. Another effect of myr is the rise of the monolayer elasticity since a higher KS is always calculated. Elastic films are more resistant against lateral compression and this effect may be important to ensure a proper interfacial molecular density, for example during viral particle formation. Among all the factors studied in this work, the one that has a marked effect on the surface behavior of HIV-1 Gag is the core of MA. The absence of this region (MA-derived peptides cases) makes the monolayers more susceptible to the ssDNASel25 solubilization effect. In this sense, the core region dramatically increases the stability of the monolayer where, upon several compression-expansion cycles, the interfacial properties remain the same with an almost invariant Ʌ factor. This stability of MA and myrMA against the lateral compressional work is in line with the increment of the monolayer thickness (observed by BAM, Fig. 6). The fact that the core region contributes to the formation of a quite stable protein shell let us to infer that an additional stabilization, at the level of the viral particle formation, can be provided by the matrix domain.

CONCLUSIONS In this work, we found that protein myristoylation is important to contribute to the interfacial lateral stability of peptides and reinforces the strong tendency of MA to remain at the air/buffer surface, conforming stable elastic Langmuir films. In addition, we propose that there is a tradeoff


23

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 41

between interfacial stability and protein solubilization due to the interaction with oligonucleotides42, this work. These data are a first step to start covering several proteins that are modified by different lipids and that may interact with soluble ligands.


24

Page 25 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 1. Langmuir monolayer assay for MANT and myrMANT peptides. A – B: isothermal compression curves of MANT (∆) and myrMANT (○) films in the presence (filled symbols) and absence (open symbols) of ssDNASel25. The graphics show the surface pressure (Π, A) and surface dipole moment (μ , B) vs the mean molecular area. The lines represent all the measured data and the symbols are included to distinguish the different conditions. C – F: values of K &#

%$(C), μ#$% (D), ΠC (E) and AC (F) in the absence (white bars) or presence (black bars) of ssDNASel25. G: Λ factor calculation for different interest (INT) and reference (REF) isotherms denoted on top of the bars. All data are the average result of at least three independent experiments. ND: not determined.


25

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 41

Figure 2. Brewster angle microscopy of MANT monolayers. Images from peptide monolayer first compression (first column) and further compression-expansion cycles (further columns), in the absence (top two rows) and the presence (bottom two rows) of ssDNASel25. The images were acquired at different molecular area values and the surface pressure is included at the top of every image. All images have the same scale, which is represented by the scale bar (50 µm) in the upper left image.


26

Page 27 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 3. Brewster angle microscopy of myrMANT monolayers. The curves on the left panel represent the reflectivity change during compression of the monolayer in the absence (open symbols) and presence (filled symbols) of the ssDNASel25 oligonucleotide; the lines represent all the measured data and the symbols are included to distinguish the different conditions. The middle panel shows representative images of the film in absence (top images) and presence (bottom images) of the ssDNASel25 and during the first (left images) and second (right images) compression. Black circles highlight diffuse domains with high reflectivity. The graphs on the right panel represent the relative thickness change along the white arrow. The images were taken at approximately 2.00 nm2·molecule-1 and the surface pressure for each case is denoted on the right-upper corner. All images have the same scale, which is represented by the scale bar (50 µm) in the upper left image.


27

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 41

Figure 4. ATR-FTIR of MANT and myrMANT peptides. The graphics show the infrared absorption spectra in the amide I region (solid lines) for the MANT (top panels) and myrMANT (bottom panels) spread from ACN (left panels) and HFIP (right panels) solutions. The spectra were curve fitted using the main spectral components determined by Fourier transform selfdeconvolution and second-derivative analysis (dashed lines).


28

Page 29 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 5. Langmuir monolayer assay for MA and myrMA proteins. A – B: isothermal compression curves of MA (∆) and myrMA (○) films in the presence (filled symbols) and absence (open symbols) of ssDNASel25. The graphics show the surface pressure (Π, A) and surface dipole moment (μ , B) vs the mean molecular area. The lines represent all the measured

data and the symbols are included to distinguish the different conditions. C – F: values of K &#

%$(C), μ#$% (D), ΠC (E) and AC (F) in the absence (white bars) or presence (black bars) of ssDNASel25. G: Λ factor calculation for different interest (INT) and reference (REF) isotherms denoted on top of the bars. All data are the average result of at least three independent experiments.


