Nanoscaled Biodegradable MetalâPolymeric Three-Dimensional

Subscriber access provided by - Access paid by the | UCSB Libraries

Tissue Engineering and Regenerative Medicine

Nanoscaled Biodegradable Metal-Polymeric 3-Dimensional Framework for Endothelial Cell Patterning and Sustained Angiogenesis Dharunya Govindarajan, Rachita Lakra, Purna Sai Korrapati, Jayavel Ramasamy, and Manikantan Syamala Kiran ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.9b00267 • Publication Date (Web): 04 Apr 2019 Downloaded from http://pubs.acs.org on April 9, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Nanoscaled Biodegradable Metal-Polymeric 3-Dimensional Framework for Endothelial Cell Patterning and Sustained Angiogenesis Dharunya Govindarajan,# Rachita Lakra,# Purna Sai Korapatti, #,¥ Jayavel Ramasamy,† and Manikantan Syamala Kiran* #, ¥ #Biological

Materials Laboratory, CSIR-Central Leather Research Institute, Adyar, Chennai

600020, Tamil Nadu, India ¥Academy

of Scientific and Innovative Research, CSIR-Central Leather Research Institute,

Adyar, Chennai 600020, Tamil Nadu, India †Centre

for Research, Anna University, Chennai 600025, Tamil Nadu, India

*Corresponding Author Email: [email protected] and [email protected] The current work describes the development of nanoscaled biodegradable metal polymeric 3Dimensional framework with controlled nano-therapeutic release for endothelial cell patterning and sustained angiogenesis for biomedical applications. Biocompatible polymers gelatin and PLGA was used as polymeric nanofibrous 3-dimensional framework in core shell manner with gelatin core containing biodegradable and bioactive metal nano-framework of cobalt caged with PEGylated curcumin by co-axial electro-spinning. FTIR results confirmed the presence of nanobioactives in the core region of co-axial nanofibre. Scanning electron microscopic analysis of the co-axial nanofibrous system showed a 3-Dimensional architecture that favored endothelial cell adhesion, patterning, migration and proliferation. The as-synthesized nanoscaled biodegradable metal polymeric 3-Dimensional core-shell nanofibres exhibited potent antibacterial efficacy. Further, it improved the endothelial cell patterning promoting angiogenesis. The high therapeutic potential of cobalt nano-framework in the nanofibres enhanced the production of vascular

ACS Paragon Plus Environment

1

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 46

endothelial growth factor promoting angiogenesis that resulted in the earlier restoration of wounded tissue compared to untreated control in vivo animal models. The study opens up new horizon in exploring biodegradable biosorbable metal nano-framework for biomaterial applications. Further the present study opens up new strategy in developing biodegradable biosorbable biomaterial with enhanced vascularization efficacy to the biomaterial which is a key for acceptance of these biomaterials into the host tissue. Keywords: PCC (PEGylated Curcumin Cobalt) nanoparticles, GP: Gelatin/PLGA, core shell nanofibres, electro-spinning, wound healing.

INTRODUCTION The development of smart biomaterials that restore the basic function of damaged tissue by providing a three dimensional architecture for tissue restoration is of high significance.1, 2 One of the key processes that get influenced by 3D orientation of the scaffolds is cell patterning that helps endothelial cells to form tubular network like structures promoting vascularization at wound site.3 The strategies employed to mend chronic wounds and their related debilitating ailment is achieved by fabricating bio-scaffold matrices having 3D structural orientation with controlled in situ delivery of therapeutic agents.4 The crucial factor that is required during the design of wound dressing material is that it should have inherent pro angiogenic properties apart from being bio-compatible and bio-resorbable that aid in earlier wound healing.5,6 The repair and regeneration of both hard and soft tissue happens only when angiogenesis is triggered simultaneously with proliferation and deposition of ECM components by principal cell types namely fibroblast, keratinocyte, osteoblast involved in wound repair and regeneration. The drawbacks associated with most of the commercially available biomaterials are their inability to promote angiogenesis simultaneously with other biological processes happening during tissue


