Nanohydroxyapatite-Coated Electrospun Poly(l-lactide) - American

3118

Biomacromolecules 2010, 11, 3118–3125

Nanohydroxyapatite-Coated Electrospun Poly(L-lactide) Nanofibers Enhance Osteogenic Differentiation of Stem Cells and Induce Ectopic Bone Formation Ehsan Seyedjafari,†,‡ Masoud Soleimani,*,§ Nasser Ghaemi,†,¶ and Iman Shabani‡,| Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran, Stem Cell Biology Department, Stem Cell Technology Research Center, Tehran, Iran, Faculty of Medical Science, Tarbiat Modares University, Tehran, Iran, School of Chemistry, College of Science, University of Tehran, Tehran, Iran, and Department of Polymer Engineering and Color Technology, Amirkabir University of Technology, Tehran, Iran Received August 7, 2010; Revised Manuscript Received September 19, 2010

A combination of calcium phosphates with nanofibrous scaffolds holds promising potential for bone tissue engineering applications. In this study, nanohydroxyapatite (n-HA) was coated on the plasma-treated surface of electrospun poly(L-lactide) (PLLA) nanofibers and the capacity of fabricated scaffolds for bone formation was investigated in vitro using human cord blood derived unrestricted somatic stem cells (USSC) under osteogenic induction and in vivo after subcutaneous implantation. PLLA and n-HA-coated PLLA (n-HA/PLLA) scaffolds exhibited a nanofibrous structure with interconnected pores and suitable mechanical properties. These scaffolds were also shown to support attachment, spreading, and proliferation of USSC, as shown by their flattened normal morphology and MTT assay. During osteogenic differentiation, significantly higher values of ALP activity, biomineralization, and bone-related gene expression were observed on n-HA/PLLA compared to PLLA scaffolds. Subsequently, these markers were measured in higher amounts in USSC on PLLA nanofibers compared to TCPS. According to the in vivo results, ossification and formation of trabeculi was observed in the n-HA/PLLA scaffold compared to PLLA. Taking together, it was shown that nanofibrous structure enhanced osteogenic differentiation of USSC. Furthermore, surface-coated n-HA stimulated the effect of nanofibers on the orientation of USSC toward osteolineage. In addition, the n-HA/PLLA electrospun scaffold showed the capacity for ectopic bone formation in the absence of exogenous cells.

Introduction Bone is one of the most interesting targets in the field of regenerative medicine because of the large number of bone grafting materials needed for the repair of injuries and damage.1 Bone structure is composed of highly organized nanofibrillar proteins (mainly collagen type I) that serve as a pattern for the deposition of crystalline calcium phosphate minerals, mostly in the form of hydroxyapatite (HA).2 This complex extracellular matrix (ECM) along with noncollagenous proteins is incorporated with the bone-specific cells like osteoblasts to form a functional and live tissue structure.3 Mimicking the ECM is a very effective strategy to design and develop appropriate scaffolds for tissue engineering.4 This may be why nanofiber scaffolds have recently been attracting a great deal of attention from the scientific community in the field of regenerative medicine, because they can greatly mimic the nanotextured and three-dimensional structure of ECM.5 Unrestricted somatic stem cells (USSC) have lately been isolated from the human umbilical cord blood (UCB) and have interesting characteristics for application in tissue engineering. They have the potential to differentiate into three germ layers and remain undifferentiated without transformation after long* To whom correspondence should be addressed. Tel.: +98(21)888610657. Fax: +98-21-8886-1065-7. E-mail: [email protected]. † Department of Biotechnology, College of Science, University of Tehran. ‡ Stem Cell Technology Research Center. § Tarbiat Modares University. ¶ School of Chemistry, College of Science, University of Tehran. | Amirkabir University of Technology.

term ex vivo expansion. Compared to bone marrow derived mesenchymal stem cells (MSC), isolation of USSC is noninvasive and is performed more easily from the UCB, which is discarded after child birth. They also have better growth kinetics with a broader life-span, up to more than 20 passages, and relatively low immunogenicity.6-9 These characteristics make USSC new and promising candidates for cell-based therapies and tissue engineering. Calcium phosphates (CaP) serve as the mostly used bone grafting substitutes to fill bone void spaces and defects.10 In addition, it is well established that they have bone-related bioactive potential such as osteoinductivity, osteoconductivity, and osteointegration, which promote bone healing and regeneration.11,12 Osteoinduction is defined as the ability of a biomaterial to induce bone formation in nonosseous tissues in the absence of exogenous inductive agents or cells. This phenomenon has been reported after the implantation of CaP, such as HA, tricalcium phosphate (TCP) and biphasic calcium phosphate (BCP), and metals like titanium in soft tissues.13-16 Composites of CaP and electrospun nanofibers have shown great potential for application in bone tissue engineering. These composites have been fabricated via the electrospinning of polymer/CaP solution17-21 or the mineralization of the surface of nanofibers by direct coating of CaP on the nanofibers’ surface through immersion in simulated body fluid (SBF),22,23 which both have some drawbacks. In the first method, embedding of CaP inside the nanofibers may lead to the masking of its bioactivity and weakening the electrospun matrix,24,25 and the latter may take a long time for a stable apatite deposition on nanofibers and