29

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 41

Figure 6. Brewster angle microscopy of MA and myrMA protein monolayers. A – B: the left plots represent the reflectivity change along compression of the monolayer in the absence (open symbols) and the presence (filled symbols) of ssDNASel25; the lines represent all the measured


30

Page 31 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

data and the symbols are included to distinguish the different conditions. A: The right panel shows representative images of the film in absence (top images) and presence (bottom images) of the oligonucleotide at different lateral surface pressures (values at the right-upper corner of each image). The images were taken at approximately 3.00 nm2·molecule-1 (low surface pressure) and at 1.00 nm2·molecule-1 (high surface pressure). B: The middle panel shows representative images of the film in presence (left images) and absence (right images) of the ssDNASel25 oligonucleotide, during the first (top images) and second (bottom images) compression. The graphs on the right panel represent the relative thickness change along the white arrow. The images were taken at approximately 2.00 nm2·molecule-1. The discontinuity region in the reflectivity is signposted in the left panel with an arrow. All images have the same scale, which is represented by the scale bar (50 µm) in the upper left image.


31

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 41

Figure 7. Structural properties of MA and myrMA proteins. A: ATR-FTIR absorption spectra in the amide I region for MA (top panel) and myrMA (bottom panel). The spectra were curve fitted using the main spectral components determined by Fourier transform self-deconvolution and second-derivative analysis (dashed lines). B: Red shift of the tryptophan fluorescence emission at different concentrations of urea for MA (∆), myrMA (○) and N-Acetyl-L-tryptophanamide (NATA; □).


32

Page 33 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 8. Langmuir monolayer assay for MA and myrMA proteins in presence of urea. A – B: Isothermal compression curves of myrMA (A) and MA (B) films in the presence of different concentrations of urea. The graphics show the surface pressure (Π) vs the mean molecular area. C – F: values of K &#$% (C), (,

)*+

(D), ΠC (E) and AC (F) in presence of different concentrations

of urea. G: Λ factor calculation for different interest (INT) and reference (REF) isotherms denoted on top of the bars. All data are the average result of at least three independent experiments.


33

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 41

Figure 9. Model of the effect on the interfacial activity of Gag-derived molecules by myristoylation, ssDNASel25 and core region. The different molecular states are represented by distinctive circles denoting soluble/interfacial equilibrium and lateral organization stability. myr: represents the myristoyl group; core: represents the sequence of MA after the 21st residue; ssDNASel25: indicates the presence of the oligonucleotide. As it can be observed ssDNASel25 increases molecular solubilization and induces interfacial reorganization; myr and core favors monolayer lateral stability and myr also enhances the elasticity of the films.


34

Page 35 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Table 1. Secondary structure analysis of MANT and myrMANT peptides spread from ACN or HFIP solution assessed by ATR-FTIR.

MANT

myrMANT

ACN -1

HFIP -1

ACN

HFIP

-1

-1

Assigments

ν (cm )

%

ν (cm )

%

ν (cm )

%

ν (cm )

%

β-sheet

1624

6.9±0.3

1625

12.5±0.5

1623

54.1±0.7

1625

11.6±1

-

-

-

-

1692

1.7±0.1

-

-

α-helix/ Random

1655

86.6±0.5

1654

78.8±0.6

1645

28.1±0.5

1654

81.6±0.7

Turn

1682

6.5±0.2

1682

8.7±0.1

1673

16.1±2

1681

6.8±0.3

Table 2. Secondary structure analysis of MA and myrMA proteins assessed by ATR-FTIR.

