Nanoprobe-Initiated Enzymatic Polymerization for Highly Sensitive

Subscriber access provided by MONASH UNIVERSITY

Article

Nanoprobe-Initiated Enzymatic Polymerization for Highly Sensitive Electrochemical DNA Detection Ying Wan, Pengjuan Wang, Yan Su, Lihua Wang, Dun Pan, Ali Aldalbahi, Shulin Yang, and Xiaolei Zuo ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.5b08817 • Publication Date (Web): 03 Nov 2015 Downloaded from http://pubs.acs.org on November 9, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Nanoprobe−Initiated

Enzymatic

Polymerization

for

Highly

Sensitive Electrochemical DNA Detection Ying Wana, Pengjuan Wangb, Yan Sua, Lihua Wangc, Dun Panc, Ali Aldalbahid, Shulin Shulin Yangb, *, Xiaolei Zuoc, *

a

School of Mechanical Engineering, Nanjing University of Science and Technology, Nanjing 210094, China b School of Environmental and Biological and Engineering, Nanjing University of Science and Technology, Nanjing 210094, China c Division of Physical Biology and Bioimaging Center, Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800, China d Chemistry Department, King Saud University, Riyadh 11451,Saudi Arabia

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 23

Abstract Electrochemical DNA (E-DNA) sensors have been greatly developed and playing an important role in early diagnosis of different diseases. In order to determine the extremely low abundance of DNA biomarkers in clinical samples, scientists are making unremitting efforts towards achieving high sensitive and selective E-DNA sensors. Here, a novel E-DNA sensor was developed taking advantage of the signal amplification efficiency of nanoprobe-initiated enzymatic polymerization (NIEP). In the NIEP based E-DNA sensor, the capture probe DNA was thiolated at its 3′-terminal to be immobilized onto gold electrode and the nanoprobe was fabricated by 5′-thiol-terminated signal probe DNA conjugated gold nanoparticles (AuNPs). Both of the probes could simultaneously hybridize with the target DNA to form a “sandwich” structure, followed by the terminal deoxynucleotidyl transferase (TdT)-catalyzed elongation of the free 3′-terminal of DNA on the nanoprobe. During the DNA elongation, biotin labels were incorporated into the NIEP-generated long single-stranded DNA (ssDNA) tentacles, leading to specific binding of avidin modified horseradish peroxidase (Av-HRP). As there are hundreds of DNA probes on the nanoprobe, one hybridization event would generate hundreds of long ssDNA tentacles, resulting in tens of thousands of HRP catalyzed reduction of hydrogen peroxide and sharply increasing electrochemical signals. By employing nanoprobe and TdT, it is demonstrated that the NIEP amplified E-DNA sensor has a detection limit of 10 fM and excellent differentiation ability for even single-base mismatch. Keywords: Terminal deoxynucleotidyl transferase (TdT); nanoprobe; Electrochemical DNA (E-DNA) sensors; signal amplification. ______________________________ *Corresponding author. Phone/Fax: +86−25−84315945. E−mail: [email protected], [email protected]


Page 3 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


■ INTRODUCTION

DNA sensing technologies have attracted numerous attentions due to their broadly application in early diagnosis of different diseases such as cancer, infectious and chronic diseases.1−3 Among different DNA sensors, electrochemical DNA (E-DNA) sensor is an extremely promising one because of its superior flexibility, rapid portability, and easy integration.4−9 Despite of the remarkable progress achieved on E-DNA sensor, it is extremely challenging to detect extremely low abundance of DNA biomarkers in clinical sample.10−12 Scientists are making unremitting efforts towards achieving high sensitive and selective E-DNA sensors. In order to improve sensitivity of DNA sensors, several nucleic acid amplification technologies have been developed, such as polymerase chain reaction (PCR),13−15 rolling circle amplification (RCA),16−18 and other isothermal amplification strategies.19−21 Although these methods could detect low abundance of DNA, there are some drawbacks, including complicated operation steps and expensive instruments. To overcome these drawbacks, Tjing et al. developed a template-independent amplification strategy known as surface initiated enzymatic polymerization (SIEP),22 which employed terminal deoxynucleotidyl transferase (TdT) to catalyze the elongation of DNA at its 3′-terminal. By using SIEP, several E-DNA sensors have been developed and achieved high sensitivity.23−26 Other than nucleic acid amplification strategies, E-DNA sensors could be amplified by using enzyme27 and different nanomaterials.28−30 Liu et al. reported an E-DNA sensor on the basis of an autocatalytic and exonuclease III (Exo III)-assisted target recycling amplification strategy, which could detect DNA with the detection limit down to the 10 fM level.27 Gold nanoparticles(AuNPs) have been widely used in E-DNA sensors, due to its properties of unique uniformity, stability, and biocompatibility.31−33 The principle of most AuNPs based signal amplification strategies is that AuNPs can severe as carrier to load numerous DNA or 3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 23

