Negative Cooperativity and High Affinity in ... - ACS Publications

Subscriber access provided by ORTA DOGU TEKNIK UNIVERSITESI KUTUPHANESI

Article

Negative Cooperativity and High Affinity in Chitooligosaccharide Binding by a Mycobacterium smegmatis Protein Containing LysM and Lectin Domains Dhabaleswar Patra, Padmanabh Mishra, Mamannamana Vijayan, and Avadhesha Surolia Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.5b00841 • Publication Date (Web): 08 Dec 2015 Downloaded from http://pubs.acs.org on December 17, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Negative Cooperativity and High Affinity in Chitooligosaccharide Binding by a Mycobacterium smegmatis Protein Containing LysM and Lectin Domains Dhabaleswar Patra, Padmanabh Mishra, Mamannamana Vijayan and Avadhesha Surolia1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012, India 1

To whom correspondence should be addressed: Tel: +91-80-22932714, 23602763; Fax: +91-8023600535; e-mail: [email protected]

Funding DP is a Senior Research Fellow in the Albert Einstein Centenary grant Research Professorship of MV. MV is Albert Einstein Professor of the Indian National Science Academy. PM is a Department of Biotechnology Research Associate. AS is a Bhatanagar Fellow of the Council of Scientific and Industrial Research (CSIR), India. The work is supported by a research grant from the Science and Engineering Research Board, Government of India. Notes The authors declare no competing financial interest. ACKNOWLEDGEMENTS The authors would like to thank the Consortium for Functional Glycomics, for the glycan array analysis. SUPPORTING INFORMATION The Supporting information is available on the ACS Publication website at http://pubs.acs.org. MSL-LysM has anomalous mobility in SDS gel. Hence, its mass was confirmed by MALDI-TOF. Its dimeric nature was confirmed by gel filtration and DLS experiments. There is a decrease in stoichiometry as we move from chitobiose to chitotetraose in ITC single site binding model. The sequence identity among LysM domain is very poor. ABBREVIATIONS MSL, Mycobacterium smegmatis lectin; MurNAc, N-acetylmuramic acid; GlcNAc, N-acetyl-Dglucosamine; DLS, Dynamic light scattering; ITC, isothermal titration calorimetry; RFU, relative fluorescence units.

1 ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT LysM domains have been recognized in bacteria and eukaryotes as carbohydrate-binding protein modules, but the mechanism of their binding to chitooligosaccharides is underexplored. Binding of a Mycobacterium smegmatis protein containing a lectin (MSL) and one LysM domain to chitooligosaccharides has been studied using isothermal titration calorimetry and fluorescence titration which demonstrate the presence of two binding sites of non-identical affinities per dimeric MSL-LysM molecule. Affinity of the molecule for chitooligosaccharides correlates with the length of the carbohydrate chain. Its binding to chitooligosaccharides is characterized by negative cooperativity in the interactions of the two domains. Apparently, the flexibility of the long linker that connects the LysM and MSL domains plays a facilitating role in this recognition. The LysM domain in MSL-LysM, like other bacterial domains but unlike plant LysM domains, recognizes equally well peptidoglycan fragments as well as chitin polymers. Interestingly, in the present case two LysM domains are enough for binding to peptidoglycan in contrast to the three reportedly required by the LysM domains of Bacillus subtilis and Lactococcus lactis. Also, the affinity of MSL-LysM for chitooligosaccharides is higher than that of LysM-chitooligosaccharide interactions reported so far.


Page 2 of 26

Page 3 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

The Lysin motif (LysM) was originally discovered in bacterial cell wall degrading enzymes of Bacillus phage Φ29 (1). These enzymes hydrolyze the glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyl-D-glucosamine (GlcNAc) in peptidoglycans. LysM domains are widely distributed in many bacterial and fungal enzymes involved in cell wall degradation. These enzymes include hydrolases, involved in remodeling of cell wall peptidoglycans (PGN) during bacterial cell division, as well as various chitinases that break down polymeric GlcNAc, the main component of fungal cell wall (2, 3). Besides these functions, a morphogenetic role associated with endospore coat formation and development has also been described for LysM domains (4). They have also been reported in higher eukaryotes including plants and humans (5, 6). Thus, LysM domains have been identified in plant cell surface receptors involved in symbiotic interaction between bacteria and leguminous plants (7). In Arabidopsis, a LysM containing receptor like kinase was shown to be involved in defense signaling in response to fungal pathogens (8, 9). Generally, the LysM domain is found in conjunction with other enzyme domains such as chitinases and hydrolases. Only rarely the LysM domain and a carbohydrate-binding module occur together. The structure of only one such protein from a fungus that contains a LysM domain and two cyanovirin lectin modules has been reported (10). Recently, a number of proteins, each containing a LysM domain and a lectin domain, have been identified in mycobacteria (11). They occur in M. smegmatis, M. marinum, M. abscessus, M. sp. JDM601 and M. ulceranus. Except for M. ulceranus, these microorganisms are either non-pathogenic or only mildly pathogenic. The structure analysis of a M. smegmatis lectin (MSL) has shown that it forms dimers similar to mannose-binding β-prism II fold plant lectins with extensive domain swapping (12). The three dimensional structure of the LysM domain consists of a βααβ fold wherein two helices are sandwiched by two anti-parallel sheets (10, 13-17). Studies on LysM domains from bacteria have been much less extensive than those from fungal and plant sources (10, 17). The present study reports functional and biophysical characterization of a M. smegmatis, a lectin with two LysM domains (MSL-LysM). Glycan array studies highlight the unique ability of this two domain LysM protein to recognise peptidoglycans unlike its other bacterial counterparts. Also the thermodynamics of MSL-LysM - chitooligosaccharide interactions investigated by isothermal titration calorimetry and fluorescence spectroscopy address, for the first time, the cooperative behaviour involved in these interactions. MATERIAL AND METHODS Materials - Chitooligosaccharides were obtained from Carbosynth, USA. Insoluble chitin from shrimp shells, pronase, trypsin and DNase were obtained from Sigma Aldrich, USA. Most of the other analytical grade chemicals used for the study were obtained from local chemical companies. Cloning, expression and purification - The MSMEG_3662 gene was amplified by PCR using the following primers: forward 5’AGCAGCTAGCATGGGCGACACTTTGAC3’ and reverse 5’GACTCGAGGGGGATCGTCAGGACC3’ (restriction sites Nhe I and Xho I for forward and reverse primers are underlined). The PCR involved 30 cycles with following conditions: initial denaturation at 368 K for 45 s, annealing at 325 K for 60 s and extension at 345 K for 80 s. The amplified gene was cloned into pET21b vector. The cloned insert was confirmed by DNA sequencing. Escherichia coli BL21 cells containing pET-MSL-LysM were grown in LB media containing 100 µg/ml ampicillin overnight at 37 ˚C. One percent of the cells grown overnight were transferred to fresh media and kept in an incubator shaker at 37 ˚C till an O.D. of 0.6 at 595 nm is reached. The cells were induced with 1 mM IPTG by incubating with it for 14 hours at 20 ˚C. The cells were harvested by centrifugation and sonicated in a buffer containing 30 mM Tris-HCl, 300 mM NaCl and 10 % glycerol (pH 8.0 at 4 ˚C). The sonicated samples were spun at 14, 000 rpm for 40 min and soluble proteins were loaded onto a pre- equilibrated Ni-NTA (sonication buffer) column. The unbound impurities were washed 3 ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