2

Page 3 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


repair and regeneration. Hence there is a pressing demand for development of biomaterials that has angiogenic potential apart from having good bio compatibility, anti-proteolytic and antibacterial properties. One of the areas that have been poorly exploited for biomaterial scaffold development is the use of bio-resorbable/bio-degradable metallic ions as nano-therapeutic agents for therapeutic tissue engineering which take into account the enhancement in bio-functionality of scaffolds for wound healing applications.7 Novel strategies on the use of biodegradable metallic minerals are gaining importance in therapeutic tissue engineering.8,9 The biodegradable metals are absorbed into the host system as they require these metals in trace amounts for various biological processes or excreted out of the system when no longer needed.10 The bio-degradable metal nano-therapeutics include cobalt, manganese, magnesium, copper, iron, calcium, zinc as nutrients; most of them being crucial cofactors of bio-macromolecules such as nucleic acids, enzymes, protein receptors or secondary signaling ligands that alter the biological functions of cells at molecular level.11 In this direction, cobalt has been reported as one of the superior biodegradebal metal with significance therapeutic properties such as stimulation of red blood cell production by vitamin B12, activation of hypoxia inducible factor-1 (HIF-1) to facilitate vascular endothelial growth factor (VEGF) expression12 and restoration of vascularization in ischaemic or infarcted animal tissues13. Although these metals are known to have several therapeutic effects, the role of these metals has not yet been explored for the fabrication of 3D scaffolds. It has been reported that the metals acts as a good stabilizing agent for various biopolymers like collagen.7 Further it can be used as carrier molecules for other bioactives. Hence apart from the therapeutic properties exhibited by biodegradable metals, it also expresses cumulatively the properties of the bio-actives caged on it.14 The ideal scaffolds for tissue


3


Page 4 of 46

engineering applications are required to have mainly three major properties that include the scaffolds

to

have

3-Dimensional

architecture,

bio-resorbability/bio-degradability

and

vascularization capability.15,16 Further the design and development of 3D scaffolds need to fulfill the requirements of anti-microbial property for faster wound closure as the wound sites are largely affected by the pathogens that can delay wound healing.17 In this direction, the present study for the first time proposed the development of 3D scaffolds based on bio-degradable cobalt metal as therapeutics within the co-axial nanofibrous system

18,19

to achieve suitable constraint

over the degree of drug release as these polymers degrade at different time points with varying delivery rate.20,21 The anti-microbial property was incorporated into the scaffolds by PEGylating cobalt nanoparticles with curcumin that imparted anti-microbial property to the scaffolds.22,23 Apart from that, it also highly enhanced the stability of nanostructures within 3D polymeric matrix.24 Further the PEGylation of curcumin on cobalt nanoparticles improved the solubility of the nutraceutical that enhanced the bioavailability upon metabolism25,26 by stabilization on conjugation with cobalt metal to help in control over systemic conditions for cell repair mechanisms.27,28 The 3D bio-mimetic material based on nanofibrous system was fabricated for synchronized delivery of nano-therapeutics to provoke cellular functions in a vogue distinct from the functionality of hydrogels and currently available micro-fibrous scaffolds.29,30 The co-axial electro spinning technique was preferred to augment the bio-functionality of these nanofibres for tissue regenerative purpose by drastically delivering the bio-actives with an optimal delivery profile to regulate tissue morphogenesis by enhancing the degree of cell-substrate interaction.31The 3D core shell nanofibres helped in strategizing the biological behavior of the resulting fibre to work as a three dimensional extracellular locale for endothelial cell patterning that enhanced angiogenesis under in vivo micro-environmental conditions.32,33 The 3D core-shell


4

Page 5 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


scaffold developed helped in assisting cell patterning and organized drug delivery that provoked both intracellular and extracellular stimulus in the cellular environment34,35 to induce the expression of angiogenic genes thereby augmenting cell differentiation, pro-angiogenesis and wound healing.36 EXPERIMENTAL SECTION Materials: Poly (D, L-lactide-co-glycolide), 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), 2,2trifluoroethanol (TFE) and Gelatin were purchased from Sigma Aldrich, USA. All Analytical grade chemicals were directly used throughout the study without further purification. Cell culture chemicals were purchased from Sigma Aldrich, USA. Synthesis of PEGylated Cobalt Nanoparticles: PEGylated Curcumin Cobalt Nanoparticles was synthesized using colloidal route. 1:1 molar ratio of Cobalt Chloride Hexahydrate (CCH) and sodium hydroxide (NaOH) solutions were prepared by dissolving it in distilled water and the mixture was heated at 90ºC for 15 mins. 0.1% Polyethylene glycol mixed with 2.6mM curcumin was added to the mixture to prevent the agglomeration of nanoparticles. It was then kept under continuous stirring for 3h at 930 rpm and maintained at pH 12. The reaction mixture was then centrifuged at 10000 rpm for 10 min to collect as-synthesized cobalt nanoparticle pellet. The pellet was then dried overnight at 40°C and ground finely using a mortar/pestle and stored at room temperature. Electrospinning: GP (Gelatin-PLGA) core-shell nanofibrous scaffolds were fabricated by coaxial electrospinning technique. The polymeric core solution for the fabrication of core-shell nanofibres was prepared by dissolving 1g of gelatin in 10 mL TFE to obtain a concentration of 10% w/v. It was kept under magnetic stirring for 48 h at room temperature to obtain a completely soluble polymeric core solution. The core solution of gelatin (10 mL) was then mixed with


