Nanopore-Based Electrochemiluminescence for ... - ACS Publications

Subscriber access provided by GRIFFITH UNIVERSITY

Article

Nanopore-Based Electrochemiluminescence for Detection of microRNAs via Duplex-Specific Nuclease-Assisted Target Recycling Xiao-Lei Huo, Hui Yang, Wei Zhao, Jing-Juan Xu, and Hong-Yuan Chen ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b11524 • Publication Date (Web): 07 Sep 2017 Downloaded from http://pubs.acs.org on September 9, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Nanopore-Based Electrochemiluminescence for Detection of microRNAs via Duplex-Specific Nuclease-Assisted Target Recycling Xiao-Lei Huo, Hui Yang, Wei Zhao, Jing-Juan Xu*, Hong-Yuan Chen State Key Laboratory of Analytical Chemistry for Life Science and Collaborative Innovation Center of Chemistry for Life Sciences, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023, China. * Corresponding author. Phone/Fax: +86-25-89687294. E-mail: [email protected]

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 26

ABSTRACT In this study, we proposed a nanopore-based ECL sensor combined with DuplexSpecific Nuclease (DSN)-assisted target recycling amplification to detect microRNAs. Due to the synergetic effect of electrostatic repulsion and volume exclusion of gold nanoparticle-labeled DNA capture (DNA-Au NPs) to negatively charged luminol anion probe, the DNA-Au NPs modified anodized aluminium oxide (AAO) nanopores electrode exhibited high ECL decline in comparison to bare AAO electrode. Upon the introduction of DSN and target microRNA, the specific DNA-RNA binding and enzyme cleaving could trigger the detachment of capture DNA from the membrane surface, resulting in uncapping of AAO and an increased ECL signal. For comparsion, positively charged Ru(bpy)32+ was used as ECL probe instead of luminol. Because the electrostatic attraction effect between DNA and Ru(bpy)32+ is partially offset by the volume exclusion effect of Au NPs, AAO electrode only modified with DNA capture is more suitable for Ru(bpy)32+ case. In our experiment, the case of negatively charged luminol combined with the synergetic effect of electrostatic repulsion and volume exclusion of DNA-Au NPs provides a quantitative readout proportional to the target microRNAs concentration in the range of 1.0 fM to 1.0 nM with a lower detection limit (LOD) of 1 fM.

KEYWORDS: nanopore, electrochemiluminescence, DSN, microRNAs, anodized aluminium oxide.


2

Page 3 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


■ INTRODUCTION Anodized aluminium oxide (AAO) nanoporous membranes, as one of the most important porous materials, have been widely used for electrochemical biosensors to detect small molecules, metal ions, DNA/RNA, proteins, cells and virus.1–8 In these researches, DNA/RNA detection using AAO nanoporous membranes biosensor is the mostly studied one. The mechanisms for DNA/RNA detection with nanoporous membranes can be explained by different way, mostly via the volume exclusion and the electrostatic interactions mechanisms.9 Previously, the utilization of the volume exclusion mechanism for DNA detecting has been demonstrated.10-14 In this mechanism, nanopores are blocked due to the target DNA bound onto the single-stranded DNA that covalently attached to the walls. This result is detected by a drop in ionic flux or current of electroactive species. Au NPs tagged onto DNA are also used to block pores and hinder the diffusion of [Fe(CN)6]4-/3-, improving the sensitivity of the assay.8,14 Another mechanism, as called electrostatic interactions, means that the negatively charged nanopores surface will hinder the diffusion of negatively charged ions, but accelerate the diffusion of positively charged ions.1517

It is confirmed that the electrostatic repulsion effect is an obvious process for the anion in

negatively charged DNA modified AAO nanopores with a 20 nm pore diameter.16 Indeed, electrostatic effect and volume exclusion always exist at the same time. Until now, the detection limit of target DNA or RNA using AAO nanopores is mainly between nM and pM level. Therefore, to achieve lower levels of detection is a real challenge. Electrochemiluminescence (ECL) technique has been extensively applied to biosensing with the advantages of low cost, wide range of analytes, low background signal, and high sensitivity.18-21

Luminol

and

Tris(2,2’-bipyridyl)

dichlororuthenium(II)