thoroughly with the same buffer and the desired 6xHis tagged protein was eluted with 300 mM imidazole in the same buffer. The purified samples were further passed through a gel-filtration chromatography column using Superdex 75 (GE Healthcare) in 20 mM phosphate buffer saline (PBS pH 7.4). Purity of the protein was confirmed on a SDS-polyacrylamide gel. The molecular weight was further confirmed by mass spectrometry (MALDI-TOF). Gel-filtration and dynamic light scattering - Gel-filtration was carried out in PBS at 4 °C at a flow rate of 0.5 ml/min using Superose 12 column (GE Healthcare). The column was calibrated using commercially available gel-filtration standards containing thyroglobulin (670 kDa), bovine γ-globulin (158 kDa), chicken ovalbumin (44 kDa), equine myoglobin (17 kDa) and vitamin B12 (1.35 kDa). Dynamic light scattering (DLS) experiments were performed on a DynaPro Molecular Sizing Instrument (Protein Solutions). Samples containing MSL-LysM were analyzed directly after gel-filtration at a concentration of ~ 2 mg/ml. Protein solutions were centrifuged three times at 15,000 rpm for 15 min and immediately loaded into a 12 µl quartz thermostated sample cuvette before measurement. Several measurements were taken at 277 K and analyzed using DYNAMICS Version 6.0 software (Protein Solutions). Data collection times of 10 s were used in all cases, for a minimum of 20 acquisitions. Similarly, DLS data were collected from chitooligosaccharide complexes of the protein. In these experiments, the concentration of the protein was kept constant at 20 µM and chitooligosaccharides [(GlcNAc)2-7] concentrations were varied from 10.0 to 200 µM. Chitin binding assay - Chitin binding assays were performed by incubating the protein (1 mg/ml) with 50 mg of insoluble chitin from shrimp shells for 90 min at room temperature on a roller wheel in 1.5 ml sample in PBS. The insoluble fraction was pelleted by centrifugation (3 min, 13,000 rpm) and supernatant was removed. The insoluble fraction was washed three times with PBS. The pellet and supernatant were analyzed in SDS-PAGE (18). Cell wall (peptidoglycan) binding assay - E. coli K-12 strain was grown in LB media to an OD600 of 0.6, at which point cells were pelleted and washed with chilled distilled water. Soluble cytoplasmic material was removed by shaking the cells vigorously with glass beads. Cells were then treated with DNase (1 mg/14 mg of cells) with vigorous shaking for 15 min at 4°C. Subsequently, cells were suspended in PBS and centrifuged at 9,000 x g for 1hr. The pellet was then resuspended in distilled water, washed extensively and boiled in 4% sodium lauryl sulphate (3.0 ml/g wet weight of cells) for 1 hr. The stirring was continued for 2 hr at room temperature followed by overnight incubation. The suspension was centrifuged at 110,000 x g for 30 min at 20°C. The pellet was then washed extensively with distilled water, resuspended in 10 mM Tris-hydrochloric acid buffer (pH 7.4), and treated with 5 mg of pronase (5 mg [7 U/mg]) at 37°C for 20 minutes. The suspension was centrifuged at 110,000 x g for 90 min at 20°C followed by washing 3 times with 10 mM Tris-hydrochloric acid buffer (pH 8.2). The pellet, suspended in 10 mM Tris-hydrochloric acid buffer (pH 8.2) was then treated with trypsin (5 mg [9000 U/mg]) at 37°C for 20 minutes. Peptidoglycan fraction thus prepared was then collected by centrifugation at 110,000 x g for 90 min at 20°C and washed 3 times with distilled water(19) The washed peptidoglycan pellet was lyophilized. The lyophilized preparation was then reconstituted in 1 ml of PBS and used for binding studies 100 µl of peptidoglycan preparation was mixed with 2.5 µg of the protein in a total volume of 150 µl and incubated in ice for 30 min. The samples were subjected to centrifugation at 4˚C (6,000 rpm) for 4 min and the supernatant was removed. The peptidoglycan pellets were washed thrice with 150 µl of the same buffer. The pellet and supernatant were analysed by SDS-PAGE followed by western blotting using anti-6X His tagR (HRP) antibodies. Glycan array analysis - Glycan array Version 5.0 (www.functionalglycomics.org) was performed for MSL-LysM to investigate its glycan binding properties. The printed array consists of 611 glycans in replicates of 6. Samples were diluted in PBS to 200 µg/ml and detected with Alexa488-labeled anti-His antibody. The highest and the lowest point from each set of six replicates were removed. The remaining 4 ACS Paragon Plus Environment

Page 4 of 26

Page 5 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

four values were averaged for calculating the relative fluorescence units (RFU). The scanner response was linear to a maximum RFU value of about 50,000. Isothermal titration calorimetry (ITC) - The titrations were carried out in a VP-ITC Micro-Calorimeter (MicroCal Inc., Northampton, Massachusetts, USA). For each titration, the purified protein was dialyzed against PBS for 12 hour with 2 changes. Ligand solutions were prepared in respective dialyzed PBS. Protein and ligand concentrations for chitobiose titration were 5.07 mM and 50 mM, respectively. For higher chitooligosaccharides, protein and ligand (chitotriose, chitotetraose, chitopentaose, chitohexaose and chitoheptaose) concentrations were 250 µM and 2 mM, respectively. Details of the titration experiment are given in Table 2. All ITC experiments were performed in the C value range of 12.78 to 223.60 (n x Ka x M, where n represents the number of binding sites, Ka association constant and M protein concentration, respectively) except in the case of chitobiose where the highest C value that could be achieved was about 0.51 (20). Titrations were carried out by stepwise ligand addition from a stirred syringe into the sample cell (1.4 ml volume) at 307 rpm. For chitobiose titration, injection volumes were 10 µl. For chitotriose, chitotetraose, chitopentaose, chitohexaose and chitoheptaose titrations, the volumes were 6 µl each. The first injection of every titration was performed with 3 µl of the ligand solution to minimize the contribution of any artifact associated with the loading of syringe with the ligand. The time interval between successive injections was 180s. The thermodynamic parameters, viz., change in enthalpy (∆H), Ka and n were determined using non-linear least squares curves fitting of the data using OriginTM 7.0 software. The data were fitted in both single site model as well as double site sequential model. Dilution corrections were applied in all the experiments by titrating the sugar solutions against the buffer. The change in entropy (∆S), was determined using the equation ∆G = ∆H – T∆S, where ∆G = -RTlnKa; R and T are universal gas constant and absolute temperature (in K), respectively. Scatchard and Hill plots ITC data - The total concentration of the ligand Xt(i) as well as the protein Mt(i) after the ith injection and the heat evolved on the ith injection Q(i) are readily available from the ITC raw data file after each experiment. The concentration correction is automatically made by the OriginTM software. The concentration of the bound ligand Xb(i) after the ith injection is obtained using the equation Xb(i) = [Q(i)/∆HVo)] + Xb(i – 1), where Q(i) (µcal) is the heat evolved on the ith injection, ∆H (cal mol-1) is the enthalpy change, Vo (ml) is the active cell volume and Xb (mM) is the concentration of the bound ligand. Xb is equal to Mb, the concentration of the bound protein. For multivalent ligands, the more general expression is Mb = (Xb) (functional valency). The concentration of free ligand (Xf) after the ith injection was determined using the equation Xf(i) = Xt(i) – Xb(i). Scatchard plots were prepared by plotting r(i) against r(i)/Xf(i), where r(i) is [Xb(i)(functional valency)/Mt(i)], and Hill plots were obtained by plotting log{Y(i)/[1-Y(i)]} versus log[Xf(i)], where Y(i) is {[Xb(i)](functional valency of ligand)]/Mt(i)}, which are modified versions of the Scatchard and Hill plots that take into account the functional valency of ligand (21). A program was developed using Microsoft Excel for construction of Scatchard and Hill plots. The method described in Dam et al. 2002, was used for preparing the modified plots. The number of binding sites (n) was calculated by extrapolating the line till the X-axis in Scatchard plot. The Hill coefficients were calculated from the slopes of the Hill plots. The association constants Ka1 and Ka2 were calculated by extrapolating two straight lines from each curve at lowest and highest concentrations respectively till the X-axis.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