10.1021/bm1009238  2010 American Chemical Society Published on Web 10/06/2010

nHa-Coated Electrospun Poly(L-lactide) Nanofibers

CaP may aggregate interfibers and interfere in the porous structure of electrospun scaffold and lead to the hindrance of cell in-growth. Recently, Yang et al.26 performed plasma treatment on poly(ε-caprolactone) (PCL) nanofibers to accelerate surface mineralization via immersion in SBF. However, a microscale increase of fiber diameter was reported, which may interfere with an ECM-mimicking role of nanofibers. Taking these into account, we hypothesized that the direct deposition of HA nanoparticles (n-HA) on the surface of PLLA nanofibers after plasma treatment will contribute to a novel nanofibrous construct, which holds promising potential for bone tissue engineering applications. To the best of our knowledge, there are no reports about the performance of USSC on polymer/HA combination. In addition, osteoinductivity of n-HA-coated PLLA (n-HA/PLLA) electrospun nanofibers have been never studied. The objective of this work was to study the biological behavior and osteogenic differentiation of USSC on the n-HA/PLLA and pristine PLLA nanofiber scaffolds in vitro. Moreover, osteoinduction of fabricated scaffolds was investigated after subcutaneous implantation in vivo.

Experimental Section Fabrication of Nanofibrous Scaffolds. Electrospinning was used to prepare nanofibrous scaffolds as described previously.27 The 12% (w/v) solution of PLLA (Sigma-Aldrich, MO, U.S.A.) in dichloromethane (Merck, Germany) was placed in a 5 mL syringe that was connected to a 21-gauge needle through an extension tube. A steel grounded collector was used to collect the electrospun nanofibers in a distance of 15 cm from the needle. The solution was fed through the tube into the needle by a syringe pump with a rate of 1 mL/h. Application of a 20 kV voltage between the needle and collector, forced the solution droplet to leave the needle and deposit on the cylinder in the form of ultrafine fibers. Having reached a thickness of about 200 µm, the mat was detached from the collector and placed in vacuum for evaporation of residual solvent. Oxygen plasma treatment was then performed by a low frequency plasma generator of 44 GHz frequency with a cylindrical quartz reactor (Diener Electronics, Germany). Pure oxygen was introduced into the reaction chamber at 0.4 mbar pressure and then the glow discharge was ignited for 5 min. A 1% (w/v) solution of n-HA (Sigma) in deionized water was prepared after well dispersion of nanoparticles in an ultrasonic bath for 20 min. To deposit n-HA on the surface of nanofibers, plasma treated mat was immersed in n-HA aqueous solution overnight. After that, the mat was well rinsed with deionized water and dried in vacuum. Because pristine PLLA nanofibers showed a very low capacity for cell attachment due to high hydrophobicity, plasma-treated PLLA were used in all experiments and referred to as PLLA in this study. Isolation and Expansion of USSC. USSC were isolated from umbilical cord blood with informed consent of the mother according to a method described by Kogler et al.6 and reported previously by our laboratory.28,29 Briefly, 5 mL of cord blood was laid over 1.077 g/mL Ficoll-Hypaque (Pharmacia Biotech, NJ, U.S.A.) gradient and centrifuged at 400 g for 25 min. Mononuclear cells were then separated and cultured in low glucose DMEM (GIBCO-BRL, Grand Island, NY, U.S.A.) supplemented with 30% FBS (Gibco), dexamethasone (100 nM; Sigma), L-glutamine (2 mM; Gibco), penicillin (100 U/mL; Gibco), and streptomycin (0.1 mg/mL; Gibco). The colonies of USSC were appeared after almost 2 weeks. They were detached with 0.25% Trypsin-EDTA (Gibco) and resuspended in DMEM supplemented with 10% FBS. After reaching 70% confluence, the cells were passaged and passage 2 (P2) cells were used in this study. For osteogenic differentiation, basal medium (DMEM supplemented with 10% FBS) was supplemented with 100 nM dexamethasone, 0.2 mM ascorbic acid 2-phosphate, and 10 mM β-glycerophosphate (all from Sigma).