(Ru(bpy)3Cl2), as the luminescence reagents, have been widely used in

hexahydrate

ECL sensors.22-23


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 26

Luminol will produce dianion in alkaline solution and the Ru(bpy)32+ possesses two positive charges. This means that the selection of luminol anion and Ru(bpy)32+ by DNA modified AAO nanopores can be used as a ECL probe to detect target DNA or RNA. Here, based on DSN-assisted target recycling amplification and high sensitivity of ECL detection, we proposed a nanopore-based ECL sensor with luminol anion and Ru(bpy)32+ as probes to detect the target microRNAs. DSN is a nuclease with a strong preference for cleaving DNA-DNA duplex or DNA in DNA-RNA hetero duplexes and does not cleave single-stranded DNA, or single-stranded RNA. It is usually used to create a signal-amplifying mechanism and increase the detection sensitivity of RNA. Based on this unique property, DSN is very suitable for miRNA signal-amplifying detection via the formation of DNA–RNA hetero duplexes using a capture DNA probe.24 As shown in Scheme 1, aminated DNA probes labeled with Au NPs was covalently attached onto nanoporous alumina using silane and glutaraldehyde coupling chemistry.25 The DNA-Au NPs modified AAO membranes exhibited an increased ECL intensity for Ru(bpy)32+ and decreased intensity for luminol compared to the original membrane. Once the DSN enzyme and target microRNA were introduced, the specific DNA-RNA binding and enzyme cleaving could trigger the detachment of DNA-Au NPs from the membrane surface, resulting in uncapping of AAO. Thus, a reduced ECL intensity with Ru(bpy)32+ and an increased signal with luminol from the uncapped AAO membrane could be detected. In addition, DSNassisted target recycling can offer effective signal amplification by cleaving the DNA probe upon binding to the target and therefore to release and reuse the target. As a result, a low miRNA concentration could be detected and a high selectivity was observed. The results displayed that this designed ECL sensor achieved a high sensitivity and selectivity for miRNA detection, providing a great promise in clinical diagnosis.


4

Page 5 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1. Schematic Illustration of (A) Construction Nanopores-Based electrode, (B) Preparation of Nanopores-Based ECL Platform and (C) ECL Detection Using Luminol or Ru(bpy)32+. ■ EXPERIMENTAL SECTION Chemicals and Materials. 3-aminopropyltrimethoxysilane (APS), glutaraldehyde (25wt% solution in water), propylamine, tris (2-carboxyethyl) phosphine hydrochloride (tris-HCl), Tris(2-carboxyethyl)phosphine (TCEP), bovine serum albumin (BSA), luminol and Ru(bpy)3Cl2 were obtained from Sigma Aldrich. DSN and 10 × DSN master buffer (500 mM Tris-HCl, 50 mM MgCl2, 10 mM DTT, pH 8.0) were purchased from Evrogen (Moscow, Russia). AAO nanoporous membranes (the side with 35 nm pores as back and 20 nm pores as front) were purchased from Top membranes Technology co., LTD. HPLC-purified, synthetic miRNAs and all other oligonucleotides were purchased from Sangon Biotech Co. Ltd. (Shanghai, China). The Sequence information for synthetic miRNAs and oligonucleotides are listed in Table 1. Other reagents were of analytical grade and used as received. Aqueous solutions were prepared using ultrapure water.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 26

Table 1. Sequence information for synthetic miRNAs and oligonucleotides used in this study synthetic oligonucleotide

abbreviation

sequence

capture DNA

SH-107-NH2

3′SH-TGATAGCCCTGTACAATGCTGCTNH25′

target

miRNA-107

5′AGCAGCAUUGUACAGGGCUAUCA3′

noncomplementary RNA

miRNA-141

5′ GGUAGAAAUGGUCUGUCACAAU 3′

LET-7b

5′ UGAGGUAGUAGGUUGUGUGGUU3′

miRNA-21

5′UAGCUUAUCAGACUGAUGUUGA3′

Preparation of Au NPs. 13 nm Au NPs were prepared by sodium citrate reduction. In a 250 ml round-bottom flask equipped with a condenser, 100 ml of 1.0 mM HAuCl4 was heated to boil under vigorously stirring. 10 ml of 38.8 mM sodium citrate was quickly added to the solution and continued for 10 min. After the solution reached room temperature, it was filtered through a 0.22 µm nylon filter. For comparison, 5 nm Au NPs were prepared through the reduction of HAuCl4 by NaBH4.26 Briefly, 0.6 mL of ice cold NaBH4 (0.1 M) was added to 20 mL of aqueous solution containing 0.25 mM HAuCl4 under continuous stirring. Keep on stirring in ice bath for 10 min. Then, the solution reacted at room temperature with continuous stirring for another 3 h till the color changed from orange-red to wine red. The UV-vis absorbance spectroscopy of the resultant gold nanoparticles was shown in Figure S1. 30 nm Au NPs (0.33 nM) were purchased from TED PELLA, INC. Preparation of DNA modified Au NPs (DNA-Au NPs): Gold nanoparticles were functionalized with capture SH-107-NH2 via gold-sulfur chemistry. Thiol-modified DNA was activated with 10 µL of 100 mM TCEP and incubated for 60 min at room temperature to reduce the disulfide bonds of the SH-107-NH2. A fixed amount of 5, 13 or 30 nm Au NPs were added