LysM domain fragment (LysMf) preparation - The LysMf was obtained by limited proteolysis of the purified full length MSL-LysM. The full length protein was incubated with trypsin (1:100) for 45 min at 25 °C and passed through Ni-NTA column. The column was extensively washed with washing buffer and the fragment of LysM domain, LysMf, was eluted with imidazole buffer. To purify it further, it was subjected to gel filtration on a Superdex 75 column (GE Healthcare) equilibrated and eluted with phosphate buffer (pH 7.4). Tryptophan fluorescence quenching - Fluorescence measurements were performed with a JASCO FP6300 spectroflourometer at 298K. The excitation wavelength was 295 nm with an excitation slit of 5 nm. Emission intensities were collected over a wavelength range of 300-400 nm with an emission slit of 5 nm. The final spectra were the averages of three scans and were corrected for the effect of dilution, buffer and the addition of chitooligosaccharide. Quantitative binding experiments were performed in 200 µl of protein solution (10 µM protein concentration) to which aliquots of a ligand solution (1-10 µl) were added and mixed thoroughly. Chitooligosaccharides were dissolved in the same buffer at a concentration of 0.5 mM for chitotriose, chitotetraose, chitopentaose, chitohexaose and chitoheptaose. In the case of chitobiose, the ligand concentration was 1 mM. The maximum change in volume caused by ligand addition was kept to within ≤ 5%. The fluorescence quenching at full saturation of binding (Fα) was estimated by plotting 1/(Fo-F) versus 1/[S], extrapolating to the Y-axis, where Fo is the fluorescence intensity of the protein without ligand, and F is the fluorescence intensity of the protein at the chitooligosaccharide concentration [S]. Association constants (Ka) were estimated using log [(Fo-F)/(FFα)] verses log[S] plots, where Fo, F and Fα correspond to those of protein concentration in absence of the ligand, in the presence of the ligand and at infinite ligand concentration, respectively; [S] refers to the concentration of unbound ligand. Fluorescence experiments were also, performed with the fragment containing LysM domain alone (LysMf), which was obtained by limited proteolysis of the full length protein MSL-LysM. Sequence analysis and molecular modeling - Pair-wise sequence analysis and multiple sequence analysis were carried out using EMBOSS Needle and Clustal Omega, respectively (22, 23). A homology model of the LysM domain was built using I-TASSER (24). This model was superposed onto the chitotetraose bound LysM domain of the Ecp6-chitotetraose complex (PDB id 4b8v) to generate a model of the chitotetraose complex of the LysM domain of MSL-LysM. A model of the corresponding chitohexaose complex was built by superposing the known structure of the hexasaccharide (PDB id 2pi8) onto the tetrasaccharide using ALIGN (25). Similarly, the second LysM domain was placed onto other reducing end of chitohexaose and the structure was minimized using CNS 1.3 (26). Interatomic contacts were calculated using program CONTACT of CCP4 (27). Figures were prepared using PYMOL (28). Similarly, dimeric MSL-LysM structure was modeled using LysM model and MSL crystal structure (12). RESULTS AND DISCUSSION Sequence and structure of the LysM domain - As mentioned earlier, LysM domain connected by a long linker region to a lectin domain exists in five mycobacterial species which are mostly non-pathogenic or only mildly pathogenic. The domains from these species show a sequence identity of 79 to 100%. An attempt to explore the presence of this domain in highly pathogenic M. tuberculosis yielded the sequence of three separate LysM domains, each of which forms part of proteins containing an esterase domain. The sequence identity among them range from 67 to 85%. Their sequence identity with the domain in MSLLysM is high at 54 to 59%. A multiple alignment of these four mycobacterial sequences with LysM domains of known three dimensional structures are shown in Figure 1. The nine independent LysM domains of known three-dimensional structure encompass fungal, plant and bacterial sources. The sequence identity among them is often very low (Table S1). However, all these have the same βααβ tertiary fold, with the secondary structural elements separated by loops. Two of these loops constitute the carbohydrate binding region in them. 6 ACS Paragon Plus Environment

Page 6 of 26

Page 7 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Isolation and preliminary characterization of MSL-LysM - MSL-LysM shows anomalous mobility in SDS-gel (Supplementary Figure S1A). Hence the mass of the protein was further confirmed by mass spectrometry (Supplementary Figure S1B). Gel-filtration experiments also demonstrated that the protein exists as a dimer in solution (Supplementary Figure S2A). The results of DLS experiment indicate it to be a dimer (Supplementary Figure S2B). There was no detectable change in the size of the protein upon binding to chitooligosaccharides [(GlcNAc)2-7]. Preliminary studies indicated MSL-LysM was able to bind chitin when the method described in van den Burg et al. 2006 was employed (Figure 2A) (18). Glycan array studies - Glycan array experiments on MSL-LysM were performed at the consortium for functional glycomics. The report indicated binding of chitooligosaccharides and their derivatives (Table 1). Also, all of the top 10 glycans in the binding profiles possessed a GlcNAc unit in the chain. The binding affinity of MSL-LysM towards the glycan increases with the number of units of GlcNAc in the oligosaccharide (Table 2). It is interesting to compare the glycan array results on MSL-LysM which has two LysM domains from a single dimeric molecule, with those on Ecp6, in which only one domain is involved in chitooligosaccharide binding processes (17, 29). The RFU value of chitotriose binding are 4642 and 6093 for MSL-LysM and Ecp6, respectively; the corresponding values for chitopentaose binding are 9470 and 7656, and those for chitohexaose binding are 11109 and 6290, for MSL-LysM and Ecp6, respectively (Table 1). Thus the RFU values for Ecp6 changed moderately with chitooligosaccharide length unlike in the case of MSL-LysM, perhaps due to the involvement of a single domain in binding on the former. From the glycan binding profile it appears that a minimum of two GlcNAc units or MurNAc-GlcNAc unit are required for binding of MSL-LysM with the glycan. Its binding to MurNAc (1-4) GlcNAc-Sp10 shows that it can also recognize bacterial cell wall, a component of peptidoglycans (PGN) (30). Thus LysM has specificity for both chitooligosaccharides and the bacterial cell wall, like other bacterial LysM domain (Figure 2B). Thus, it is different from plant and fungal LysM domains that recognize chitooligosaccharides only (31). Interestingly, in the case of the B. subtilis LysM protein, a minimum of three LysM domains are required for PGN binding whereas in the case of MSL-LysM which is a dimeric protein two LysM domains are sufficient for this recognition. LysMf does not show any detectable binding to peptidoglycans. Isothermal titration calorimetry studies - MSL-LysM - chitooligosaccharide interactions with various chitooligosaccharides [(GlcNAc)n, n = 2, 3, 4, 5, 6, 7] were studied by ITC. Upper panels of Figure 3 show the exothermic heat released upon binding at each injection, which decreases monotonically with successive injections until saturation is achieved. A plot of the incremental heat released as a function of MSL-LysM binding to chitooligosaccharides was initially obtained using one site model. The experimental details and thermodynamic parameters are given in Table 2. The binding efficiencies increased with increase in chain lengths of the oligosaccharides in agreement with Glycan array experiments. The protein sugar interactions were enthalpically driven and the loss of entropy opposes the binding process. Only a few studies have explored the thermodynamics of LysM protein-ligand interactions. The affinity of LysM and chitinase A from Pteris ryukyuensis for chitotetraose and chitopentaose are 0.145x104 M-1 and 0.531x 104 M-1, respectively, while that of LysM of Ecp6 for chitotetraose and chitohexaose are 8.69 x 104 M-1 and 22.22 x 104 M-1, respectively (2,17, 29). The binding affinity of MSL-LysM for chitobiose is in the millimolar range while that for higher chitooligosaccharides, including chitotetraose, is in the micromolar range. Thus the Ka values for M. smegmatis protein for chitotetraose is one and two orders of magnitudes higher than that of the LysM domains of Ecp6 and chitinase A, respectively. Similarly, the binding affinity of MSL-LysM is ten times more than that of Ecp6 for chitohexaose. The only binding study available on a bacterial LysM protein is that on the oligosaccharide binding of a B. subtilis, LysM protein using microscale thermophoresis (MST) (31, 32). The binding affinities of this protein for chitotetraose, chitopentaose and chitohexaose are 90, 370 and 40 fold lower than that observed for MSL-LysM. 7 ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