MA -1

myrMA -1

Assigments

ν (cm )

%

ν (cm )

%

β-sheet

1626

13±0.4

1624

12±0.4

α-helix/ Random

1654

79.5±0.9

1653

83.8±1

Turn

1681

7.5±0.6

1681

4.2±0.9


35

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 41

ASSOCIATED CONTENT Supporting Information. Supporting information is appended to this manuscript describing experimental procedures to corroborate oligonucleotide interaction with MA and MA-derived peptides, protein myristoylation after purification and thermodynamics for monolayer compression-expansion cycles. AUTHOR INFORMATION Corresponding Author *To whom correspondence should be addressed: Dr. Ernesto E. Ambroggio: [email protected] Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Funding Sources This work is supported by CONICET (PIP 2013-2015) and FONCyT (PICT 2012-1377 and PICT 2015-2575). L.B.P.S. holds a PhD fellowships from CONICET and E.E.A is a Career Member of CONICET ACKNOWLEDGMENTS The authors specially thank Dr. Michael F. Summers for kindly providing the bacterial expression vectors for MA and myrMA. The authors also acknowledge the financial support from CONICET (PIP 2013-2015) and FONCyT (PICT 2012-1377 and PICT 2015-2575). L.B.P.S. holds a PhD fellowships from CONICET and E.E.A is a Career Member of CONICET. We are also grateful to all the members of the biophysical area at CIQUIBIC-DQB for helpful discussions and the “Centro de Microscopía Óptica y Confocal Avanzada de Córdoba


36

Page 37 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(CEMINCO)”, integrated to the “Sistema Nacional de Microscopía (SNM-MINCyT)” for BAM assistance.


37

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 41

REFERENCES 1. Ray, A.; Jatana, N.; Thukral, L., Lipidated proteins: Spotlight on protein-membrane binding interfaces. Prog Biophys Mol Biol 2017, 128, 74-84. 2. Freed, E. O., HIV-1 gag proteins: diverse functions in the virus life cycle. Virology 1998, 251 (1), 1-15. 3. Jones, I. M.; Morikawa, Y., The molecular basis of HIV capsid assembly. Rev Med Virol 1998, 8 (2), 87-95. 4. Conte, M. R.; Matthews, S., Retroviral matrix proteins: a structural perspective. Virology 1998, 246 (2), 191-8. 5. Scarlata, S.; Carter, C., Role of HIV-1 Gag domains in viral assembly. Biochim Biophys Acta 2003, 1614 (1), 62-72. 6. Zhou, W.; Resh, M. D., Differential membrane binding of the human immunodeficiency virus type 1 matrix protein. J Virol 1996, 70 (12), 8540-8. 7. Zhou, W.; Parent, L. J.; Wills, J. W.; Resh, M. D., Identification of a membrane-binding domain within the amino-terminal region of human immunodeficiency virus type 1 Gag protein which interacts with acidic phospholipids. J Virol 1994, 68 (4), 2556-69. 8. Mercredi, P. Y.; Bucca, N.; Loeliger, B.; Gaines, C. R.; Mehta, M.; Bhargava, P.; Tedbury, P. R.; Charlier, L.; Floquet, N.; Muriaux, D.; Favard, C.; Sanders, C. R.; Freed, E. O.; Marchant, J.; Summers, M. F., Structural and Molecular Determinants of Membrane Binding by the HIV-1 Matrix Protein. J Mol Biol 2016, 428 (8), 1637-55. 9. Purohit, P.; Dupont, S.; Stevenson, M.; Green, M. R., Sequence-specific interaction between HIV-1 matrix protein and viral genomic RNA revealed by in vitro genetic selection. RNA 2001, 7 (4), 576-84. 10. Alfadhli, A.; Barklis, E., The roles of lipids and nucleic acids in HIV-1 assembly. Front Microbiol 2014, 5, 253. 11. Chukkapalli, V.; Oh, S. J.; Ono, A., Opposing mechanisms involving RNA and lipids regulate HIV-1 Gag membrane binding through the highly basic region of the matrix domain. Proc Natl Acad Sci U S A 2010, 107 (4), 1600-5. 12. Brezesinski, G.; Mohwald, H., Langmuir monolayers to study interactions at model membrane surfaces. Adv Colloid Interface Sci 2003, 100-102, 563-84. 13. Stefaniu, C.; Brezesinski, G.; Mohwald, H., Langmuir monolayers as models to study processes at membrane surfaces. Adv Colloid Interface Sci 2014, 208, 197-213. 14. Dupuy, F.; Fanani, M. L.; Maggio, B., Ceramide N-acyl chain length: a determinant of bidimensional transitions, condensed domain morphology, and interfacial thickness. Langmuir 2011, 27 (7), 3783-91. 15. Voet, D.; Voet, J. G., Chapter 5 - Nucleic Acids, Gene Expression, and Recombinant DNA Technology. In Biochemistry, 4 ed.; John Wiley & Sons: New York, 2011; p 85. 16. O'Neil, L.; Andenoro, K.; Pagano, I.; Carroll, L.; Langer, L.; Dell, Z.; Perera, D.; Treece, B. W.; Heinrich, F.; Losche, M.; Nagle, J. F.; Tristram-Nagle, S., HIV-1 matrix-31 membrane binding peptide interacts differently with membranes containing PS vs. PI(4,5)P2. Biochim Biophys Acta 2016, 1858 (12), 3071-3081. 17. Alfadhli, A.; McNett, H.; Tsagli, S.; Bachinger, H. P.; Peyton, D. H.; Barklis, E., HIV-1 matrix protein binding to RNA. J Mol Biol 2011, 410 (4), 653-66. 18. Tang, C.; Loeliger, E.; Luncsford, P.; Kinde, I.; Beckett, D.; Summers, M. F., Entropic switch regulates myristate exposure in the HIV-1 matrix protein. Proc Natl Acad Sci U S A 2004, 101 (2), 517-22.