6

Page 7 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


into the DNA solution and made the molar ratio Au NPs : DNA≈1:75. The solution was incubated for 48 h and then centrifuged (15000 rpm, 30 min). The deposition was resuspended in a fixed amount of stock solution (50 mM Tris buffer) to make the particles concentration around 10 nM and stored at 4°C for further use. Porous membranes functionalization and immobilization of probe DNA-Au NPs. AAO membranes functionalization was followed by Smirnorv’s group with slight change.25 Pt film was firstly sputtered on the back side of AAO nanoporous membranes with a current of 15 mA in a vacuum chamber for 100 s (Ar plasma). The Pt layer used here could improve the electrical conductivity between AAO membranes and ITO glass. Then the membranes were treated with plasma for 4 min and immersed into ultra-pure water for 1 h. This process was repeated 2 times. After drying in oven at 120 °C for 1 h, they were immersed into 5% APS of alcohol solution for 6 h. After washing in alcohol, the membranes were baked at 120 ºC for 30 min. Then an electrical insulation tape with 4 mm hole was pasted onto membranes, making the Pt layer of AAO tightly adhere to the ITO (Scheme 1A). It should be noted that the insulation tape used in the experiment possessed good water-resistance ability and prevent the leakage of the electrolyte. 30 µL 25% aqueous solution of glutaraldehyde were dropped on the membranes overnight. After washing with ultra-pure water, 30 µL DNA-Au NPs were placed on the membranes and left there for a determined time. Finally, in order to improve the efficiency of the hybridization, the glutaraldehyde was neutralized overnight in a 2% aqueous solution of BSA. For the DNA modified membranes, a same volume of 10 µM capture DNA was used instead of DNA-Au NPs. ECL detection of miRNAs. DSN-assisted miRNA recycling amplification was performed in a 40 µL reaction mixture containing 1ⅹDSN master buffer (50 mM Tris–HCl (pH 8.0), 5 mM MgCl2 and 1 mM DTT), 0.2 U DSN and different concentration of miRNA-107, incubating at 50


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 26

ºC for 2 h. Then, the detached Au NPs and residual fragment of DNA were washed away by ultra-pure water. ECL measurements were detected with MPI-E ECL analyzer (Remax Electronic Instrument Limited Co., Xi’an, China). The detection was performed in 10 mM Tris−HCl buffer (pH 8.3) containing 0.10 mM luminol and 5.0 mM H2O2 at a potential from 0.1 V to 0.6 V and scan rate of 100 mV/s. The voltage of the photomultiplier tube was set at -700 V in the process of detection. Electrochemical impedance spectroscopy (EIS) were carried out at room temperature using PGSTAT30/FRA2 (aotolab, Netherland) in above luminol solution with 0.1 M KCl within the frequency range from 0.5 Hz to 100 kHz and a bias potential of 0.65 V. For the ECL detection with Ru(bpy)32+, it is performed in 10 mM Tris−HCl buffer (pH 7.3) containing 0.10 mM Ru(bpy)32+ and 10 mM TPrA at a potential from 0.45 V to 1.15 V. The voltage of the photomultiplier tube was set at -400 V in the process of detection. The EIS bias potential is 1.15 V and detected in above Ru(bpy)32+/TPrA solution with 0.10 M KCl. The all measurements were detected in a three-electrode mode with ITO electrode as working electrode, a Pt wire counter electrode, and Ag/AgCl reference electrode. A plastic clip bound with an Ag/AgCl wire and Pt wire was firstly clamped onto the AAO-ITO electrode and made the tips of Ag/AgCl reference electrode and Pt wire counter electrode immerse into solution. Then, the other end of reference electrode and counter electrode was connected to PGSTAT30/FRA2. The EIS data were fitted to appropriate equivalent circuits and analyzed with computer program ZSimDemo version 3.30d. Apparatus and Characterization. Transmission electron microscopy (TEM) image was acquired on JEM-2100 (JEOL Ltd., Japan). Scanning electron microscope (SEM) image was obtained with Hitachi S4800 (JEOL, Japan). ■ RESULTS AND DISCUSSION


8

Page 9 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1A shows the characterization of both sides of AAO membranes by SEM. As shown in Figure 1A and B, a well-ordered array of nanopores can be observed in both sides of the membranes and the pore sizes were roughly estimated at 35 nm for back side and 20 nm for front side. The pore size decreased to around 20 nm when a Pt film was sputtered on the membranes (Figure 1C). It should be noted that the sputtered Pt film could improve electrical conductivity and keep favorable electrical conductivity between AAO and ITO. Figure 1D shows the synthesized Au NPs with average diameter of 13 nm. Figure 1E and F shows the modification of DNA-Au NPs onto the front side of the membranes and the procedure of DSN-assisted target recycling amplification. Compared to the bare AAO membranes (Figure 1B), the DNA-Au NPs modified AAO membrane (Figure 1E) was more roughly and visibly and a lot of pores were blocked by the nanoparticles. After DSN-assisted target recycling, plentiful DNA-Au NPs were cleaved from the membrane (Figure 1F), leaving the nanopores opened. In our experiment, the DNA-Au NPs were modified onto membrane by a glutaraldehyde linker, which joined the amino groups of 5’-aminated DNA and the terminal amino group of aminosilane. This chemical bond can firmly fix the DNA-Au NPs on the membrane, avoiding undesirable detachment of the nanoparticles. In addition, the DNA of DNA-Au NPs can form DNA–RNA hetero duplexes when the target miRNAs were added. DSN enzyme could cleave DNA in the hetero duplexes and does not cleave single-stranded DNA, or single-stranded RNA. Both of the firm chemical bond and DSN enzyme can improve the detection specificity. Moreover, DSN-assisted target recycling can offer effective cleaving DNA on DNA-Au NPs and therefore to release and reuse the target. Hence, most of DNA-Au NPs were cleaved from the membrane in Figure 1F.