From the results presented in Table 2, it is interesting to note that the binding stoichiometry obtained for different oligosaccharides decreases with increasing ligand size when the binding is analyzed using one site model (Figure 3). When the observed stoichiometry was plotted as a function of the number of GlcNAc units in the oligosaccharides, a linear dependence was observed till chitopentaose, whereas the stoichiometry of chitoheptaose and chitohexaose remain almost same (Figure S3). This indicates that the possibility of the recruitment of the second binding site of the dimeric MSL-LysM molecule by the oligomers longer than chitotriose. Hence the results of all the titrations were fitted using a two site sequential model (Figure 4). The thermodynamic parameters obtained from these calculations are given in Table 3. The association constants of MSL-LysM interactions exhibit interesting trends (Table 3). The Ka1 values ranges from 216 M-1 to 121 x 106 M-1 The Ka2 value for them ranges from 72 M-1 to 2.47 x 104 M1 . The Ka1 value for chitotriose and higher oligosaccharides is at least an order of magnitude higher than Ka2. It is thus apparent that MSL-LysM exhibits negative cooperativity in the recognition of chitooligosaccharides, the extent of which increases with the size of the oligosaccharide. An increase in Ka1 value with an increase in the size of the oligosaccharide is consistent with an extended binding site in the protein. This is also consistent with a decrease in binding enthalpy as the size of the oligosaccharide is increased when going from the di to a tetrasaccharide. The first site appears to have more extensive interactions with the chitooligosaccharides as evident from a decrease in binding enthalpy for this site as compared to that for the low affinity binding site. In order to investigate this aspect further, contributions of successive monosaccharide units of the oligosaccharide to the binding enthalpy (∆∆H), entropy (∆∆S) and free energy (∆∆G) were calculated from the thermodynamic data presented in Table 3 by subtracting the values corresponding to the oligosaccharide containing ‘(n-1)’ monosaccharide units from the values corresponding to the oligosaccharide containing ‘n’ GlcNAc residues (33). Values of ∆∆H and ∆∆G are nonlinear (Table S2), suggesting differential contributions of the solvent and protein to the thermodynamics of binding. This result is consistent with dominance of the first site over the second site in the recognition of the oligosaccharides. An unusual sharing of the same chitooligosaccharide between the two domains is perhaps facilitated by the conformation about the glycosidic bond adopted by the GlcNAc oligomer (34, 35), although the flexibility of the hinge region of the polypeptide chain between the domains can also be a determinant for the observed cooperativity which is discussed latter. The structure of the Ecp6chitotetraose complex also indicates an asymmetric binding by its two LysM domains simultaneously. Scatchard and Hill plot analyses of ITC data - To investigate the cooperative behavior further, Scatchard plot and Hill plot analyses of the raw ITC data were carried out as described by Dam et al. 2002 (21). While both Scatchard and Hill plots are used to study cooperative interactions, the latter has the advantage of assigning numerical values to the degree of cooperativity of the system, as well as revealing cooperativity associated with the binding of multivalent ligand to multi-subunit proteins such as dimeric MSL-LysM. In Hill plot analysis of the binding of a multivalent ligands such as chitooligosaccharides, in our treatment of ITC data, the term for the fraction of bound ligand, Xb/Mt, is corrected for the valency of the sugar to yield (Xb) (functional valency of sugar)/Mt which is a modified version of the classical Hill plot as well as the Scatchard plot (21). Typical Scatchard and Hill plots of raw ITC data for the binding of chitotetraose [(GlcNAc)4] with MSL-LysM are shown in Figures 5A and 5B, respectively. The Scatchard plot could only be fitted using a two component exponential decay, which indicated the existence of two different binding sites. For chitobiose - MSL-LysM interactions, the Hill plot is essentially a straight line with a slope of 0.95, which is close to a value of 1.0, indicating feeble if any cooperativity for this interaction. However, for other chitooligosaccharides [(GlcNAc)3-7], the slope ranges from 0.90 to 0.51 with the increase in the size of the ligand, indicating increased negative cooperativity with increase in the size of the ligand (Table 4). 8 ACS Paragon Plus Environment