38

Page 39 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

19. Grasso, E. J.; Oliveira, R. G.; Maggio, B., Surface interactions, thermodynamics and topography of binary monolayers of Insulin with dipalmitoylphosphatidylcholine and 1palmitoyl-2-oleoylphosphatidylcholine at the air/water interface. J Colloid Interface Sci 2016, 464, 264-76. 20. Gaines, G. L., Insoluble monolayers at liquid-gas interfaces. Interscience Publishers: 1966. 21. Gallea, J. I.; Sarroukh, R.; Yunes-Quartino, P.; Ruysschaert, J. M.; Raussens, V.; Celej, M. S., Structural remodeling during amyloidogenesis of physiological Nalpha-acetylated alphasynuclein. Biochim Biophys Acta 2016, 1864 (5), 501-10. 22. Ambroggio, E. E.; Separovic, F.; Bowie, J.; Fidelio, G. D., Surface behaviour and peptide-lipid interactions of the antibiotic peptides, Maculatin and Citropin. Biochim Biophys Acta 2004, 1664 (1), 31-7. 23. Matar, G.; Nasir, M. N.; Besson, F., Interfacial properties and structure stability of the gp41 tryptophan-rich peptide from HIV-1. J Colloid Interface Sci 2010, 352 (2), 520-5. 24. Nieto-Suárez, M.; Vila-Romeu, N.; Prieto, I., Behaviour of insulin Langmuir monolayers at the air–water interface under various conditions. Thin Solid Films 2008, 516 (24), 8873-8879. 25. Borioli, G. A.; Caputto, B. L.; Maggio, B., c-Fos and phosphatidylinositol-4,5bisphosphate reciprocally reorganize in mixed monolayers. Biochim Biophys Acta 2005, 1668 (1), 41-52. 26. Borioli, G. A.; Maggio, B., Surface thermodynamics reveals selective structural information storage capacity of c-Fos-phospholipid interactions. Langmuir 2006, 22 (4), 177581. 27. Frey, W.; Schief, W. R.; Vogel, V., Two-Dimensional Crystallization of Streptavidin Studied by Quantitative Brewster Angle Microscopy. Langmuir 1996, 12 (5), 1312-1320. 28. Barnsley, M. F., Chapter V - Fractal Dimension. In Fractals Everywhere (Second Edition), Academic Press: 1993; pp 171-204. 29. Arrondo, J. L.; Goni, F. M., Structure and dynamics of membrane proteins as studied by infrared spectroscopy. Prog Biophys Mol Biol 1999, 72 (4), 367-405. 30. Barth, A., Infrared spectroscopy of proteins. Biochim Biophys Acta 2007, 1767 (9), 1073101. 31. Barth, A.; Zscherp, C., What vibrations tell us about proteins. Q Rev Biophys 2002, 35 (4), 369-430. 32. Sarroukh, R.; Goormaghtigh, E.; Ruysschaert, J. M.; Raussens, V., ATR-FTIR: a "rejuvenated" tool to investigate amyloid proteins. Biochim Biophys Acta 2013, 1828 (10), 232838. 33. Chirgadze, Y. N.; Nevskaya, N. A., Infrared spectra and resonance interaction of amide-I vibration of the antiparallel-chain pleated sheet. Biopolymers 1976, 15 (4), 607-25. 34. Lowik, D. W.; Garcia-Hartjes, J.; Meijer, J. T.; van Hest, J. C., Tuning secondary structure and self-assembly of amphiphilic peptides. Langmuir 2005, 21 (2), 524-6. 35. Nguyen, L. T.; Ardana, A.; ten Brinke, G.; Schouten, A. J., Surface potentials in Langmuir monolayers of unidirectionally oriented alpha-helical diblock copolypeptides. Langmuir 2010, 26 (9), 6515-21. 36. Pusterla, J. M.; Malfatti-Gasperini, A. A.; Puentes-Martinez, X. E.; Cavalcanti, L. P.; Oliveira, R. G., Refractive index and thickness determination in Langmuir monolayers of myelin lipids. Biochim Biophys Acta 2017, 1859 (5), 924-930.