Biomacromolecules, Vol. 11, No. 11, 2010

3119

Cell Seeding. Prior to cell seeding, the mats were cut into 1.5 cm diameter circular scaffolds, which were placed in 24-well tissue culture polystyrene (TCPS) and sterilized in 70% ethanol. Then the scaffolds were incubated with basal medium overnight to facilitate cell attachment. An initial density of 2 × 105 cells per well were suspended in 200 µL of medium and seeded onto the PLLA and n-HA/PLLA scaffolds and TCPS as control. After 30 min, basal medium was added to each well to a final volume of 1 mL. After one day, the scaffolds were transferred to new wells and the osteogenic medium was used to culture the USSC on both scaffolds and TCPS beginning from this day. Scanning Electron Microscopy (SEM). The surface morphology of scaffolds was characterized using a scanning electron microscope (SEM, LEO 1455VP, Cambridge, U.K.), and after that, specimens were coated with gold using a sputter coater. The fiber diameter was determined from SEM images using image analysis software (imageJ, NIH, U.S.A.). Morphology of USSC on the scaffolds during osteogenic differentiation was also investigated by SEM. The cell-loaded scaffolds were rinsed with PBS after 7 and 14 days of osteogenic differentiation and fixed in glutaraldehyde 2.5% for 1 h. For dehydrating, the scaffolds were placed in a series of gradients of alcohol concentration and then dried. To assess the attachment and behavior of a single USSC on nanofibers, scaffolds seeded with 5 × 103 cells per cm2 were collected for SEM on day one after seeding. Contact Angle Measurement. The water contact angle of the surface of scaffolds before and after surface treatments was measured by the sessile drop method with a G10 contact angle goniometer (Kruss, Germany) at room temperature. A water droplet was placed on the scaffold surface and the contact angle was measured after 10 s. ATR-FTIR Spectroscopy. The coating of n-HA on the surface of nanofibers was investigated by FTIR-ATR. The spectra were recorded using an Equinox 55 spectrometer (Bruker Optics, Germany) equipped with a DTGS detector and a diamond ATR crystal. Mechanical Properties. The tensile measurements were performed on the nanofibrous webs using a universal testing machine (Galdabini, Italy). Prepared scaffolds were cut into 10 × 60 × 0.11 mm specimens, and a tensile test was conducted at 50 mm/min crosshead speed at room temperature. MTT Assay. Proliferation of USSC on PLLA and n-HA/PLLA scaffolds in comparison to TCPS was evaluated via MTT assay. Sterilized nanofibrous membranes were placed in a 24-well culture plate, seeded with a cell density of 5 × 103 cells per cm2, and incubated at 37 °C, 5% CO2 under basal medium. After 1, 3, 5, and 7 days of cell seeding, 50 µL of MTT solution (5 mg/mL in DMEM) was added to each well (n ) 4) followed by incubation at 37 °C for 3.5 h. For dissolution of the dark-blue intracellular formazan, the supernatant was removed and 1 mL of DMSO (Merck) was added. The optical density was read spectrophotometrically at a wavelength of 570 nm. The same procedure was performed for cultured cells in TCPS as control. Real-Time RT-PCR. The difference between the mRNA levels of important bone-related genes in USSC cultured on scaffolds and TCPS was analyzed using real-time RT-PCR. Total RNA was extracted and random hexamer primed cDNA synthesis was carried out using Revert Aid first strand cDNA synthesis kit (Fermentas, Burlington, Canada). The cDNAs were used for a 40 cycle PCR in Rotor-gene Q real-time analyzer (Corbett, Australia). Real-time PCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (Fermentas) followed by melting curve analysis to confirm PCR specificity. Each reaction was repeated two times, and the threshold cycle average was used for data analysis by Rotor-gene Q software (Corbett). Genes and related specific primers are illustrated in Table 1. A relative expression was quantified using the ∆∆Ct method. Target genes were normalized against HPRT and calibrated to USSC P2. Alkaline Phosphatase Activity. For ALP activity measurement, the total protein of cells on TCPS and scaffolds was extracted using 200 µL of RIPA buffer. The lysate was then centrifuged at 14000 g at 4 °C for 15 min to sediment cell debris. The supernatant was collected and

3120


Seyedjafari et al.

Table 1. Primers Used in Real-Time RT-PCR

gene HPRT1 Runx2 osteonectin osteocalcin

primer sequence (F,R, 5′f3′) CCTGGCGTCGTGATTAGTG TCAGTCCTGTCCATAATTAGTCC GCCTTCAAGGTGGTAGCCC CGTTACCCGCCATGACAGTA AGGTATCTGTGGGAGCTAATC ATTGCTGCACACCTTCTC GCAAAGGTGCAGCCTTTGTG GGCTCCCAGCCATTGATACAG

product length (bp) 125 67 224 80

ALP activity was measured with an ALP assay kit (Parsazmun, Tehran, Iran), using p-nitrophenyl phosphate (p-NPP) as substrate and alkaline phosphatase provided in the kit as a standard. The activity of enzyme (IU/L) was normalized against total protein (mg/dl). Calcium Content Assay. The amount of calcium minerals deposited on TCPS and scaffolds by USSC under osteogenic induction was measured using cresolphthalein complexone method. Calcium extraction was performed by homogenization of the scaffolds in 0.6 N HCL (Merck) followed by shaking for 4 h at 4 °C. Optical density was measured at 570 nm after the addition of the reagent to calcium solutions. Calcium content was obtained from the standard curve of OD versus a serial dilution of calcium concentrations. In addition to deposited calcium minerals, n-HA itself contains calcium in its structure. To exclude this, unseeded n-HA/PLLA scaffolds were used as control during culture and their calcium content was subtracted from the corresponding scaffold seeded with USSC. Subcutaneous Implantation. All animal experiments were performed in accordance with the Stem Cell Technology Research Center (Tehran, Iran) guidelines. Male Balb/c mice (Razi Institute, Karaj, Iran) weighing 20-25 g were housed under standard conditions in a controlled temperature (20 °C) and a light/dark cycle (12/12 h). Mice were individually anesthetized via intraperitoneal injection of ketamine (20 mg/kg) and xylazine (2 mg/kg) and an inhaled mixture of 20% v/v isoflurane and propylene glycol. Mice hair was removed at the surgical site and sterilized by 10% povidone-iodine. A suitable pocket for implant was created after incision at the dorsal skin. PLLA and n-HA/ PLLA scaffolds were implanted in six mice (n ) 3 for each scaffold) and then the incision was closed with sutures. Histopathology. A total of 10 weeks postimplantation, mice were anesthetized and the implants were removed with surrounded tissue and were fixed in 10% buffered formaldehyde solution, processed, and embedded in paraffin. Thick sections (3-5 µm) were stained with hematoxylin, eosin (HE), and von Kossa and were observed using a Nikon Eclipse Microscope. Statistical Analysis. All experiments were conducted at least for n ) 3. Data are expressed as mean ( SD. One-way analysis of variance (ANOVA) was used to compare results. A p-value of less than 0.05 was considered statistically significant.