Page 8 of 26

Page 9 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Fluorescence studies - Surface-exposed tryptophans are often involved in protein-ligand interactions through CH- π interactions (36-41). There are four tryptophans in MSL-LysM. They are Trp44, Trp74, Trp104 and Trp171. The first three tryptophans are buried and are present in the lectin domain (12, PDB id 4okc). Trp171 is, however, located in the LysM domain and was expected to be perturbed on complexation with chitooligosaccharides. Indeed, the addition of chitooligosaccharides [(GlcNAc)2-7] to MSL-LysM showed significant Trp fluorescence quenching which was accompanied by a small red shift (Figure 6A, B). The red-shift indicates that the Trp171 residue experiences an increase in its polarity upon complexation with chitooligosaccharides. In other words, its energy is reabsorbed by surrounding chitooligosaccharides, resulting in less energetic emission as evident from a decrease of its intensity and its red-shifted emission (42). The extent of quenching is 40.8% for chitobiose, 60.2% for chitotriose, 80.5% for chitotetraose, 75.3% for chitopentaose, 71.8% for chitohexaose and 68.5% for chitoheptaose (Figure 7A). The ligand size dependent quenching suggests that the exposure of the indicator group (Trp171) at the surface of the MSL-LysM - ligand complex depends on the length of the oligosaccharide it is bound to (37, 43-46). The values of KaF, viz. the values of association constant determined by fluorescence titration for the binding of the chitooligosaccharides with MSL-LysM increase with ligand size and are in agreement with ITC values (Table 5, Figure 7B). The increase in affinities with increase in ligand size can be explained on the basis of an extended binding site consisting of subsites, each of which accommodates a single GlcNAc unit. Both –∆H and –∆S values show decrease with ligand size till chitotetraose, which indicates that the binding site at domain 1 can optimally accommodate up to four GlcNAc units of a chitooligosaccharide, with a concomitant recruitment of the second LysM domain by larger sugar units. Purification of the single domain fragment, LysMf, was facilitated by the presence of the hexa histidine tag at the C-terminus of the full length MSL-LysM protein. SDS-PAGE of LysMf thus purified yields Mr. ≈ 6000.0 Da. Mass spectrometry data demonstrate LysMf to have a molecular mass of 6214.7 Da (Figure 8). These data taken together with the sequence of the full length MSL-LysM indicate that the fragment emanates from the cleavage of the full length protein at Arg161 which has a calculated mass of 6215.8 Da. The KaF values for the chitooligosaccharides-single domain fragment (LysMf) were similar to those obtained for the first site of the full length protein (Figure 9). Moreover, the binding of all the chitooligosaccharides to the fragment were qualitatively and quantitatively consistent with a single site binding mechanism (Table 6, Figure 10). These studies thus validate our interpretations that intramolecular interactions between the two domains of the full length LysM account for the observed cooperativity for its binding to chitooligosaccharides [(GlcNAc)4-7]. Molecular modeling - In the absence of a crystal or an NMR structure of the complex, it is difficult to seek a structural rationale for the thermodynamic parameters of MSL-LysM - oligosaccharide interactions. However, a plausible explanation can be provided from modeling studies. Although the structure of full length MSL-LysM is not known, the structure of lectin domain (MSL) has been elucidated using crystallography. MSL exists as a heavily domain swapped dimer. Solution studies reported here indicate that both LysM domains are involved in oligosaccharide binding. Therefore, the full length protein is likely to dimerize through the lectin domain with the two LysM domains dangling at its either end. Using the known structures of LysM domain from other sources, a homology model of LysM in MSL-LysM was built using I-TASSER. The two LysM domains in MSL-LysM are linked to the central MSL dimer by long identical polypeptide chains (Figure 11). FoldIndex indicates that part of the linker chain is likely to be intrinsically unfolded (47). Flexibility of this long linker is perhaps necessary for the biological function of MSL-LysM. As it is not possible to predict the structure of these chains in the linker region, the orientation of the LysM domains with respect to the MSL dimer becomes difficult to model in a more precise manner. Nevertheless, the model explains qualitatively MSL-LysM – chitooligosaccharide interactions, discussion on which follows. 9 ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 26

The homology model was superposed on the chitotetraose-bound LysM domain of the Ecp6chitotetraose complex to generate a model of the chitotetraose-bound LysM of MSL-LysM. The model of the first four residues of the chitohexaose obtained from the crystal structure of E. coli MltA (pdb id 2pi8) was superposed on the chitotetraose of the model of the tetraose-bound LysM, to generate a plausible model of the LysM-chitohexaose complex. As a complementary possibility, the last four residues of the chitohexaose were docked onto another LysM domain in a symmetric manner. The final model, illustrated in Figure 11, now has two LysM domains bound to a chitohexaose molecule. The first domain binds to first four residues while the second binds to the last four residues. The middle two residues are shared by the two domains in a sterically acceptable manner. The chitohexaose and LysM domain interactions are asymmetric in nature in each case. Consequently, the interactions of the two domains with the hexasaccharide are not the same, though they are similar. Models with the first LysM domain binding to a chitotetraose moiety and the second domain binding with the remainder of the sugar residues are also equally possible. Reliable homology models can be built only on the basis of available structural information. Such information on protein complexes of relevant oligosaccharides longer than hexamer is not available. Therefore, it is not feasible to predict the structural features of the interaction of MSLLysM with a full length chitin molecule on the basis of homology modeling. The main merit of the model involving chitohexaose is that it provides a rationale for the observed thermodynamic parameters reported here. CONCLUSIONS The function of LysM domain in the full length MSL-LysM has been characterized. MSL-LysM is composed of two domains separated by a flexible linker. Each polypeptide chain contains two distinct types of carbohydrate binding regions –one specific for mannose and the other for chitooligosaccharide. Although both domains are carbohydrate binding modules, each specific glycan interacts only with the respective recognition module. Therefore, these functionally decoupled domains represent a good example of protein evolution in which fusion, acquisition and structural intermingling of functionally related, but otherwise distinct domains could allow for new proteins with different function to emerge. We quantify here, for the first time, negative cooperativity in protein chitooligosaccharide interactions. The flexible linker between the two domains has a facilitating role in ensuring a correct juxtaposition of the two identical domains of the protein. Binding of the peptidoglycan component N-GlcNAc-β-(1, 4)-NMurNAc by MSL-LysM was also observed with an apparent affinity. Peptidoglycans are the major component of bacterial cell wall, and therefore this interaction may be functionally important. Interestingly, two LysM domains are enough for binding to peptidoglycan in contrast to the three reportedly required by the other bacterial LysM domains. Also the affinity of MSL-LysM for GlcNAc polymers is higher than those reported for LysM-chitooligosaccharide interactions in the other members of this family.


Page 11 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

REFERENCES 1.

2.

3.

4. 5. 6. 7.

8.

9.

10.

11. 12.

13. 14.

15.

16.

17.