39

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 41

37. Wu, Z.; Alexandratos, J.; Ericksen, B.; Lubkowski, J.; Gallo, R. C.; Lu, W., Total chemical synthesis of N-myristoylated HIV-1 matrix protein p17: structural and mechanistic implications of p17 myristoylation. Proc Natl Acad Sci U S A 2004, 101 (32), 11587-92. 38. Jameson, D. M., Chapter 11 - Intrinsic Protein Fluorescence. In Introduction to Fluorescence, Taylor & Francis: 2014; pp 75-101. 39. Ono, A., HIV-1 Assembly at the Plasma Membrane: Gag Trafficking and Localization. Future Virol 2009, 4 (3), 241-257. 40. Ono, A.; Ablan, S. D.; Lockett, S. J.; Nagashima, K.; Freed, E. O., Phosphatidylinositol (4,5) bisphosphate regulates HIV-1 Gag targeting to the plasma membrane. Proc Natl Acad Sci U S A 2004, 101 (41), 14889-94. 41. Alfadhli, A.; McNett, H.; Eccles, J.; Tsagli, S.; Noviello, C.; Sloan, R.; Lopez, C. S.; Peyton, D. H.; Barklis, E., Analysis of small molecule ligands targeting the HIV-1 matrix protein-RNA binding site. J Biol Chem 2013, 288 (1), 666-76. 42. Chen, A. K.; Sengupta, P.; Waki, K.; Van Engelenburg, S. B.; Ochiya, T.; Ablan, S. D.; Freed, E. O.; Lippincott-Schwartz, J., MicroRNA binding to the HIV-1 Gag protein inhibits Gag assembly and virus production. Proc Natl Acad Sci U S A 2014, 111 (26), E2676-83. 43. Liu, Y.; Nikolaitchik, O. A.; Rahman, S. A.; Chen, J.; Pathak, V. K.; Hu, W. S., HIV-1 Sequence Necessary and Sufficient to Package Non-viral RNAs into HIV-1 Particles. J Mol Biol 2017, 429 (16), 2542-2555. 44. Tholey, A.; Pipkorn, R.; Bossemeyer, D.; Kinzel, V.; Reed, J., Influence of myristoylation, phosphorylation, and deamidation on the structural behavior of the N-terminus of the catalytic subunit of cAMP-dependent protein kinase. Biochemistry 2001, 40 (1), 225-31. 45. Sankaram, M. B., Membrane interaction of small N-myristoylated peptides: implications for membrane anchoring and protein-protein association. Biophys J 1994, 67 (1), 105-12.


40

Page 41 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

1454x705mm (72 x 72 DPI)


Myristoylation and oligonucleotide interaction modulate peptide and

Recommend Documents