5


Page 6 of 46

100 mg of PEGylated curcumin cobalt nanoparticles under constant stirring for 30 minutes to obtain polymeric core solution containing nano-therapeutics for PCC loaded GP core-shell nanofibres. The shell/sheath solution was prepared by dissolving PLGA (10%w/v) in HFIP under vigorous stirring for 48 h. The polymeric core and sheath solutions were fed in separate plastic syringes fitted with a stainless-steel blunt needle of 0.5 mm in diameter at a flow rate of 0.2 ml/h for core and 0.4 ml/h for shell with a voltage of 18.8 kV. A sheet of aluminum foil covered over the mandrel was kept a distance of 12 cm from the needle tip to collect the jet of continuous (control GP and PCC loaded GP) core-shell nanofibres. Control GP core-shell nanofibrous scaffold is denoted as NFC: NanoFibre Control and PCC loaded GP core-shell nanofibrous scaffold is denoted as NFS: NanoFibre Sample. The spun fibers were dried at room temperature and stored in desiccator for further studies. Characterization of core-shell nanofibres Scanning electron microscopic analysis: The surface morphology of NFC, NFS core-shell nanofibrous scaffolds and PCC nanoparticles were observed using a scanning electron microscope (TESCAN VEGA3 SBU). The samples were sputter coated with a thin layer of gold to reduce surface conduction and were scanned using electron beam of high resolution under vacuum. Transmission electron microscopic analysis: The internal morphology of PCC nanoparticles (FEI Tecnai 20), NFC and NFS core-shell nanofibrous scaffolds (DELONG AMERICA VEM5) were observed using a transmission electron microscope. The samples were fabricated as a thin layer on the carbon coated copper grids and were accelerated at high voltage. Fourier Transform Infra-Red Spectroscopic analysis: Chemical analysis of NFC and NFS core-shell nanofibres were studied using Spectrum Two Perkin-Elmer Spectrophotometer. KBr


6

Page 7 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was used as a binding aid to which the nanofibres were ground and pressed under Atlas Manual 15T Hydraulic Press pellet maker to obtain a pellet. The spectrum was recorded under transmission mode in the range of 750 to 4000 cm-1 with 7 scans per second and a resolution of 1 cm-1. Differential Scanning Calorimetric analysis: The denaturation temperature of NFC, NFS core-shell nanofibres were studied using DSC PERKIN ELMER. About 5mg of the nanofibrous scaffolds were sealed in the aluminum pans and were heated at a temperature of 50ºC-350ºC at a heating rate of 5ºC/min. Mechanical properties: Tensile strength, Elongation at break (%) and Extension at maximum load (mm) of NFC and NFS core-shell nanofibres were measured using an Instron tensile tester instrument. The nanofibrous scaffolds with a dimension of 10 cm x 1 cm x 0.5 cm were cut and the ends were fixed firmly with a gripper. A load of 1 N was applied with a crosshead speed of 5mm/min to record the measurements. Swelling analysis: The swelling property of the nanofibres was studied using water uptake assay. About 2mg of nanofibrous scaffolds were immersed in an eppendorf containing 2ml of distilled water. The scaffolds were periodically taken out from the vial and excess surface water was removed with a sterile tissue paper. The wet weight was measured during 1h, 2h, 3h, 4h, 5h, 6h and 24h using a sensitive balance. The percentage swelling ratio was calculated using Equation 1, Percentage of swelling (%) = [(Ww-Wd)/Wd] * 100 - Equation 1 where, Ww-weight of wet scaffold Wd-weight of dry scaffold