electrochemical labels, leading to enhanced signal. Zhang et al. fabricated a nanoprobe by using a few hundred DNA strands conjugated AuNPs for construction of E-DNA sensor, which obtained detection limit of 10 fM.34 Taking advantage of thionine-capped diblock DNA/AuNP conjugate tags, Wang et al. reported the ultrasensitive electrochemical analysis of DNA down to fM level.35 Here, we proposed an E-DNA sensor based on nanoprobe-initiated enzymatic polymerization (NIEP) strategy, which was termed as E-NIEP DNA sensor. By employing AuNPs-DNA conjugates as nanoprobe and TdT-initiated DNA elongation, we aim to provide a promising approach for ultra-sensitive and selective detection of target DNA.

■ EXPERIMENTAL SECTION

Materials and Reagents. DNA oligonucleotides were purchased from Sangon Biotech Co. (Shanghai, China) with their sequences listed in Table 1. The capture probe (oligo 1) was designed with thiol modification at its 3′−terminus and a −(CH2)6− alkyl chain. The signal probe (oligo 2) was designed with thiol modification at its 5′−terminus and 10 consecutive thymines spacer. The capture probe was complementary to 3′−terminus of target DNA (oligo 3) and signal probe was complementary the 5′−terminus of oligo 3. Oligo 4 contains one−base mismatch; oligo 5 has two mismatched bases; oligo 6 has three mismatched bases. Oligo7 is a random sequence that is not complementary to the probe sequence. Table 1 Oligonucleotides that were employed in this work. Oligo

Sequence

Oligo 1 (capture probe) Oligo 2 (signal probe)

5′−GAAACCCTATGTATGCTC−SH−3′ 5′−SH−TTTTTTTTTTGTATGAATTATAATCAAA−3′


Page 5 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Oligo 3 (target DNA) Oligo 4 (1 mismatch ) Oligo 5 (2 mismatches ) Oligo 6 (3 mismatches ) Oligo 7 (noncognate)

Tris

5′−GAGCATACATAGGGTTTCTCTTGGTTTCTTTGATTATAATTCATAC−3′ 5′−GAGCATACATAGGGTTTCTCTTGGTTTCTTTGATTATGATTCATAC−3′ 5′−GAGCATACATAGGGTTTCTATTGGTTTCTTTGATTATGATTCATAC−3′ 5′−GAGCATGCATAGGGTTTCTATTGGTTTCTTTGATTATGATTCATAC−3′ 5′−ATCATCGATATCGTTCGATATCGTTATCGATTATCGTTATCATCGA−3′

(hydroxymethyl)

aminomethane

was

from

Cxbio

Biotechnology

Ltd.