Garvey, K. J., Saedi, M. S., and Ito, J. (1986) Nucleotide sequence of Bacillus phage phi 29 genes 14 and 15: homology of gene 15 with other phage lysozymes. Nucleic Acids Res. 14, 10001-10008. Ohnuma, T., Onaga, S., Murata, K., Taira, T., and Katoh, E. (2008) LysM domains from Pteris ryukyuensis chitinase-A: a stability study and characterization of the chitin-binding site. J. Biol. Chem. 283, 5178-5187. Gruber, S., Vaaje-Kolstad, G., Matarese, F., Lopez-Mondejar, R., Kubicek, C. P., and SeidlSeiboth, V. (2011) Analysis of subgroup C of fungal chitinases containing chitin-binding and LysM modules in the mycoparasite Trichoderma atroviride. Glycobiology 21, 122-133. Costa, T., Isidro, A. L., Moran, C. P., Jr., and Henriques, A. O. (2006) Interaction between coat morphogenetic proteins SafA and SpoVID. J. Bacteriol. 188, 7731-7741. Buist, G., Steen, A., Kok, J., and Kuipers, O. P. (2008) LysM, a widely distributed protein motif for binding to (peptido)glycans. Mol. Microbiol. 68, 838-847. Kombrink, A., Sanchez-Vallet, A., and Thomma, B. P. (2011) The role of chitin detection in plant--pathogen interactions. Microbes Infect. 13, 1168-1176. Mulder, L., Lefebvre, B., Cullimore, J., and Imberty, A. (2006) LysM domains of Medicago truncatula NFP protein involved in Nod factor perception. Glycosylation state, molecular modeling and docking of chitooligosaccharides and Nod factors. Glycobiology 16, 801-809. Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y., Kawakami, N., Kaku, H., and Shibuya, N. (2007) CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 104, 19613-19618. Wan, J., Zhang, X. C., Neece, D., Ramonell, K. M., Clough, S., Kim, S. Y., Stacey, M. G., and Stacey, G. (2008) A LysM receptor-like kinase plays a critical role in chitin signaling and fungal resistance in Arabidopsis. Plant Cell 20, 471-481. Koharudin, L. M., Viscomi, A. R., Montanini, B., Kershaw, M. J., Talbot, N. J., Ottonello, S., and Gronenborn, A. M. (2011) Structure-function analysis of a CVNH-LysM lectin expressed during plant infection by the rice blast fungus Magnaporthe oryzae. Structure 19, 662-674. Abhinav, K. V., Sharma, A., and Vijayan, M. (2013) Identification of mycobacterial lectins from genomic data. Proteins 81, 644-657. Patra, D., Mishra, P., Surolia, A., and Vijayan, M. (2014) Structure, interactions and evolutionary implications of a domain-swapped lectin dimer from Mycobacterium smegmatis. Glycobiology 24, 956-965. Bateman, A., and Bycroft, M. (2000) The structure of a LysM domain from E. coli membranebound lytic murein transglycosylase D (MltD). J. Mol. Biol. 299, 1113-1119. Bielnicki, J., Devedjiev, Y., Derewenda, U., Dauter, Z., Joachimiak, A., and Derewenda, Z. S. (2006) B. subtilis ykuD protein at 2.0 A resolution: insights into the structure and function of a novel, ubiquitous family of bacterial enzymes. Proteins 62, 144-151. Lecoq, L., Bougault, C., Hugonnet, J. E., Veckerle, C., Pessey, O., Arthur, M., and Simorre, J. P. (2012) Dynamics induced by beta-lactam antibiotics in the active site of Bacillus subtilis L,D-transpeptidase. Structure 20, 850-861. Liu, T., Liu, Z., Song, C., Hu, Y., Han, Z., She, J., Fan, F., Wang, J., Jin, C., Chang, J., Zhou, J. M., and Chai, J. (2012) Chitin-induced dimerization activates a plant immune receptor. Science 336, 1160-1164. Sanchez-Vallet, A., Saleem-Batcha, R., Kombrink, A., Hansen, G., Valkenburg, D. J., Thomma, B. P., and Mesters, J. R. (2013) Fungal effector Ecp6 outcompetes host immune receptor for chitin binding through intrachain LysM dimerization. Elife 2, e00790.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

18.

19. 20. 21.

22. 23.

24. 25. 26.

27.

28. 29.

30.

31.

32.

33.

34.

Page 12 of 26

van den Burg, H. A., Harrison, S. J., Joosten, M. H., Vervoort, J., and de Wit, P. J. (2006) Cladosporium fulvum Avr4 protects fungal cell walls against hydrolysis by plant chitinases accumulating during infection. Mol. Plant Microbe Interact. 19, 1420-1430. Braun, V. and Rehn, K. (1969) Chemical characterization, spatial distribution and fucntion of a lipoprotein (murein-lipoprotein) of the E. coli cell wall. European J. Biochem. 10, 426-438. Turnbull, W. B., and Daranas, A. H. (2003) On the value of c: can low affinity systems be studied by isothermal titration calorimetry? J. Am. Chem. Soc. 125, 14859-14866. Dam, T. K., Roy, R., Page, D., and Brewer, C. F. (2002) Negative cooperativity associated with binding of multivalent carbohydrates to lectins. Thermodynamic analysis of the "multivalency effect". Biochemistry 41, 1351-1358. Rice, P., Longden, I., and Bleasby, A. (2000) EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 16, 276-277. Sievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Soding, J., Thompson, J. D., and Higgins, D. G. (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7, 539. Roy, A., Kucukural, A., and Zhang, Y. (2010) I-TASSER: a unified platform for automated protein structure and function prediction. Nat. Protoc. 5, 725-738. Cohen, G. H. (1997) ALIGN: a program to superimpose protein coordinates, accounting for insertions and deletions. J. Appl. Crystallogr. 30, 1160-1161. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Crystallography & NMR system: A new software suite for macromolecular structure determination. Acta Crystallogr. D Biol. Crystallogr. 54, 905-921. Winn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R., Keegan, R. M., Krissinel, E. B., Leslie, A. G., McCoy, A., McNicholas, S. J., Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A., and Wilson, K. S. (2011) Overview of the CCP4 suite and current developments. Acta Crystallogr. D Biol. Crystallogr. 67, 235-242. Delano, W. L. (2002) The PyMol Graphics System. San Carlos, CA: Delano Scientific. de Jonge, R., van Esse, H. P., Kombrink, A., Shinya, T., Desaki, Y., Bours, R., van der Krol, S., Shibuya, N., Joosten, M. H., and Thomma, B. P. (2010) Conserved fungal LysM effector Ecp6 prevents chitin-triggered immunity in plants. Science 329, 953-955. Mesnage, S., Dellarole, M., Baxter, N. J., Rouget, J. B., Dimitrov, J. D., Wang, N., Fujimoto, Y., Hounslow, A. M., Lacroix-Desmazes, S., Fukase, K., Foster, S. J., and Williamson, M. P. (2014) Molecular basis for bacterial peptidoglycan recognition by LysM domains. Nat. Commun. 5, 4269. Wong, J. E., Alsarraf, H. M., Kaspersen, J. D., Pedersen, J. S., Stougaard, J., Thirup, S., and Blaise, M. (2014) Cooperative binding of LysM domains determines the carbohydrate affinity of a bacterial endopeptidase protein. FEBS J. 281, 1196–1208. Seidel, S. A., Dijkman, P. M., Lea, W. A., van den Bogaart, G., Jerabek-Willemsen, M., Lazic, A., Joseph, J. S., Srinivasan, P., Baaske, P., Simeonov, A., Katritch, I., Melo, F. A., Ladbury, J. E., Schreiber, G., Watts, A., Braun, D., and Duhr, S. (2013) Microscale thermophoresis quantifies biomolecular interactions under previously challenging conditions. Methods 59, 301-315. Rani, P. G., Bachhawat, K., Reddy, G. B., Oscarson, S., and Surolia, A. (2000) Isothermal titration calorimetric studies on the binding of deoxytrimannoside derivatives with artocarpin: implications for a deep-seated combining site in lectins. Biochemistry 39, 10755-10760. Saul, F. A., Rovira, P., Boulot, G., Damme, E. J., Peumans, W. J., Truffa-Bachi, P., and Bentley, G. A. (2000) Crystal structure of Urtica dioica agglutinin, a superantigen presented by MHC molecules of class I and class II. Structure 8, 593-603. 12 ACS Paragon Plus Environment

Page 13 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

35.

36. 37.

38.

39. 40.

41. 42. 43.

44.

45. 46.