7


Page 8 of 46

In vitro Release study: To evaluate the release kinetics of curcumin from NFS core-shell nanofibrous scaffold; about 5 mg of NFS scaffold was immersed in 5 ml of 1X PBS solution and placed in an orbital shaking incubator at 37°C. 1 ml of PBS was collected from the incubated samples at certain time intervals and the same volume of withdrawn solution was stocked up with 1ml of fresh 1X PBS. The loading efficiency of curcumin was determined by dissolving the NFS core-shell nanofibrous scaffold in the solvent and the cumulative release profile was studied for 4 days. The release profile of curcumin was measured at 425 nm using a UV spectrophotometer (PERKIN-ELMER). Anti-bacterial activity: Anti-bacterial activity of NFC and NFS core-shell nanofibrous mats were examined using agar diffusion method against E.coli (Gram negative), S.aureus (Gram positive) and B.subtilis (Gram positive) strains. The nanofibre samples were mounted on the agar plates containing each strain of bacteria and were incubated at 37ºC for 24 h. After incubation, the zone of inhibition formed around the samples was measured using Bio-Rad Quantity One 4.6.9 XR software to study the anti-microbial effect of the samples. Hemo-compatibility assay: Hemo-compatibility of NFC and NFS core-shell nanofibres were tested on heparinized human blood. The RBC’s from blood were isolated by centrifugation process and the cells were thoroughly washed with assay buffer (5 mM HEPES buffer containing 150 mM sodium chloride) for two to three times. A suspension of about 107 cells in 1 ml assay buffer was taken in the microfuge tubes with nanofibre samples (2mg) and kept for incubation at 37ºC for 30 minutes. The tubes were centrifuged at 2000 rpm for 3 minutes and the absorbance values of supernatant were measured at 540 nm. The percentage of hemolysis was calculated using Equation 2;


8

Page 9 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Hemolysis (%) = [(Absorbance of nanofibres-Absorbance of negative control)/(Absorbance of positive control -Absorbance of negative control)] x 100

-

Equation 2

In vitro scratch wound healing assay: NFS core-shell nanofibres (1mg/ml) were incubated in DMEM medium at 37°C and the release media was collected at 24 h. The NFC core-shell nanofibres were used as a control. Approximately 1,50,000 keratinocyte (HaCaT) cells were seeded in a 24-well tissue culture pate and incubated at 37°C in a CO2 incubator for confluence. After firm attachment of cells, scratch wounds were created on the monolayer of the confluent cells using a pipette tip and they were thorough washed with 1X PBS to remove cell debris. The collected release media containing nano-therapeutics was slowly added to the wounded monolayer of cells and maintained under tissue culture conditions. The migration of keratinocyte cells was captured using a phase contrast microscope (Leica Microsystems) at a time interval of 2 h and the wound area was measured using Image J software. The percentage of scratch wound recovered was calculated using Equation 3; Scratch Wound Area Recovered (%) = [(Initial Scratch Wound Area - Final Scratch Wound Area)/ (Initial Wound Area)]*100

-

Equation 3

Biomedical Applications Cell culture and Maintenance: Endothelial (EA hy926) cell line was purchased from American Type Culture Collection (ATCC). The cells were cultured using Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 24 mM sodium bicarbonate and 25 mM HEPES, streptomycin (100 µg/mL), penicillin (100 units/mL), gentamicin (30 µg/mL), amphotericin B (2.5 µg/mL), 10% FBS (Invitrogen, USA). The cells were cultured in the tissue culture flasks buffered at pH 7.4 and maintained at 37°C in an incubator supplied with 5% CO2 and 95% air. The cells were harvested by trypsinization once they are 70-80% confluent and were used for


9


Page 10 of 46

further experiments. The gene expression of Vascular Endothelial Growth Factor (VEGF), Vascular Endothelial Growth Factor Receptor 2 (VEGFR2) was evaluated by subjecting the endothelial cells under treatment with NFC and NFS nanofibres. Angiogenic profiling Endothelial Cell (EC) Tube Formation assay: To evaluate the angiogenic efficacy of core shell nanofibres, in vitro endothelial tube formation assay was performed. An approximate count of 15,000 Endothelial (EA hy926) cells were seeded onto the scaffolds and incubated for 24 h and 48 h at 37ºC in a CO2 incubator. The plates were then periodically monitored for the development of tubular network like structures. The EC tubes formed were then captured using a phase contrast microscope (Leica Microsystems, Germany) and the patterning effect was recorded along with cell viability. The viability of ECs on NFC and NFS core-shell nanofibres were investigated using MTT assay. After incubation, the cultured ECs were added with 0.5 mg/mL 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (0.5 mg/ml MTT salt in 1X PBS) followed by incubation for 4 h. The supernatant was removed and the insoluble formazan crystals formed were solubilized in dimethyl sulphoxide (DMSO). The absorbance was measured at 570 nm using a Bio-Rad ELISA plate reader. The percentage of cell viability at 24 h and 48 h were calculated using Equation 4, Percentage of endothelial cell viability (%) = [Optical density of NFS / Optical density of NFC] * 100

-

Equation 4

Where, NFS- PCC loaded GP core shell nanofibres and NFC- Control GP core shell nanofibres Evaluation of VEGF, VEGFR2 Gene Expression RNA Isolation and PCR Analysis: In order to investigate the gene expression profile of Vascular Endothelial Growth Factor (VEGF) and Vascular Endothelial Growth Factor Receptor