Ethylenediaminetetraacetic acid (EDTA) and tris (2−carboxyethyl) phosphine hydrochloride (TCEP) were from Sigma Aldrich (St. Louis, MO, USA); SH−OEG (HS−(CH2)11−EG2−OH) was from Prochimia (Gdansk, Poland).; TMB substrate (3,3′,5,5′−tetramethylbenzidine; Neogen K-blue low-activity substrate) was purchased from Neogen (Lansing, MI, USA). Av-HRP was from Biolegend (San Diego, CA, USA). TdT was purchased from Beyotime Biotechnology Co. Ltd (Jiangsu, China). Bio−dATP was from Promocell (Heidelberg, Germany). AuNPs (D = 30±2 nm; OD = 1) was from Cytodiagnostics (Ontario, Canada). The buffer solutions involved in this study were as follows: the immobilization buffer and hybridization buffer were Phosphate buffered saline (PBS, pH = 7.2); the washing buffer was PBS (0.01 M, pH 7.4); nanoprobe was dispersed in PBS; PBSB (0.01 M PBS, 1% BSA, pH 7.0), or PBST (0.01 M PBS, 0.1% Tween, pH 7.0). All solutions were prepared with Milli-Q water (18MΩ.cm−1 resistivity) from a Millipore water system. Apparatus. Electrochemical measurements were performed with a CHI 630D electrochemical work station (CH Instruments Inc., Austin, TX, USA) and a conventional three-electrodes configuration was employed all through the experiment, which involved a gold working electrode, a platinum wire auxiliary electrode, and an Ag/AgCl reference 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 23

electrode. Cyclic voltammetry (CV) was carried out at a scan rate of 50 mV/s, and the voltage of amperometric current versus time was fixed at 100 mV and the electro reduction current was measured at 100 s when the HRP redox reaction would reach a steady state. Fabrication of nanoprobe. Nanoprobe was fabricated following the process of a literature.36 Briefly, Au−DNA were synthesized by incubating signal probes (3.3 µM) in 300 µL of AuNPs solution (~1 nM, 30 nm in diameter). After mixing at 350 rpm for 16 h, the Au-DNA conjugates were “aged” in salts (0.1 M of NaCl, 10 mM of phosphate, pH = 7.0) for 40 h. Excess reagents were removed by centrifuging at 10000 rpm for 15 min. The red oily precipitate was washed, re−centrifuged at 10000 rpm for 15 min, and then dispersed in 300 µL of buffer. Formation of the oligonucleotide−incorporated nonfouling surface (ONS). Gold electrodes were treated following the previous process.37 Thiolated capture probes at appropriate concentrations of 3 µL were then added to each electrode for overnight at 4 oC. The probe density was modulated by varying the concentration of capture probes (0.1, 0.2, 0.5, 1, 5and 10 µM). Then electrodes were incubated with different concentration of OEG (0, 0.1, 0.5, 1, 1.5 and 2 mM) for more than 4 h to obtain ONS. The electrodes were then rinsed with PBS buffer and dried with N2 after each step. Hybridization of target DNA or mismatched DNA. Target DNA at different concentration was pre−hybridized with nanoprobe for 30 min and then added to ONS. The reaction condition of mismatched DNA was the same as target DNA. The blank was tested by mixing PBS with nanoprobe and followed by the same steps with target DNA. In real sample detection, target DNA was diluted in human serum and then mixed with nanoprobe. After 1 h incubation at room temperature, electrodes were washed, dried and subjected to next step. NIEP. Mixed solution containing bio−dATP, 1 U TdT in reaction buffer was added to 6 ACS Paragon Plus Environment

Page 7 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


each working electrode. The TdT−mediated extension reaction was performed at 37 oC for 1 h. Next, electrodes were treated with Av-HPR. After the incubation for 15 min at room temperature, electrodes were washed with PBS buffer and subjected to electrochemical measurements.

■ RESULTS AND DISCUSSION

Scheme 1. Strategy of E-NIEP DNA sensor. Capture probe is immobilized on gold electrode via its 3′-thiol modification and nanoprobe is 5′-thiolated signal probe DNAs conjugated AuNP. Upon target hybridization, nanoprobes are connected to the electrode, leading to TdT-catalyzed incorporation of biotin labeled dATP into the free 3′-OH of signal probes. Then Av-HRPs are specifically attached onto NIEP-generated long single-stranded DNA (ssDNA), resulting in HRP catalyzed reduction of substrate (TMB and H2O2) and greatly enhanced electrochemical signals.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 23