47.

von der Lieth, C., Siebert, H., Kozar, T., Burchert, M., Frank, M., Gilleron, M., Kaltner, H., Kayser, G., Tajkhorshid, E., Bovin, N. V., Vliegenthart, J. F., and Gabius, H. (1998) Lectin ligands: new insights into their conformations and their dynamic behavior and the discovery of conformer selection by lectins. Acta Anat. (Basel) 161, 91-109. Eftink, M. R., and Ghiron, C. A. (1976) Exposure of tryptophanyl residues in proteins. Quantitative determination by fluorescence quenching studies. Biochemistry 15, 672-680. Sanadi, A. R., and Surolia, A. (1994) Studies on a chitooligosaccharide-specific lectin from Coccinia indica. Thermodynamics and kinetics of umbelliferyl glycoside binding. J. Biol. Chem. 269, 5072-5077. del Carmen Fernandez-Alonso, M., Canada, F. J., Jimenez-Barbero, J., and Cuevas, G. (2005) Molecular recognition of saccharides by proteins. Insights on the origin of the carbohydratearomatic interactions. J. Am. Chem. Soc. 127, 7379-7386. Privat, J. P., Delmotte, F., Mialonier, G., Bouchard, P., and Monsigny, M. (1974) Fluorescence studies of saccharide binding to wheat-germ agglutinin (lectin). Eur. J. Biochem. 47, 5-14. Chattopadhyay, A., Rawat, S. S., Greathouse, D. V., Kelkar, D. A., and Koeppe, R. E., 2nd. (2008) Role of tryptophan residues in gramicidin channel organization and function. Biophys. J. 95, 166-175. Bhattacharyya, B., Kapoor, S., and Panda, D. (2010) Fluorescence spectroscopic methods to analyze drug-tubulin interactions. Methods Cell Biol. 95, 301-329. Vivian, J. T., and Callis, P. R. (2001) Mechanisms of tryptophan fluorescence shifts in proteins. Biophys. J. 80, 2093-2109. Anantharam, V., Patanjali, S. R., Swamy, M. J., Sanadi, A. R., Goldstein, I. J., and Surolia, A. (1986) Isolation, macromolecular properties, and combining site of a chito-oligosaccharidespecific lectin from the exudate of ridge gourd (Luffa acutangula). J. Biol. Chem. 261, 1462114627. Shibuya, N., Goldstein, I. J., Shafer, J. A., Peumans, W. J., and Broekaert, W. F. (1986) Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin. Arch. Biochem. Biophys. 249, 215-224. Hom, K., Gochin, M., Peumans, W. J., and Shine, N. (1995) Ligand-induced perturbations in Urtica dioica agglutinin. FEBS Lett. 361, 157-161. Brewer, C. F., and Brown, R. D., 3rd. (1979) Mechanism of binding of mono- and oligosaccharides to concanavalin A: a solvent proton magnetic relaxation dispersion. Biochemistry 18, 2555-2562. Prilusky, J., Felder, C. E., Zeev-Ben-Mordehai, T., Rydberg, E. H., Man, O., Beckmann, J. S., Silman, I., and Sussman, J. L. (2005) FoldIndex: a simple tool to predict whether a given protein sequence is intrinsically unfolded. Bioinformatics 21, 3435-3438.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 26

FIGURE LEGENDS Figure 1 Multiple sequence alignment Multiple sequence alignment of LysM domain of MSL-LysM, three LysM domains of Rv1288 (M. tuberculosis) and other LysM domains of known 3D structures. The chitin-binding residues are shown in boxes. Secondary structure elements as they exist in the LysM of Ecp6 are indicated at the bottom of the figure. The open triangle indicates the residue (Trp171) implicated in the observed fluorescence changes during the binding of chitooligosaccharide by MSL-LysM. MSL, M. smegmatis lectin; Mtb, Mycobacterium tuberculosis; M.o., Magnaporthe oryzae; C.f., Cladosporium fulvum; A.t., Arabidopsis thaliana; B.s., Bacillus subtilis; E.c., E. coli. Figure 2 Chitin and cell wall binding assay (A) Affinity capture and precipitation of MSL-LysM by chitin from shrimp. Free chitin and MSL-LysM protein are shown in lanes 1 and 2; MSL-LysM recovered from the pellet (P) and supernatant (S) after incubation with the chitin is shown in lanes 3 and 4. (B) Cell wall-binding assay. MSL-LysM protein and MSL-LysM recovered in cell wall pellet (P) is shown in lanes 2 and 3; washed after incubation (W) and supernatant (S) are shown in lanes 1 and 4. Figure 3 Isothermal titration calorimetric studies of MSL-LysM (single site model) Calorimetric titration of MSL-LysM with (A) chitobiose, (B) chitotriose, (C) chitotetraose, (D) chitopentaose, (E) chitohexaose and (F) chitoheptaose. Protein and ligand concentration were 5.07 mM and 50 mM for chitobiose and 250 µM and 2 mM for the other chitooligosaccharides respectively. Upper panels show the raw ITC data obtained from automatic injections of chitooligosaccharides into MSLLysM. Lower panels show the integrated heats upon binding obtained using single site binding model. Figure 4 Isothermal titration calorimetric studies of MSL-LysM (two sites sequential model) Calorimetric titration of MSL-LysM with (A) chitobiose, (B) chitotriose, (C) chitotetraose, (D) chitopentaose, (E) chitohexaose and (F) chitoheptaose. Protein and ligand concentration were 5.07 mM and 50 mM for chitobiose and 250 µM and 2 mM for the other chitooligosaccharides respectively. Upper panels show the raw ITC data obtained from automatic injections of chitooligosaccharides into MSLLysM. Lower panels show the integrated heats upon binding obtained by fitting a two site sequential model. Figure 5 Analysis of raw ITC data (A) Scatchard plot of the ITC data for chitotetraose (2 mM) binding to MSL-LysM (250 µM). (B) The corresponding Hill plot. Figure 6 Fluorescence quenching of MSL-LysM as a function of (GlcNAc)4 concentration (A) Emission spectra at varying (GlcNAc)4 concentrations measured at 22 ˚C. (B) A plot of the change of quenching at 340 nm as a function of (GlcNAc)4 concentration. The curve could only be fitted using a two component exponential decay, which indicates the existence of two different binding sites. Figure 7 Analysis of fluorescence data (MSL-LysM) (A) A plot of the change in quenching at 340 nm as a function of various chitooligosaccharides concentration. (B) Hill plot of fluorescence quenching of MSL-LysM treated with different concentration of chitotetraose at 22˚C. Figure 8 Purification and mass confirmation of LysM fragment. A) Purification profile of Ni-NTA affinity purified LysM fragment (LysMf) on Superdex 75 column (GE Healthcare). The inset shows the SDS-PAGE profile of LysMf after Ni-NTA affinity purification obtained subsequent to gel-filtration. B) MALDI-TOF spectrum of LysMf. 14 ACS Paragon Plus Environment

Page 15 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 9 Analysis of fluorescence data. Hill plots of fluorescence quenching of (A) MSL-LysM and (B) monomeric LysM domain treated with different concentration of chitooligosaccharides, respectively. Figure 10 Analysis of fluorescence data (LysM domain) (A) A plot of the change in quenching at 340 nm as a function of various chitooligosaccharides concentration. (B) Hill plot of fluorescence quenching of LysM domain treated with different concentration of chitotetraose at 22˚C. Figure 11 Homology model of LysM domains with bound chitohexaose (A) Chitohexaose, shown in sticks, is docked at the putative binding sites of both the LysM domains. The sugar binding residues present in both the domains are shown in sticks (B) The LysM domains are shown in green, MSL dimer is shown in red and the connecting linker between them are shown in grey.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 26