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 26

Figure 1. (A) Back side of AAO membrane(~35nm). (B) Front side of AAO membrane(~20 nm) (C) The back side of AAO membrane after Pt layer deposition. (D) TEM image of Au NPs with the diameter around 13 nm. (E) AAO membrane modified with DNA-Au NPs, (F) DNA-Au NPs modified AAO after DSN-assisted target miRNA recycling with 1 nM miRNA-107 at 50 ºC for 2h. Then we investigated the ECL performance of the electrode in luminol/H2O2 solution. As can be seen in Figure 2A, a dramatic ECL intensity decline can be observed when DNA-Au NPs modified onto the membrane in comparison to the bare AAO electrode. After DSN-assisted target miRNA recycling, DNA of DNA-Au NPs was cleaved by DSN enzyme and released the Au NPs from the membranes. Due to the target recycling amplification assisted by DSN, the presence of a small amount of miRNAs result in the removal of a mass of DNA-Au NPs, leading to highly increased ECL peaks. Meanwhile, Figure 2A also shows the ECL intensity of DNA capture and DNA-Au NPs modified AAO. Both the DNA capture and DNA-Au NPs could reduce the ECL intensity, but the signal decrease more for the latter. For a bare AAO, the


10

Page 11 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


luminol anions diffuse through the pores and react at the ITO electrode, giving a high ECL signal. When the DNA-Au NPs covalently attach to the membranes, the 20 nm pores are partly sealed by the 13 nm Au NPs which provide considerable volume exclusion. In addition, the negatively charged DNAs modified nanopores on the Au NPs also have an electrostatic repulsion to luminol anion, further reducing the ECL intensity. Therefore, the significant increase of ECL intensity when DNA-Au NPs detached from the membranes was attributed to the reduction of volume exclusion and electrostatic repulsion together. Obviously, DNA-Au NPs modified AAO sensors have great advantage in detection of miRNAs compared to modifying DNA only (Figure 2C). It is obvious that the DNA-Au NPs have a strong effect on decrease of ECL intensity of luminol anion, for comparison, another oppositely charged ECL reagent, positively charged Ru(bpy)32+ as ECL probe was investigated further. Figure 2B shows the ECL response of bare AAO, DNA capture modified AAO, DNA-Au NPs modified AAO and DNA capture modified AAO after DSN-assisted target recycling. As can be observed, DNA-Au NPs modified AAO had a higher ECL intensity comparing to the bare AAO. Besides, the AAO electrode only modified with DNA capture had the highest ECL intensity. Figure 2D shows the comparison of the ECL performance of electrode modified with DNA capture and DNA-Au NPs after DSN-assisted target recycling. Compared to the DNA modified electrode, the DNA-Au NPs had a smaller decrease in ECL intensity due to the reduction of volume exclusion. That is no doubt a good testimony to the following two facts comparing to luminol case. Firstly, highly electronegative DNA molecules can increase the ECL intensity via electrostatic attraction of Ru(bpy)32+ cation. Secondly, the lower intensity for DNA-Au NPs modified AAO comparing to DNA capture modified AAO is a result of greater volume exclusion effect from Au NPs. Obviously,


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 26

electrostatic attraction and volume exclusion effect have an opposite effect in the Ru(bpy)32+ case. Therefore, the AAO electrode simply modified with DNA capture is more suitable for ECL detection in Ru(bpy)32+case.