The strategy. A schematic representation of our E–NIEP DNA sensor is shown in Scheme 1. Capture probes labeled with thiol at their 3′ terminus are immobilized at gold electrode surface via gold−Sulfur (Au−S) bond. Then the surface is passivated with SH-OEG to form ONS for minimizing the nonspecific adsorption. Nanoprobes are prepared by conjugating AuNPs with signal probes DNA via its 5′-thiol. Upon target binding, a “sandwich” type detection regime is formed, leading to attachment of nanoprobes onto the electrode surface. Nanoprobes were then subjected to TdT-mediated incorporation of biotin-dATPs into the 3′-OH of signal probes, followed by specific binding of Av-HRPs. Since there are a few hundred of DNA probes on each nanoprobe,38 one hybridization event would generate hundreds of long DNA chain, resulting in tens of thousands of HRPs catalyzing reduction of hydrogen peroxide.

Figure 1. (A) CV responses for the detection of 100 nM target (solid line) and no target (dashed line). (B) Amperometric curves that were obtained by detecting target DNA with a series of concentrations (0, 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM, 100 nM) in TMB substrate solution. Scan rate of CV: 0.1 V/s. Potential of amperometry: 0.1 V.


Page 9 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CV was employed to characterize the enzyme based electrocatalytic process. As shown in Figure 1A, there was a significant increase at the HRP-catalyzed reduction peak (~0.27 V, a characteristics for HRP/TMB/H2O2 catalytic system) after the recognition of target DNA (100 nM), indicating the successful attachment of Av-HRP on the electrode surface.39 To quantitatively measure the target binding events, target DNA with different concentrations (including 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM and 100 nM) were detected with amperometry. It can be observed that the amperometric current increased with target concentration in the range from 10 fM to 100 nM, which demonstrated the validity of this E-NIEP DNA sensor (Figure 1B).

Figure 2. Optimization of the concentration of capture probe (A), the concentration of SH-OEG (B) and dispensing buffer of nanoprobe (C). The S/N (signal-to-noise ratio) was calculated as follows: S/N= (Isignal − Iblank)/Iblank

Optimization of Parameters. In order to obtain the optimal performance of the E-NIEP system, we investigated the effect of several experimental conditions such as surface density of immobilized capture probes, concentration of SH-OEG, disperse buffer of nanoprobe. For the optimization of the capture probe density, we prepared a series of SAMs with different surface



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 23

density, by varying the capture probe concentration (0.1, 0.5, 1, 5and 10 µM). The signal of 100 nM target DNA and that of no target was used to test the signal-to-noise ratio (S/N): S/N= (Isignal − Iblank)/Iblank Isignal represents the amperometric response of 100 nM target, and Iblank represents the amperometric response of buffer solution without target. The S/N of our detection system illustrated a trade-off (Figure 2A): with lower capture probe density, the capture probes captured less target strands, which in turn brought less signaling nanoprobes and resulted in lower signal gain. With higher capture probe density, the capture probes can capture more target strands and bring enhanced electrochemical signal; however, high probe density would bring steric crowding and more non-specific binding of signal probes, resulting in lower S/N. It was predicted that the highest S/N occurred at a medium density, which coincided with the experimental observation: the optimized probe concentration was found to be 0.5 µM. The surface density of SH-OEG was also an important factor that influenced the performance of this E-NIEP DNA sensor. Previous studies have demonstrated that a well-formed capture probe/SH − OEG mixed monolayer possess superior non-specific adsorption resistance ability.37 We thus prepared a series of ONS with different SH-OEG concentration (0, 0.1, 0.5, 1, and 2 mM). Figure 2B demonstrated the relationship between S/N and SH-OEG concentration. The highest S/N ratio was realized at a concentration of 0.5 mM. While the density of SH-OEG was low, ONS was not well formed, resulting in non-specific binding and high background signal. However, while the OEG concentration was too high, it might replace capture probes leading to decrease of target capturing. Next, we investigated the effect of dispersion buffer for nanoprobes since nanoprobes played an important role in signal amplification. As shown in Figure 2C, the S/N ratio was


