New Insights into Staphylococcus aureus ... - ACS Publications

ARTICLE pubs.acs.org/jpr

New Insights into Staphylococcus aureus Stress Tolerance and Virulence Regulation from an Analysis of the Role of the ClpP Protease in the Strains Newman, COL, and SA564 Dorte Frees,† Julie Hove Andersen,† Lene Hemmingsen,†,‡ Kerttu Koskenniemi,‡ Kristoffer T. Bæk,† Musemma Kedir Muhammed,† Dereje Dadi Gudeta,† Tuula A. Nyman,§ Antti Sukura,‡ Pekka Varmanen,|| and Kirsi Savijoki*,§ †

)

Department of Veterinary Disease Biology, Faculty of Life Sciences, University of Copenhagen, Stigbøjlen 4 DK-1870, Frederiksberg C, Denmark ‡ Department of Veterinary Biosciences, University of Helsinki, Finland § Institute of Biotechnology, University of Helsinki, Finland Department of Food and Environmental Sciences, Faculty of Agriculture and Forestry, University of Helsinki, Finland

bS Supporting Information ABSTRACT: In Staphylococcus aureus, ClpP proteases were previously shown to be essential for virulence and stress tolerance in strains derived from NCTC8325. Because these strains exhibit a severely reduced activity of the alternative sigma factor, SigB, we here reassessed the role of ClpP in SigB-proficient clinical strains. To this end, clpP was deleted in strains COL, Newman, and SA564, and the strains were characterized phenotypically. The proteomic changes accomplished by the clpP deletion in the different strains were analyzed using the 2-D DIGE technique. The proteomic analyses revealed mostly conserved changes in the protein profiles of the ClpP-deficient strains. Among the strain-specific changes were the up-regulation of prophage proteins that coincided with an increased spontaneous release of prophages and the relatively poorer growth of the clpP mutants in some strain backgrounds. Interestingly, the effect of ClpP on the expression of selected virulence genes was strain-dependent despite the fact that the expression of the global virulence regulators RNAIII, mgrA, sarZ, sarR, and arlRS was similarly changed in all clpP mutants. ClpP affected the expression of sarS in a strain-dependent manner, and we propose that the differential expression of sarS is central to the strain-dependent effect of ClpP on the expression of virulence genes. KEYWORDS: Staphylococcus aureus, ClpP, proteolysis, prophages, regulation of virulence, 2-D DIGE

’ INTRODUCTION The opportunistic pathogen Staphylococcus aureus continues to be a leading cause of human infections ranging from minor skin infections to life-threatening endocarditis, pneumonia, and septicemia.1 The adaptability and resilience of S. aureus is highlighted by the worldwide dominance of methicillin-resistant S. aureus (MRSA) strains in hospital settings and by the recent emergence of highly virulent community-acquired MRSA strains.2 The pathogenicity of S. aureus relies on a wide array of surfacebound and secreted virulence factors that equip the bacterium for tissue binding, tissue destruction, and immune evasion.3 Interestingly, proteomic studies have revealed that both the surfacome (total surface-bound proteins) and exoproteome (total extracellular proteins) of clinical S. aureus isolates display an extreme heterogeneity, with only a very small subset of proteins, less than 10%, produced by all of the tested strains.4,5 This variation can be partly explained by differences in genotype because many virulence r 2011 American Chemical Society

factors are encoded in variable regions of the chromosome.6 However, recent data suggest that a differential expression of virulence genes has an equally important role in generating diversity.5,7,8 The expression of virulence factors is regulated by a complex network of regulatory elements encompassing at least six two-component systems, including AgrAC, SaeRS, SrrAB, HssRS, ArlRS, and YycFG, along with the alternative sigma factor SigB, the ClpP proteases, and a number of transcriptional regulators, of which many belong to the family of SarA homologues. The access to whole genome sequences has revealed that natural mutations in global virulence regulators occur frequently among S. aureus isolates and that different “regulatory genotypes” can explain some of the phenotypic diversity in the virulence gene expression.9 Special Issue: Microbial and Plant Proteomics Received: September 22, 2011 Published: November 23, 2011 95

dx.doi.org/10.1021/pr200956s | J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