Figure 2. (A) ECL response with luminol of (a) bare AAO, (b) DNA capture modified AAO, (c) DNA-Au NPs modified AAO and (d) DNA-Au NPs modified AAO after DSN-assisted target recycling with 1 nM miRNA-107 for 2h at 50 ºC. (B) ECL response with Ru(bpy)32+ of (a) bare AAO, (b) DNA capture modified AAO, (c) DNA-Au NPs modified AAO and (d) DNA capture modified AAO after DSN-assisted target recycling with 1 nM miRNA-107 for 2h at 50 ºC. Comparison of the ECL performance of DNA capture modified AAO, DNA-Au NPs modified AAO after DSN-assisted target recycling with (C) luminol and (D) Ru(bpy)32+. Besides, the result of the ECL changes is also verified by the electrochemical impedance spectroscopy (EIS). EIS were carried out at room temperature in luminol or Ru(bpy)32+ solution


12

Page 13 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with 0.1 M KCl within the frequency range from 0.5 Hz to 100 kHz. It is very necessary to construct an equivalent circuit for understanding and analyzing the EIS data. In our nanoporebased sensor, the equivalent circuit includes two sections: the classic circuit of AAO and Randles circuit (Figure 3 insert). Curve a in Figure 3A and B shows the EIS data of the bare ITO which possess a typical randles circuit. It can be seen that the resistance is much smaller than the AAObased electrode. Besides, for such nanopores electrode, the changes of ionic flow do not affected by ITO-electrolyte interface and the ion mobility is mostly affected by the ions’ interaction with the pores.27 Therefore, the Randles circuit would no further be considered for the nanopore-based electrode here. Circuit of AAO consists of two elements: the resistance of the membrane resistances (Rmem) and the membrane capacitance (Cmem). At low frequency, the capacitive component Cm no longer affects the total impedance value and the total impedance, Zt, can be approximately equal to Rmem.28 Hence, membrane resistances are only discussed for EIS analysis here. The EIS data of luminol case was shown in Figure 3A, the bare AAO revealed a small membrane resistance with a value about 2104 Ω (curve b). However, when the DNA-Au NPs was modified onto the electrode via covalent bond, the Rmem increased to 18012 (curve c) corresponding to the closing of the pores and electrostatic repulsion between the negatively charged DNA and anion luminol. Once treated with the DSN and target miRNAs, a significant decrease of the Rmem was obtained (1231 Ω, curve d). It was indicated that the DNA-Au NPs could be recognized by target miRNAs and then cut away from the AAO membranes, resulting in the opening of the pores. For Ru(bpy)32+case, the Rmem value of bare AAO is about 4373 Ω (curve b). However, when the DNA was modified onto the electrode via covalent bond, the Rmem decreased to 1990 Ω (curve c) corresponding to the electrostatic attraction between the negatively charged DNA and


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 26

positively charged Ru(bpy)32+ probe. Once treated with the DSN and target miRNAs, an increase of the Rct was obtained (4042 Ω, curve d) due to the release of DNA by enzyme cleavage. Both of these two EIS cases are consistent with the ECL phenomenon.

Figure 3. (A) The EIS with luminol of (a) bare ITO, (b) bare AAO, (c) DNA-Au NPs modified AAO and (d) after DSN-assisted target recycling. Bias potential: 0.65 V. (B) The EIS with Ru(bpy)32+ of (a) bare ITO, (b) bare AAO, (c) DNA capture modified AAO and (d) after DSNassisted target recycling. Bias potential: 1.15 V.


14

Page 15 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (A) The dependence of ECL peak intensity on incubation time with DNA-Au NPs (13 nm). (B) The dependence of ECL peak intensity on incubation time of DSN-assisted target recycling with 1nM miRNA-107 for 2h at 50 ºC for 13 nm DNA-Au NPs modified electrode. (C) ECL response of (a) bare AAO, (b) 5nm, (c) 13nm and (d) 30 nm DNA-Au NPs modified AAO. (D) ECL response of AAO modified with different size of DNA-Au NPs after DSN-assisted target recycling with 1nM miRNA-107 for 2h at 50 ºC. The ECL detection was performed in 10 mM Tris−HCl buffer (pH 8.3) containing 0.1 mM Luminol and 5 mM H2O2. Scan rate: 100 mV/s. Scan range: 0.1−0.6 V. In order to improve the assay performance for the detection of the miRNAs, three important parameters, the DNA-Au NPs modification time, DSN incubation time and the size of Au NPs were optimized. In figure 4A, a quick decrease in the ECL peak with the extension of the incubation time from 0 to 36 h could be observed, and the intensity drop reaches a plateau at 24