Results Characterization of Nanofibers. Fabricated PLLA scaffolds showed porous structure with interconnected pores and uniform

Figure 2. ATR-FTIR spectra of n-HA, PLLA, and n-HA/PLLA.

smooth random-oriented nanofibers with an average diameter of 440 ( 129 nm. After n-HA coating, a homogeneous distribution of spherical-shaped n-HA with an average size of 161 nm was observed on the surface of nanofibers. It was demonstrated that n-HA did not block the pores at the surface of scaffold and also attached to the surface of nanofibers beneath the top layer (Figure 1). Contact angle measurements showed that PLLA nanofibers became completely hydrophilic (0° angle) after plasma treatment and n-HA coating did not affect its hydrophilicity. PLLA nanofibers showed tensile strength of 1.91 ( 0.311 MPa and elongation at break of 87% which did not significantly change after surface modification. The existence of n-HA on the surface of PLLA nanofibers was confirmed via ATR-FTIR (Figure 2). Strong characteristic peaks of PLLA was detected at 1749 cm-1 for CdO group and at 1083 for C-O stretching. Peaks at 632 and 1035 cm-1 are referred to the vibrations in PO43-, which is in the chemical structure of n-HA. The latter peak is located at 1012 cm-1 in the pristine n-HA spectrum and was shifted to higher wavenumber (1035 cm-1) after surface coating. Characteristic peaks of PLLA became weaker but exhibited no change in wavenumber in the n-HA/ PLLA spectrum. Morphology and Proliferation of USSC. The morphology of USSC on PLLA and n-HA/PLLA was studied on day 1 after low-density cell seeding. USSC on both scaffolds exhibited typical flattened polygonal morphology and spread and attached well on the surface nanofibers (Figure 3). Furthermore, the proliferation of these cells seeded on nanofibers and TCPS was investigated (Figure 4). According to the MTT results, a significant increase in cell number was observed on TCPS and both PLLA and n-HA/PLLA during time. However, the rate of cell proliferation increased up to day 5 and then decreased after that. In this period, USSC proliferated more slowly on nanofiber scaffolds compared to TCPS. Moreover, in all time points except day 1, higher cell population was detected on TCPS compared to nanofiber scaffolds and no significant difference was observed

Figure 1. Morphology of fabricated scaffolds, PLLA (A), and n-HA/PLLA (B and C) nanofibers at 1000× (A and B) and 5000× (C).



3121

Figure 3. Morphology of USSC on day 1 after seeding at low cell density: PLLA (A) and n-HA/PLLA (B).

Figure 4. Proliferation of USSC on scaffolds and TCPS during a 7-day culture period: asterisk shows significant difference with p < 0.05.

between the proliferation of USSC on PLLA and the n-HA/ PLLA during the assay time. Osteogenic Behavior of USSC. Morphology, ALP ActiVity, and Mineralization. The capacity of electrospun PLLA and n-HA/ PLLA scaffolds to support osteogenic differentiation of USSC was investigated via monitoring important bone-related markers. Because osteogenic induction was performed after seeding with high cell density, a confluent monolayer of USSC was observed on days 7 and 14 on TCPS (Figure 5B and C) and both scaffolds (Figure 6). Mineral depositions were clearly obvious but with higher amounts on day 14. These depositions were qualitatively higher and bigger on n-HA/PLLA nanofibers compared to PLLA and TCPS. They also had a vividly porous structure composed from the aggregation of globular mineral accretions (Figure 7). For quantification, mineralized calcium content was also measured on days 7 and 14 (Figure 8A). Although no significant difference was observed between calcium content of USSC on both scaffolds and TCPS on day 7, but higher amounts were detected on n-HA/PLLA compared to PLLA and TCPS on day 14. USSC also showed higher mineralization on PLLA compared to TCPS. A similar trend of ALP activity was observed in USSC on scaffolds and TCPS (Figure 8B). With no significant difference on day 3, ALP activity peaked on day 7 in all groups and exhibited higher amounts in n-HA/PLLA, PLLA, and TCPS, respectively. A decrease in ALP activity was detected on day 14 in cells on scaffolds and TCPS. On this day, USSC on both scaffolds exhibited similar ALP activity, which was significantly higher than that on TCPS. Gene Expression Analysis. Main osteogenic genes were investigated in USSC under induction (Figure 9). Runx2 was continuously expressed on scaffolds and TCPS during differentiation of USSC. On days 7 and 14, there was no significant