Page 11 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


tested when nanoprobe was dispersed in different buffer (PBS, PBST and PBSB). Nanoprobe in PBST provided lower noise and higher signal. The reason might be that tween could decrease the nonspecific adsorption and improve the stability of nanoprobe.40−42 Of note, there are some other factors that affect the performance of the E-NIEP DNA sensor, including incubation time of the target, TdT and Av-HRP. According to several literatures about DNA hybridization and biotin-avidin attachment on electrode surface, 1-h hybridization time and 15 min incubation time of biotin-avidin attachment in this work were enough to make complete reaction.43−45 The incubation time of TdT was investigated and reported in our previous work.23 It is experimentally the amperometric response for the target increased along with the extension time at first and saturated at around 1 h. Thus 1-h incubation time was chosen to be optimized experimental condition.

Figure 3 Amperometric response for E-NIEP DNA sensor with (red) and E-DNA sensor without nanoprobe (blue). Inset: Linear calibration curve for logarithmical concentration of target DNA. The data were collected from at least three independent sets of experiments.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 23

Biosensing. Under optimal experimental conditions, we interrogated the amperometric response for this E-NIEP DNA sensor (Figure 3). The amperometric signal was logarithmically related to the target concentration and monotonically increased in the target concentration ranging from 10 fM to 10 pM, which demonstrated the validity of this E-NIEP DNA sensor. The background signal was 0.187 µA and the error bar was 0.018 (data not show), the detection limit was calculated to be lower than 1 fM (3 times the signal from the standard deviation of the background noise). However, the obtained signal for 1 fM target cannot be distinguished from the blank (data not show), thus the detection limit was experimentally found to be 10 fM. On the contrast, the response of E-DNA sensor without nanoprobe was shown and the detection limit was found to be 100 pM. From the comparison, this E-NIEP DNA sensor improved the sensitivity for 4 orders of magnitudes.

Figure 4. Specificity for E-NIEP DNA sensor. Comparison for the signal intensity for detection performance of a series of targets at 1 nM: perfectly matched target DNA (oligo 3), 1-base mismatched DNA (oligo 4), 3-base mismatched DNA (oligo 5) and non-cognate (NC) DNA (oligo 6).


Page 13 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


We challenged the E-NIEP DNA sensor with a series of targets to evaluate the specificity (Figure 4). The signal intensity for 1 nM of noncognate DNA was statistically insignificant from that of the background (only nanoprobe in pure buffer), suggesting that this sensor was highly specific. Our sensor exhibited excellent differentiation ability toward even a single-base mismatched DNA. The reason might be that the sandwich type sensor has two probes complementary to the target, which enhances the selectivity.

Figure 5. Amperometric response for electrochemical detection of target DNA diluted with (dash area) or without (blank area) human serum. The data were collected from at least three independent sets of experiments.

Furthermore, we challenged our system in complicated samples. The target DNA was diluted in serum and then determined by the E-NIEP DNA sensor (Figure 5). Though the background increased slightly and the S/N was not good as in the pure solution after human serum was added, the E-NIEP DNA sensor provided the potential for successful detection of real sample.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 23

Table 2 Comparison of E−DNA sensors using different amplification strategies Amplification Response range Detection limit Assay time Reference strategy ExoIII 1 pM−10 nM 0.6 pM ~5 h 46 digestion/AuNP ExoIII digestion/ 10 fM−10 pM 10 fM ~3 h 27 G-quadruplex-he min RCA 0.1 pM−1 nM 0.1 pM >2.5 h 47 CSDPR/HCR. 10 fM−1 nM 8 fM 5h 48 TdT 1 pM−1 µM < 1 pM ~2.5 h 23 TdT/SLP 0.1 pM−100 nM < 0.1 pM ~2.5 h 24 TdT/ AuNP 10 fM−100 nM

Nanoprobe-Initiated Enzymatic Polymerization for Highly Sensitive

Recommend Documents