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 26

h. Therefore, 24 h was selected as the optimal modification time. Figure 4B shows the dependence of ECL intensity on incubation time of DSN-assisted target miRNA recycling. A continuous increase of ECL signals with the incubation time from 0 to 160 min could be found, and the ECL intensity reached a plateau at 120 min. Therefore, 120 min was selected as the optimal incubation time. It should be noted that 13 nm Au NPs were used in above all experiment. For comparison, the ECL performances of AAO modified with different size of DNA-Au NPs were investigated in the following experiment. As shown in Figure 4C, with the increase of DNA-Au NPs’ size, the ECL intensity decreased. However, DNA-Au compared with the 5 nm and 30 nm DNA-Au NPs modified AAO electrode, the 13 nm DNA-Au NPs modified electrode has a larger ECL intensity increase after DSN-assisted target recycling amplification(Figure 4D). This smaller increase for 5 nm DNA-Au NPs modified AAO electrode is associated with the volume exclusion. Smaller DNA-Au NPs provide lower volume exclusion and hence give a relative small signal increase after releasing away from AAO membranes. In addition, the smaller changes of ECL intensity for 30 nm DNA-Au NPs modified AAO electrode may be contributed to the fact that larger diameter Au NPs hindered the miRNA recognition with DNA and DSN enzyme cleavage. Therefore, 13 nm DNA-Au NPs were selected for the miRNA detection. Under the optimized conditions, the relationship between the ECL intensity of luminol and the concentration of target miRNA were investigated. As illustrated in Figure 5A, with the adding of miRNAs, the concentration dependence of the signal changes was obtained. ECL changes (I−I0) was found to be logarithmically related to the concentration of the target miRNAs in the range from 1.0 fM to 1.0 nM with R =0.987 (inset in Figure 6A). Meanwhile, the miRNA concentration as low as 1 fM could be detected (S/N = 3). For comparison, the linear range of


16

Page 17 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Ru(bpy)32+ case on DNA modified AAO electrode was from 1.0 nM to 0.10 pM with a detection limit 0.6 pM (Figure S2).

Here, this high detection limit of the Ru(bpy)32+/DNA sensor

compared to the luminol/DNA-Au NPs was mostly contributed to the fact that electrostatic attraction effect work only in the detection. Definitely, the negatively charged luminol combined with the synergetic effect of electrostatic repulsion and volume exclusion of DNA-Au NPs possessed a lower detection limit. Note that the detection limits of the developed sensors using ECL method for detection of DNA/RNA are more sensitive than other biosensors based on AAO (Table 2).

Figure 5. (A) Relationship between the increment in ECL peak height after DSN-assisted target recycling (I-I0) and miRNA concentration. Inset show logarithmic calibration plot plots. Error bars represent the standard deviation of three independent experiments. Detection limit:1 fM. (B) Specificity investigation of the sensor for the target miRNA-107 (1.0 nM) against the blank assay and other controlled miRNA sequences of miRNA-21(1.0 nM), miRNA-141 (1.0 nM) and let-7B (1.0 nM). The detection was performed in 10 mM Tris−HCl buffer (pH 8.3) containing 0.1 mM Luminol and 5 mM H2O2. Table 2. DNA/RNA biosensors based on nanoporous anodic alumina oxide (AAO) and other ECL-based DNA/RNA sensors: detection principle, application and performance


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 26

Detection method

Target

detection limit

Reference

DPV

RNA

9.5 pM,

29

CV

DNA

0.5 nM

27

DPV

DNA

0.1 pM

30

Amperometric i-t Curve

DNA

0.1 nM

16

fluorescence

DNA

100 nM

31

Reflectometric interference

DNA

2 nmol/cm2

32

Resistance

DNA

10 µM

9

ECL

DNA

1.7 fM

33

ECL

RNA

0.5 fM

34

ECL

RNA

1 fM

This Work

spectroscopy

The selectivity of the biosensor for the target miRNA-107 (1.0 nM) against the blank assay and other control miRNA sequences of 1.0 nM for miRNA-21, miRNA-141 and let-7B were tested via comparing the ECL changes of luminol. As shown in Figure 5B, the signal raise was negligible for the control miRNAs or blank assay. While the presence of the target miRNAs could lead to a significant signal increase. These results demonstrated that DSN could provide excellent discrimination ability, and our nanopore-based ECL sensor possesses a high selectivity toward the target miRNAs against other control miRNAs. ■ CONCLUSION In conclusion, a nanopore-based ECL sensor modified with DNA-Au NPs was established. The DNA-Au NPs modified AAO electrode exhibited a strong repulsion effect for negatively charged luminol anion probe due to the electrostatic repulsion and volume exclusion effect, leading to a dramatic ECL decline. In our experimental design, the DSN is employed to amplify the signal


18

Page 19 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


output for cleaving DNA of DNA-Au NPs in presence of target miRNA-107 and release the DNA-Au NPs from the membranes. Due to the target recycling amplification, the presence of a small amount of miRNAs can result in the removal of a mass of DNA-Au NPs, leading to a low detection limit. The proposed method provides a quantitative readout proportional to the target concentration in the range of 1.0 fM to 1.0 nM with a high selectivity. It is envisaged that this assay could also be readily extended to other miRNA markers detection through adaptation of matched capture probe sequences. ■ ASSOCIATED CONTENT Supporting Information. This material is available free of charge via the Internet at http://pubs.acs.org. Figure of relationship between the increment in ECL peak height after DSN-assisted target recycling(I-I0) and miRNA concentration using Ru(bpy)32+ as ECL probe on DNA modified AAO electrode (PDF) ■ AUTHOR INFORMATION Corresponding Author *Phone/Fax: +86-25-89687294. E-mail: [email protected].. Author Contributions All authors have given approval to the final version of the manuscript. Notes The authors declare no competing financial interest.