difference between its mRNA levels on PLLA and n-HA/PLLA. However, these values were significantly higher than that on TCPS on each day. Transcripts of osteonectin were significantly higher on n-HA/PLLA compared to PLLA and TCPS. On day 14, its mRNA level on PLLA increased to the level of that on n-HA/PLLA, which both showed higher osteonectin expression compared to TCPS. An increase in osteocalcin expression levels was detected on the second week of osteogenic differentiation of USSC on scaffolds and TCPS. This gene was expressed significantly higher in cells on n-HA/PLLA compared to PLLA and TCPS. There were also higher levels of its mRNA on PLLA compared to TCPS on day 14. Subcutaneous Implantation. Microscopic examination of the sections taken from the group that received a PLLA scaffold showed an amorphous eosinophilic material with a laminated pattern in some areas surrounded by granulomatous inflammatory process (Figure 10A). On von Kossa staining, no evidence of calcium deposition was identified (Figure 10D). The sections from the group that received the n-HA/PLLA scaffold showed marked ossification and calcification without significant inflammatory infiltrate. Residues of amorphous eosinophilic material were also noticed in some areas. Moreover, trabeculi and bone marrow element were identified in ossification areas (Figure 10B,C). Von Kossa staining showed the deposition of calcium and bone formation in n-HA/PLLA implants (Figure 10E,F).

Discussion Recently, because of the growing need for bone reconstruction and healing due to various diseases or traumas, bone tissue engineering has attracted much attention in the field of regenerative medicine.30 Mimicking the structure of natural bone using appropriate nanofibrous scaffolds in combination with CaP have shown promising potential for bone engineering applications.21,31,32 In this study, we demonstrated that the n-HA/PLLA nanofiber scaffold had a significant effect on the osteogenic behavior of USSC in vitro. Furthermore, osteoinduction of this scaffold without cells was evaluated in vivo after subcutaneous implantation. Both PLLA and n-HA/PLLA scaffolds were composed from ultrafine fibers and interconnected pores. This structure can ideally mimic the ECM and create natural niches, which control the attachment, proliferation, and differentiation of stem cells.33 Interconnected pores are important to facilitate nutrient transport and cell in-growth.34 Ideally, n-HA did not block these pores. After rinsing several times, weakly bound n-HA were detached from the scaffold and only nanofibers’ surface-bound n-HA remained attached. The anionic chemical groups produced after

3122


Seyedjafari et al.

Figure 5. Morphology of USSC on TCPS: on day 1 after seeding at low cell density (A) and during osteogenic differentiation on days 7 (B) and 14 (C); Bars: 100 µm.

Figure 6. Morphology of USSC during osteogenic differentiation on nanofibrous PLLA (A,B) and n-HA/PLLA (C,D) on days 7 (A,C) and 14 (B,D).

Figure 7. Mineral deposition of USSC after 14 days of osteogenic differentiation.

the oxygen plasma treatment could provide an initial site for n-HA coating via electrostatic interactions with Ca2+.35 Physical characteristics of PLLA such as hydrophilicity and appropriate

tensile properties did not significantly change after n-HA coating. These physical properties make PLLA and n-HA/PLLA nanofibrous scaffolds suitable for tissue engineering applications.36 There are reports which have shown that the osteogenic differentiation of stem cells is promoted in higher initial cell densities.37,38 Herein, the osteogenic induction was initiated on the confluent culture and a low-density cell seeding was used to assess the behavior of a single USSC on nanofibers. Wellspread USSC with a typical polygonal morphology showed that both scaffolds highly supported cell attachment and exhibited suitable biocompatibility. This was further shown by a monolayer of USSC with a flattened morphology which remained attached to the surface of nanofibers during a 14-day differentiation period. The flattened morphology of USSC reflected the high scaffold biocompatibility resulted from the nanofibrous structure and high hydrophilicity. Nanofibers have a large surface area, which provides a large number of anchorage sites for cells to attach and proliferate. Compared to traditional scaffolds, this enhances initial attachment to the surface of nanofibers and cell spreading after seeding.5 Moreover, the surface hydrophilicity is another key requirement of the surface of biomaterials and improve biocompatibility and cell behavior.39,40



3123

Figure 8. Calcium content (A) and ALP activity (B) of USSC on scaffolds and TCPS during osteogenic differentiation: asterisk show significant difference with p < 0.05.

Figure 9. Relative expression of Runx2, osteonectin, and osteocalcin on days 3, 7, and 14 in USSC on scaffolds and TCPS during osteogenic differentiation: asterisk shows significant difference with p < 0.05.

Figure 10. Histological findings of ectopic bone formation, HE staining (A-C) and von Kossa staining (D-F) of PLLA (A,D) and n-HA/PLLA (B,C,E,F): S, scaffold; ST, surrounding tissue; black arrows, trabeculi; white arrows, calcium deposition; Bars: 100 µm.