10

Page 11 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2 (VEGFR2) in endothelial cells, the confluent cells in the tissue culture flasks were treated with NFC and NFS core-shell nanofibres to isolate the total RNA after 24 hours of incubation. The cells were subjected to homogenization using trizol reagent. The phase separation was done using chloroform and the colorless upper aqueous phase was separated using centrifugation process held at 12,000 x g for 15 minutes at 4°C to obtain the total RNA content. The yield and purity of isolated RNA was enumerated by Nanodrop (Thermo Fisher Scientific, USA). The samples were normalized and used as template for reverse transcription using High Capacity cDNA synthesis kit followed by amplification. The primer sequences were designed and custom synthesized by Sigma Aldrich, USA and the primer pair of VEGF and VEGFR2 involving forward and reverse primers for amplification are given below in Table 1. The PCR reaction was carried out in an Eppendorf thermocycler using Master Cycler Gradient PCR and the amplicons were size fractionated by 2% agarose gel electrophoresis using 100 bp ladder.

S.No

1

Gene

VEGF

2.

VEGFR2

3.

GAPDH

Primer Sequence

Forward

5’ACATCACATGAGAGGTCTGC 3’

Reverse

5’AAATCAAATGCGGCTACTTC 3’

Forward

5’TTCTTGGCTGTGCAAAAGTG 3’

Reverse

5’TCTTCAGTTCCCCTCCATTG 3’

Forward

5’CTCTCTGCTCCTCCCTGTTC 3’

Reverse

5’ TCCCGTTGATGACCAGCTTC 3’

Optimum Annealing Amplicon Temperature Size Ta (°C) 85 bp 50 173 bp

62

278 bp

Table. 1 PCR Primer Sequences of VEGF and VEGFR2 Rat aortic ring assay: Aortic ring assay was carried out to investigate the sprouting of endothelial cells around the rat aortic rings treated with the nanofibrous scaffolds. The aorta from


11


Page 12 of 46

a female wistar rat (145 g) was removed and cut into small rings of 0.1 cm. These rings of the thoracic aorta were placed in the tissue culture plates containing collagen matrix supplemented with DMEM medium. The plates with aortic rings were then treated with nanofibrous scaffolds and incubated at 37ºC. The endothelial sprouting in the aortic rings was photographed at different time intervals and the area of sprouting was calculated using Bio-Rad Quantity One 4.6.9 XR software. Chorioallantoic membrane (CAM) assay: In order to study the effect of NFC and NFS coreshell nanofibres, angiogenic profiling and embryonic growth of the fertilized eggs were tested using CAM assay. Giri Raja breed eggs (5 Day old) were procured from TANUVAS, Potheri. Tamilnadu, India. The egg shells were wiped with 50% alcohol and a window opening was created on the blunt end of the egg at its central region. The nanofibrous scaffolds were carefully placed on chorioallantoic membrane of chick embryo and the eggs were incubated at 37ºC under humid condition. After incubation, the capillary formation with micro vessel growth was photographed during different time periods. In Vivo wound Healing study: The procedures for the use of animals in clinical research were approved by IAEC- Institutional Animal Ethical Committee (IAEC No. Rev. 02/2017 (b)). The bio-compatibility of the scaffolds was tested in vivo by open excision wound healing assay. The female wistar rats of approximately 130–150 g were carefully raised in habitual environment for one week. The rats were grouped into three sets: Saline Control, GP, PCC-GP. The rats were then anaesthetized with ketamine/xylazine and the dorsal side of skin was shaved off and disinfected with 70% ethanol. The open wound excisions of 2 cm x 2 cm were made using sterile surgical blades and the wound area was labeled in a blotting paper. The wound regions were photographed and covered with a dressing made of sterile gauze. The wound region was


12

Page 13 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cleansed with saline and the gauze dressing was replaced on every third day. The reduction in wound size was sketched out and photographed at various time intervals. The percentage of wound size reduction was calculated using Equation 5; Cn= [(so-sn) /so]*100

-

Equation 5

Where, Cn represents the percentage of wound size reduction on Day 3, 6, 12, 15 and 18, So represents initial size of wound and Sn represents final size of wound on Day 3, 6, 12, 15 and 18 respectively. Statistical analysis: The experiments and assays carried out throughout the study were done in triplicates. The data obtained were expressed as average and standard deviation of three experiments. SPSS 22 software was used to perform statistical analysis. The P value

Nanoscaled Biodegradable MetalâPolymeric Three-Dimensional

Recommend Documents

Nanoscaled Biodegradable MetalâPolymeric Three-Dimensional