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 26

■ ACKNOWLEDGMENT This work was supported by the Science and Technology Ministry of China (Grant No. 2016YFA0201200), the National Natural Science Foundation (Grants 21327902, 21535003) of China. This work was also supported by a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions and the Innovation Cross Team of Chinese Academy of Sciences.


20

Page 21 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


■ REFERENCES (1)Slowing, I. I.; Vivero-Escoto, J. L.; Trewyn, B. G.; Lin, V. S. Mesoporous Silica Nanoparticles: Structural Design and Applications. J. Mater. Chem. 2010, 20, 7924−7937. (2) Wang, G.; Zhang, B.; Wayment, J. R.; Harris, J. M.; White, H. S. Electrostatic-gated Transport in Chemically Modified Glass Nanopore Electrodes. J. Am. Chem. Soc. 2006, 128, 7679−7686. (3) Chua, J. H.; Chee, R. E.; Agarwal, A.; Wong, S. M.; Zhang, G. J. Label-free Electrical Detection of Cardiac Biomarker with Complementary Metal-oxide Semiconductor-compatible Silicon Nanowire Sensor Arrays. Anal. Chem. 2009, 81, 6266–6271. (4) Rosi, N. L.; Mirkin, C. A. Nanostructures in Biodiagnostics. Chem. Rev. 2005, 105, 1547– 1562. (5) de la Escosura-Muñiz, A.; Parolo, C.; Merkoçi, A.

Immunosensing Using

Nanoparticles. Mater. Today. 2010, 13, 24–34. (6) Li, Y.; Ito, T. Size-Exclusion Properties of Nanoporous Films Derived from Polystyrene− Poly (methylmethacrylate) Diblock Copolymers Assessed Using Direct Electrochemistry of Ferritin. Anal. Chem. 2009, 81, 851–855. (7) Wang, G.; Bohaty, A. K.; Zharov, I.; White, H. S. Photon Gated Transport at the Glass Nanopore Electrode. J. Am. Chem. Soc. 2006, 128, 13553–13558. (8) de la Escosura-Muñiz, A.; Mekoçi, A. Nanoparticle Based Enhancement of Electrochemical DNA Hybridization Signal Using Nanoporous Electrodes. Chem. Commun. 2010, 46, 9007–9009.


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 26

(9) Wang, X.; Smirnov, S. Label-free DNA Sensor Based on Surface Charge Modulated Ionic Conductance. Acs Nano. 2009, 3, 1004−1010. (10) Vlassiouk, I.; Takmakov, P.; Smirnov, S. Sensing DNA Hybridization via Ionic Conductance through a Nanoporous Electrode. Langmuir. 2005, 21, 4776–4778. (11) Takmakov, P.; Vlassiouk, I.; Smirnov, S. Hydrothermally Shrunk Alumina Nanopores and their Application to DNA Sensing. Analyst. 2006, 131, 1248–1253. (12) Smirnov, S.; Vlassiouk, I.; Rios, F.; Takmakov, P.; Gust, D. Smart Nanoporous Membranes. ECS Trans. 2007, 3, 23−29. (13) Yu, J.; Zhang, L.; Xu, X.; Liu, S. Quantitative Detection of Potassium Ions and Adenosine Triphosphate via a Nanochannel-based Electrochemical Platform Coupled with G-quadruplex Aptamers. Anal. Chem. 2014, 86, 10741−10748. (14) de la EscosuraⅹMuñiz, A.; Merkoçi, A. A Nanochannel/NanoparticleⅹBased Filtering and Sensing Platform for Direct Detection of a Cancer Biomarker in Blood. Small. 2011, 7, 675– 682. (15) Chen, W.; Wu, Z. Q.; Xia, X. H.; Xu, J. J.; Chen, H. Y. Anomalous Diffusion of Electrically Neutral Molecules in Charged Nanochannels. Angew. Chem., Int. Ed. 2010, 49, 7943–7947. (16) Li, S. J.; Li, J.; Wang, K.; Wang, C.; Xu, J. J.; Chen, H. Y.; Huo, Q. A Nanochannel Array-based Electrochemical Device for Quantitative Label-free DNA analysis. ACS Nano. 2010, 4, 6417–6424.