Compared to TCPS, Both scaffolds also showed the capacity to support the proliferation of USSC during a 7-day monitoring under basal medium. On the other hand, n-HA did not influence cell proliferation on nanofibrous substrates. In addition, the cells had a higher rate of proliferation on TCPS compared to nanofiber scaffolds. A possible reason is that the surface of the scaffolds was not modified enough after treatments to support cell proliferation as well as TCPS, and further improvement should be performed. Another reason may be the differentiation of stem cells on nanofibrous substrates under basal medium, which should be evaluated in further studies. Biochemical and gene expression analysis are the common ways to assess the osteogenic behavior of stem cells on the surface of biomaterials. ALP is known as a major osteogenic marker and has a critical role in mineralization based on its activity via cleavage of phosphate groups.37,41 ALP is also

considered as an early stage marker for osteogenic differentiation and the transient increase of its activity was previously reported in USSC6 and MSC37 while induced toward osteolineage. In this study, we demonstrated that the USSC on TCPS and nanofiber scaffolds became efficiently committed to osteogenic differentiation because of this fact that the ALP activity reached a peak followed by a decrease in value during induction time. The higher values of ALP activity can show the enhanced early osteogenic differentiation of USSC on nanofibrous scaffolds compared to TCPS. This enhancement was also demonstrated on n-HA/PLLA compared to PLLA. The results of ALP activity was further confirmed by calcium content analysis. Biomineralization occurs in the late stages of osteogenesis and is considered as a marker of fully differentiated stem cells.37,42 On day 14, higher amounts of calcium depositions were observed on n-HA/PLLA, PLLA, and TCPS, respectively. These

3124


results are indicative that the nanofibrous structure of electrospun scaffolds provided USSC with physical cues which enhanced both early and late osteogenic commitment. This is consistent with the two recent studies which have shown improved osteogenic differentiation of human MSC43 and ESC44 on PCL nanofibers. In the present study, the n-HA coated on the surface of nanofibers synergistically enhanced the stimulatory effect of nanofibers on the osteogenic differentiation of USSC. The n-HA may have directly influenced the cell surface receptors, which mediated the activation of signaling pathways related to osteogenesis. Moreover, Ca2+ released from the n-HA have been shown to enhance the MC3T3-E1 preosteoblast cell differentiation under osteogenic induction.45 For a closer look at the osteogenic behavior of USSC, the expression of three important bone-related genes was studied on TCPS and scaffolds. Runx2 is a transcription factor that is of major importance in the orientation of osteoprogenitors and stem cells toward osteolineage.46 Compared to TCPS, both scaffolds showed a higher expression of Runx2 on days 7 and 14 and there was no significant difference between the mRNA levels on PLLA and n-HA/PLLA. This demonstrated that n-HA could not enhance the expression of Runx2 on n-HA/PLLA electrospun scaffolds. Accordingly, Lin et al. showed the inability of HA to up-regulate Runx2 expression and concluded that the HA promoted the osteogenic orientation of stem cells via up-regulation of genes like ALP and osteocalcin rather than the Runx2 pathway.47 The expression of osteonectin and osteocalcin was also investigated in this study. Osteonectin is a glycoprotein that binds Ca2+ and regulates the initial stages of crystal growth. Osteocalcin is known to be expressed late during osteogenesis and has a critical role in biomineralization.3 On day 7, a higher expression of osteonectin was detected on n-HA/PLLA compared to PLLA and TCPS, which both showed similar mRNA levels for this gene. This is indicative that, contrary to the nanofibrous structure, n-HA stimulated the upregulation of osteonectin prior to the final mineralization. Accordingly, Sefcik et al.48 reported that there was no significant difference between the osteonectin expression in adipose stem cells cultured on nanofiber scaffolds and TCPS. In our study, the mRNA level of osteonectin on PLLA reached the value of that on n-HA/PLLA on day 14 and a significant higher expression was observed on both scaffolds compared to TCPS. These findings demonstrated that the n-HA induced the early up-regulation of osteonection on nanofibrous structures. The late stage of osteogenic differentiation was observed on day 14, while the osteocalcin expression was up-regulated in the USSC on TCPS and both scaffolds. On the corresponding day, the synergistic effect of PLLA nanofibers and n-HA on the osteogenic differentiation of USSC were confirmed from this fact that higher osteocalcin transcripts were detected on n-HA/ PLLA, PLLA, and TCPS, respectively. Chuenjitkuntaworn et al.49 reported similar findings about the expression of osteocalcin in preosteoblastic cells on similar surfaces, except the n-HA/ PLLA, which was fabricated via the electrospinning of PLLA solution blended with n-HA. Interestingly, in this study, we observed that the coating of n-HA on the surface of electrospun nanofibers led to bone formation 10 weeks after subcutaneous implantation. This was certainly the effect of n-HA since uncoated PLLA nanofibers showed no bone formation. Osteoinduction of HA implanted in nonosseous tissues has been previously reported.12,13 Here, our findings suggested that the n-HA directly coated on the

Seyedjafari et al.