Table 1 Glycan array compounds for MSL-LysM and Ecp6 with best RFUs* Serial Glycan CFG glycan Average RFU no. no. MSL-LysM Ecp6 1

190

GlcNAcb1-4GlcNAcb1-4GlcNAcb1-4GlcNAcb14GlcNAcb1-4GlcNAcb1-Sp8

11109

6290

2

191

GlcNAcb1-4GlcNAcb1-4GlcNAcb1-4GlcNAcb14GlcNAcb1-Sp8

9470

7656

3

192

GlcNAcb1-4GlcNAcb1-4GlcNAcb-Sp8

4642

6093

4

368

Neu5Aca2-6GlcNAcb1-4GlcNAcb1-4GlcNAc-Sp21

2218

---

5

313

MurNAcb1-4GlcNAcb-Sp10

1958

---

6

311

GlcNAcb1-4GlcNAcb-Sp10

604

---

7

98

GalNAcb1-4(Fuca1-3)GlcNAcb-Sp0

533

---

8

81

Fuca1-4GlcNAcb-Sp8

524

---

*

RFUs less than 500 are not shown due to signal to noise ration issue.

Table 2 Thermodynamic parameters for the binding of MSL-LysM to various chitooligosaccharides using single site model at 25˚C * Sugar

N ± S.D.

Ka x 104 (M-1) ± -∆H0 (kcal mol-1) -∆G0 (kcal mol-1) -∆S0 (cal mol-1 K-1) S.D. ± S.D. ± S.D. ± S.D.

(GlcNAc)2

0.92 ±0.0.1

0.010± 0.001

1.7± 0.21

2.2± 0.2

1.67±0.15

(GlcNAc)3 0.72±0.1

7.1± 0.12

15.2±0.11

6.6±0.08

28.8±0.13

(GlcNAc)4 0.60± 0.12

11.7± 0.18

22.6±0.16

6.9±0.17

52.6±0.18

(GlcNAc)5 0.48± 0.2

117± 12.2

25.3±3.4

8.3± 2.1

56.9± 7.2

(GlcNAc)6 0.45± 0.25

197±15.7

27.0±4.2

8.6±2.3

61.7±8.3

(GlcNAc)7 0.44±0.28

170± 21.6

20.0±4.8

8.5±3.2

39.0±8.8

*

Thermodynamic parameters are obtained from an average of three independent ITC experiments.


Page 17 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table 3 Thermodynamic parameters for the binding of MSL-LysM to various chitooligosaccharides evaluated using two site sequential model* 4

-

4

Ka2 x 10 (M 1 ) ± S.D.

-

-∆S02

-∆H01 (kcal mol-1)± S.D.

-∆H02 (kcal mol-1)± S.D.

-∆G01 (kcal mol-1) ± S.D.

-∆G02

-∆S01

(kcal mol1 ) ± S.D.

(cal mol-1 K-1)± S.D.

(cal mol-1 K-1) ± S.D.

Sugar

Ka1 x 10 (M 1 ) ± S.D.

(GlcNac)2

0.0216±0.006

0.0072±0.001

2.76±0.11

0.445±0.71

3.2±0.9

2.5±0.7

1.4±3.18

6.8±1.2

(GlcNac)3

12.5±0.08

1.1±0.06

16.96± 0.04

17.65 ±0.08

6.9±0.04

5.5±0.05

33.6±0.08

40.7±0.09

(GlcNac)4

214±0.11

7.3±0.09

21.45±0.12

12.27±0.14

8.6±0.13

6.6±0.015

43.4±0.14

18.9±0.17

(GlcNac)5

153±1.5

5.4±0.8

25.00±1.8

1.6±1.1

8.4±1.7

6.4±1.4

55.6±3.4

16.2±3.1

(GlcNac)6

179±2.1

5.8±1.7

24.9±1.8

8.8±1.0

8.5±1.8

6.5±1.1

55.0±3.5

8.05±2.5

(GlcNac)7

121±5.6

2.47±6.8

21.7±3.5

4.54±2.8

8.3±3.1

6.0±2.9

45.2±5.7

-35.3±4.1

*

Thermodynamic parameters are obtained from an average of three independent ITC experiments.

Table 4 The binding parameters for MSL-LysM and chitooligosaccharides interactions from Hill and Scatchard plots (ITC data)* Sugar

Hill coefficient n ± S.D.

Binding site N (Scatchard) ± S.D.

Ka1 x 104 (M-1) ± S.D.

Ka2 x 104 (M-1) ± S.D.

(GlcNac)2 0.95 ± 0.29

1.49 ± 0.82

0.0088 ± 0.83

0.073 ± 0.92

(GlcNac)3 0.90 ± 0.08

1.85 ± 0.06

19.90 ± 0.21

1.26 ± 0.34

(GlcNac)4 0.87 ± 0.09

1.87 ± 0.07

190.5 ± 0.33

11.2 ± 0.42

(GlcNac)5 0.57 ± 0.08

1.92 ± 0.05

70.8 ± 0.21

4.1 ± 0.37

(GlcNac)6 0.53 ± 0.07

2.2 ± 0.06

28.1 ± 0.22

2.2 ± 0.39

(GlcNac)7 0.51 ± 0.12

2.1 ± 0.27

32.2 ± 0.57

3.1 ± 0.93

*

Bindings parameters are an average of three independent ITC experiment measurements.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 26

Table 5 Binding parameters obtained from Hill plots of fluorescence data (MSL-LysM)* Hill coefficient Sugar

KaF1 [x 104 (M-1)] ± S.D. KaF2 [x 104 (M-1)] ± S.D.

n ± S.D. (GlcNac)2 0.94 ± 0.34

0.097 ± 0.05

0.069 ± 0.04

(GlcNac)3 0.81 ± 0.14

50.11 ± 3.4

0.8 ± 0.07

(GlcNac)4 0.79 ± 0.21

120.7 ± 7.6

7.94 ± 0.9

(GlcNac)5 0.74 ± 0.18

147.6 ± 9.4

2.7 ± 1.2

(GlcNac)6 0.71 ± 0.22

147.6 ± 9.4

2.7 ± 1.2

*Measurements are an average of 3 independent experiments.

Table 6 Binding parameters obtained from Hill plots of fluorescence data (monomeric LysM domain)* Hill coefficient Sugar

KaF [x 104 (M-1)] ± S.D.

n ± S.D. (GlcNAc)2 1.20 ± 0.34

0.093 ± 0.04

(GlcNAc)3 1.02 ± 0.14

25.11 ± 3.8

(GlcNAc)4 0.95 ± 0.21

65.7 ± 6.5

(GlcNAc)5 0.94 ± 0.18

97.6 ± 7.9

(GlcNAc)6 0.93 ± 0.22

127.6 ± 8.7

*Measurements are an average of 3 independent experiments.


Page 19 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 1

Figure 2 A

B


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3


Page 20 of 26

Page 21 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 4


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5 A

B

Figure 6 A

B


Page 22 of 26

Page 23 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 7 A

B

Figure 8


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 9 A)

B)

Figure 10 A

B


Page 24 of 26

Page 25 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 11


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For Table of Contents Only


Page 26 of 26

Negative Cooperativity and High Affinity in ... - ACS Publications

Recommend Documents