22

Page 23 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(17) Gao, H. L.; Li, C. Y.; Ma, F. X.; Wang, K.; Xu, J. J.; Chen, H. Y.; Xia, X. H. A Nanochannel Array Based Device for Determination of the Isoelectric Point of Confined Proteins. Phys. Chem. Chem. Phys. 2012, 14, 9460−9467. (18) Xu, S. J.; Liu, Y.; Wang, T. H.; Li, J. H. Positive Potential Operation of a Cathodic Electrogenerated Chemiluminescence Immunosensor Based on Luminol and Graphene for Cancer Biomarker Detection. Anal. Chem. 2011, 83, 3817−3823. (19) Duan, R. X.; Zhou, X. M.; Xing, D. Electrochemiluminescence Biobarcode Method Based on Cysteamine-Gold Nanoparticle Conjugates. Anal. Chem. 2010, 82, 3099−3103. (20) Xu, S. J.; Liu, Y.; Wang, T. H.; Li, J. H. Highly Sensitive Electrogenerated Chemiluminescence Biosensor in Profiling Protein Kinase Activity and Inhibition Using Gold Nanoparticle as Signal Transduction Probes. Anal. Chem. 2011, 82, 9566−9572. (21)Zhou, H.; Liu, J.; Xu, J. J.; Chen, H. Y. Highly Sensitive Electrochemiluminescence Detection of Single-nucleotide Polymorphisms Based on Isothermal Cycle-assisted Triple-stem Probe with Dual-nanoparticle Label. Anal. Chem. 2011, 83, 8320–8328 (22)Zhang, H. R.; Wang, Y. Z.; Zhao, W.; Xu, J. J.; Chen, H. Y. Visual Color-Switch Electrochemiluminescence Biosensing of Cancer Cell Based on Multichannel Bipolar Electrode Chip. Anal. Chem. 2016, 88, 2884−2890. (23) Zhang, H. R.; Wu, M. S.; Xu, J. J.; Chen, H. Y. Signal-on Dual-potential Electrochemiluminescence Based on Luminol–gold Bifunctional Nanoparticles for Telomerase Detection. Anal. Chem. 2014, 86, 3834−3840.


23


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 26

(24) Yin, B. C.; Liu, Y. Q.; Ye, B. C. One-step, Multiplexed Fluorescence Detection of MicroRNAs Based on Duplex-specific Nuclease Signal Amplification. J. Am. Chem. Soc. 2012, 134, 5064−5067. (25) Vlassiouk, I.; Krasnoslobodtsev, A.; Smirnov, S.; Germann, M. “Direct” Detection and Separation of DNA Using Nanoporous Alumina Filters. Langmuir. 2004, 20, 9913−9915. (26) Li, M. X.; Zhao, W.; Qian, G. S.; Feng, Q. M.; Xu, J. J.; Chen, H. Y. Distance Mediated Electrochemiluminescence Enhancement of CdS Thin Films Induced by the Plasmon Coupling of Gold Nanoparticle Dimers. Chem. Commun. 2016, 52, 14230−14233. (27)Wang, L.; Liu, Q.; Hu, Z.; Zhang, Y.; Wu, C.; Yang, M.; Wang, P. A Novel Electrochemical Biosensor Based on Dynamic Polymerase-extending Hybridization for E. coli O157: H7 DNA Detection. Talanta. 2009, 78, 647–652. [28] Walter, G. W. A Review of Impedance Plot Methods Used for Corrosion Performance Analysis of Painted Metals. Corros.Sci. 1986, 26, 681−703. (29) Rai, V.; Hapuarachchi, H. C.; Ng, L. C.; Soh, S. H.; Leo, Y. S.; Toh, C. S. Ultrasensitive cDNA Detection of Dengue Virus RNA Using Electrochemical Nanoporous Membrane-Based Biosensor. Plos. One. 2012, 7, e42346. (30) Rai, V.; Deng, J.; Toh, C. S. Electrochemical Nanoporous Alumina Membrane-based Label-free DNA Biosensor for the Detection of Legionella sp. Talanta. 2012, 98, 112−117. (31) Feng, C. L.; Zhong, X. H.; Steinhart, M.; Caminade, A. M.; Majoral, J. P.; Knoll, W. Graded-Bandgap Quantum-Dot-Modified Nanotubes: A Sensitive Biosensor for Enhanced Detection of DNA Hybridization. Adv. Mater. 2007, 19, 1933−1936.


24

Page 25 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(32) Pan, S.; Rothberg, L. J. Interferometric Sensing of Biomolecular Binding Using Nanoporous Aluminum Oxide Templates. Nano Lett. 2003, 3, 811−814. (33) Zhang, H. R.; Xu, J. J.; Chen, H. Y. Electrochemiluminescence Ratiometry: a New Approach to DNA Biosensing. Anal. Chem. 2013, 85, 5321-5325. (34) Feng, Q. M.; Shen, Y. Z.; Li, M. X.; Zhang, Z. L.; Zhao, W.; Xu, J. J.; Chen, H. Y. DualWavelength Electrochemiluminescence Ratiometry Based on Resonance Energy Transfer Between Au Nanoparticles Functionalized g-C3N4 Nanosheet and Ru (bpy)

3

2+

for MicroRNA

Detection. Anal. Chem. 2015, 88, 937-944.


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 26

Table of Contents.


26

Nanopore-Based Electrochemiluminescence for ... - ACS Publications

Recommend Documents