surface of nanofibers could induce bone formation under the skin of mice in the absence of exogenous inductive agents or cells. Taking all the results into account, PLLA nanofibers along with the n-HA coated on their surface synergistically enhanced the osteogenic differentiation of USSC. Herein, n-HA/PLLA scaffolds ideally mimic the bone ECM, which is composed of collagen type I nanofibers mineralized with nanosized CaP crystallites.2 Compared to collagen, pristine PLLA exhibits suitable mechanical characteristics and its surface properties can be improved via plasma treatment.50,51 Therefore, appropriate physical and chemical cues are generated from a n-HA/PLLA nanofibrous structure and push USSC to differentiate to osteoblast-like cells under osteogenic induction. Moreover, this structure showed the capacity to induce bone formation when implanted subcutaneously in the absence of exogenous cells. Our in vitro results demonstrated that the combination of USSC and n-HA/PLLA nanofiber scaffold hold great promises for bone tissue engineering. Further studies should include in vivo application of this cell-scaffold construct for ectopic bone generation or healing of bone defects.

Conclusion In the present study, we investigated the osteogenic differentiation of the recently introduced human UCB-derived USSC on PLLA and n-HA/PLLA nanofiber scaffolds. It was demonstrated that not only the nanofibrous structure of scaffold, but also n-HA coated on the surface of nanofibers enhanced the osteogenic differentiation of USSC. These enhancements were confirmed at the level of biochemical and gene expression analysis. In addition, n-HA/PLLA electrospun scaffold showed the capacity for ectopic bone formation in the absence of exogenous cells. Further in vivo analysis is needed to assess the capacity of the USSC-loaded n-HA/PLLA scaffolds for bone regeneration in critical-size bone defects. Acknowledgment. This work was financially supported by Stem Cell Technology Research Center (Tehran, Iran).

References and Notes (1) Greenwald, A. S.; Boden, S. D.; Goldberg, V. M.; Khan, Y.; Laurencin, C. T.; Rosier, R. N. J. Bone Joint Surg. Am. 2001, 98–103, 83-A Suppl 2 Pt 2. (2) Fratzl, P.; Gupta, H.; Paschalis, E.; Roschger, P. J. Mater. Chem. 2004, 14, 2115–2123. (3) Roach, H. Cell Biol. Int. 1994, 18, 617–628. (4) Hollister, S.; Maddox, R.; Taboas, J. Biomaterials 2002, 23, 4095– 4103. (5) Smith, L.; Ma, P. Colloids Surf., B 2004, 39, 125–131. (6) Ko¨gler, G.; Sensken, S.; Airey, J.; Trapp, T.; Mu¨schen, M.; Feldhahn, N.; Liedtke, S.; Sorg, R.; Fischer, J.; Rosenbaum, C. J. Exp. Med. 2004, 200, 123. (7) Ko¨gler, G. Fundam. Tissue Eng. Regener. Med. 2009, 167–176. (8) Fallahi-Sichani, M.; Soleimani, M.; Najafi, S.; Kiani, J.; Arefian, E.; Atashi, A. Cell Biol. Int. 2007, 31, 299–303. (9) Ahmadbeigi, N.; Seyedjafari, E.; Gheisari, Y.; Atashi, A.; Omidkhoda, A.; Soleimani, M. Cell Biol. Int. 2010, 34, 687–92. (10) Laurencin, C. ASTM International: West Conshohocken, PA, 2003. (11) LeGeros, R. Clin. Orthopaed. Relat. Res. 2002, 395, 81. (12) Yamasaki, H.; Sakai, H. Biomaterials 1992, 13, 308–312. (13) Ripamonti, U. Biomaterials 1996, 17, 31–35. (14) Habibovic, P.; Yuan, H.; van der Valk, C.; Meijer, G.; van Blitterswijk, C.; de Groot, K. Biomaterials 2005, 26, 3565–3575. (15) Yuan, H.; De Bruijn, J.; Li, Y.; Feng, J.; Yang, Z.; De Groot, K.; Zhang, X. J. Mater. Sci.: Mater. Med. 2001, 12, 7–13. (16) Fujibayashi, S.; Neo, M.; Kim, H.; Kokubo, T.; Nakamura, T. Biomaterials 2004, 25, 443–450. (17) Venugopal, J.; Vadgama, P.; Kumar, T.; Ramakrishna, S. Nanotechnology 2007, 18, 055101.

nHa-Coated Electrospun Poly(L-lactide) Nanofibers (18) Prabhakaran, M.; Venugopal, J.; Ramakrishna, S. Acta Biomater. 2009, 5, 2884–2893. (19) Song, J.; Kim, H.; Kim, H. J. Mater. Sci.: Mater. Med. 2008, 19, 2925–2932. (20) Jose, M.; Thomas, V.; Johnson, K.; Dean, D.; Nyairo, E. Acta Biomater. 2009, 5, 305–315. (21) Jeong, S.; Ko, E.; Yum, J.; Jung, C.; Lee, Y.; Shin, H. Macromol. Biosci. 2008, 8, 328–338. (22) Yu, H.; Jang, J.; Kim, T.; Lee, H.; Kim, H. J. Biomed. Mater. Res., Part A 2009, 88, 747–754. (23) Chen, J.; Chu, B.; Hsiao, B. J. Biomed. Mater. Res., Part A 2006, 79, 307–317. (24) Gupta, D.; Venugopal, J.; Mitra, S.; Giri Dev, V.; Ramakrishna, S. Biomaterials 2009, 30, 2085–2094. (25) McCullen, S.; Zhu, Y.; Bernacki, S.; Narayan, R.; Pourdeyhimi, B.; Gorga, R.; Loboa, E. Biomed. Mater. 2009, 4, 035002. (26) Yang, F.; Wolke, J.; Jansen, J. Chem. Eng. J. 2008, 137, 154–161. (27) Babaeijandaghi, F.; Shabani, I.; Seyedjafari, E.; Safaei Naraghi, Z.; Vasei, M.; Haddadi-Asl, V.; Kamyab Hesari, K.; Soleimani, M. Tissue Eng., Part A 2010, DOI: 10.1089/ten.TEA.2009.0829. (28) Hashemi, S.; Soleimani, M.; Zargarian, S.; Haddadi-Asl, V.; Ahmadbeigi, N.; Soudi, S.; Gheisari, Y.; Hajarizadeh, A.; Mohammadi, Y. Cells Tissues Organs 2008, 190, 135–149. (29) Shabani, I.; Haddadi-Asl, V.; Seyedjafari, E.; Babaeijandaghi, F.; Soleimani, M. Biochem. Biophys. Res. Commun. 2009, 382, 129–133. (30) Kneser, U.; Schaefer, D.; Polykandriotis, E.; Horch, R. J. Cell. Mol. Med. 2006, 10, 7–19. (31) Fan, Y.; Duan, K.; Wang, R. Biomaterials 2005, 26, 1623–1632. (32) Marelli, B.; Ghezzi, C.; Barralet, J.; Boccaccini, A.; Nazhat, S. Biomacromolecules 2010, 4433–4442. (33) Ferreira, L.; Karp, J.; Nobre, L.; Langer, R. Cell Stem Cell 2008, 3, 136–146. (34) Zhu, X.; Cui, W.; Li, X.; Jin, Y. Biomacromolecules 2008, 9, 1795– 1801.


3125

(35) Yanagida, H.; Okada, M.; Masuda, M.; Ueki, M.; Narama, I.; Kitao, S.; Koyama, Y.; Furuzono, T.; Takakuda, K. J. Biosci. Bioeng. 2009, 108, 235–243. (36) Li, W.; Cooper, J., Jr.; Mauck, R.; Tuan, R. Acta Biomater. 2006, 2, 377. (37) Jaiswal, N.; Haynesworth, S.; Caplan, A.; Bruder, S. J. Cell. Biochem. 1997, 64, 295–312. (38) Holy, C.; Shoichet, M.; Davies, J. J. Biomed. Mater. Res., Part A 2000, 51, 376–382. (39) Yang, J.; Bei, J.; Wang, S. Polym. AdV. Technol. 2002, 13, 220–226. (40) Ryu, G.; Yang, W.; Roh, H.; Lee, I.; Kim, J.; Lee, G.; Lee, D.; Park, B.; Lee, M.; Park, J. Surf. Coat. Technol. 2005, 193, 60–64. (41) Anderson, H.; Sipe, J.; Hessle, L.; Dhamyamraju, R.; Atti, E.; Camacho, N.; Millan, J. Am. J. Pathol. 2004, 164, 841. (42) Sottile, V.; Thomson, A.; McWhir, J. Cloning Stem Cells 2003, 5, 149–155. (43) Ruckh, T.; Kumar, K.; Kipper, M.; Popat, K., Acta Biomater. 2010. (44) Smith, L.; Liu, X.; Hu, J.; Wang, P.; Ma, P. Tissue Eng., Part A 2009, 15, 1855–1864. (45) Jung, G.; Park, Y.; Han, J. J. Mater. Sci.: Mater. Med. 2010, 21, 1649– 1654. (46) Viereck, V.; Siggelkow, H.; Tauber, S.; Raddatz, D.; Schutze, N.; Hu¨fner, M. J. Cell. Biochem. 2002, 86, 348–356. (47) Lin, L.; Chow, K.; Leng, Y. J. Biomed. Mater. Res., Part A 2009, 89, 326–335. (48) Sefcik, L.; Neal, R.; Kaszuba, S.; Parker, A.; Katz, A.; Ogle, R.; Botchwey, E. J. Tissue Eng. Regener. Med. 2008, 2, 210–220. (49) Chuenjitkuntaworn, B.; Supaphol, P.; Pavasant, P.; Damrongsri, D. Polym. Int. 2010, 59, 227–235. (50) Ma, L.; Gao, C.; Mao, Z.; Zhou, J.; Shen, J.; Hu, X.; Han, C. Biomaterials 2003, 24, 4833–4841. (51) Khorasani, M.; Mirzadeh, H.; Irani, S. Radiat. Phys. Chem. 2008, 77, 280–287.

BM1009238

Nanohydroxyapatite-Coated Electrospun Poly(l-lactide) - American

Recommend Documents