Table 1. S. aureus Strains Used in the Present Study S. aureus strains

relevant genotype

reference

8325

rsbU‑ traR+

36

8325-4

Derived from 8324 by curing of 3 prophages

36

8325-4ΔclpP

clpP‑

20

8325-4ΔclpP + clpP

clpP‑ complemented with a chromosomal copy of clpP

This study

8325ΔclpP::erm + clpP

clpP disruption mutant complemented with a chromosomal copy of clpP

22

SH100

Functional rsbU derivative of 8325-4

11

COL

Methicillin-resistant clinical isolate

63

COLΔclpP COLΔclpP + clpP

clpP‑ clpP‑ complemented with a chromosomal copy of clpP

This study This study

Newman

Clinial isolate (ATCC 25904), rsbU+

64

NewmanΔclpP

clpP‑

This study

NewmanΔclpP + clpP

clpP‑ complemented with a chromosomal copy of clpP

This study

NewmanΔrsbUVWsigB

rsbU‑ sigB‑

23

SA564

Low passage clinical isolate

65

SA564ΔclpP

clpP‑

This study

For example, the high expression of hemolysins and extracellular proteases observed in the strains derived from NCTC8325, which is defective in the rsbU gene that encodes an activator of SigB, can be ascribed to the low activity of the alternative sigma factor, SigB, in these strains.10
12 Similarly, the characteristic profile of the virulence factors produced by the strain Newman has been linked to a missense mutation in saeS that results in a hyper-activation of the SaeRS two-component system.13 The ATP-dependent ClpP proteases are highly conserved among eubacteria and in the chloroplasts and mitochondria of eukaryotic cells.14 Structurally and functionally, ClpP proteases are related to the eukaryotic proteasome,15 and like other energydependent proteases, ClpP proteases play a critical role in protein homeostasis by disposing of damaged (misfolded) proteins and by degrading short-lived regulatory proteins (reviewed by Frees et al.16). The conditional degradation of regulatory proteins is controlled by complex signaling cascades that are fully understood only in a few cases. Notable examples of cellular regulators that are subject to conditional degradation by ClpP proteases include the competence regulator ComK in Bacillus subtilis and the stationary phase sigma factor σS in E. coli and Salmonella Typhimurium.17
19 Misfolded proteins present a major problem to cells stressed by heat shock and other stressful conditions, and therefore the function of the ClpP proteases is especially important in stressed cells. In the low GC Gram-positive bacteria Staphylococcus, Listeria, Streptococci, and Bacillus subtilis, ClpP proteases appear to be the most important type of protease for degrading stress-damaged proteins because clpP mutants are highly sensitive to stress.16 Importantly, the inactivation of ClpP in pathogenic bacteria often has a profound negative effect on their virulence, and in Staphylococcus aureus, the inactivation of clpP attenuated virulence in a murine abscess model.20,21 Presumably, the role of ClpP in stress responses contributes to the decreased virulence of the S. aureus clpP mutant; however, current knowledge suggests that the down-regulation of extracellular virulence factors in the clpP mutant may be the primary reason for the loss of virulence.20
22 Importantly, the role of ClpP in the stress tolerance and virulence of S. aureus has only been characterized in strains of the NCTC8325 family. As stated above, the 8325-derived strains carry an 11 bp deletion in the rsbU gene encoding an activator of the alternative sigma factor SigB.

Accordingly, these strains do not produce any RsbU, and the strains consequently have a severely reduced SigB activity.10,23 In B. subtilis, SigB is the master regulator of the general stress response, and SigB was predicted to play a similar role in S. aureus (reviewed by Hecker et al.24). However, because the overlap between the Bacillus and S. aureus SigB regulons turned out to be surprisingly small (10%), and because S. aureus sigB mutants were only moderately stress-sensitive, this assumption has been questioned.24 However, two recent studies clearly demonstrated that SigB is indeed important for the survival of S. aureus under conditions of extreme stress.25,26 Furthermore, it is well documented that SigB in S. aureus has a major yet unidentified effect on global virulence regulation.9,11,12,23 We therefore found it important to re-examine the role of ClpP in S. aureus in SigBproficient strains. For this reason, we deleted clpP in two wellcharacterized strains, Newman and COL, as well as in the lowpassage clinical isolate SA564, and examined the effect on the stress tolerance and virulence regulation of the strains. Furthermore, we expanded our knowledge of the role of ClpP in S. aureus by characterizing the changes in the cellular proteome accomplished by the clpP deletion in both SigB-positive and -negative strain backgrounds, using the strain backgrounds of 8325-4, Newman, and SA564.

’ MATERIALS AND METHODS Bacterial Strains and Growth Conditions

The bacterial strains used in this study are listed in Table 1. The S. aureus strains were grown in tryptic soya broth media (TSB; Oxoid) under vigorous agitation at 200 rpm at 37 °C. In most experiments, 20 mL of medium was inoculated in 200-mL flasks to allow efficient aeration of the medium. For solid medium, 1.5% agar was added to make TSA plates. Erythromycin (5 μg mL
1) was added as required. Upon receipt of the lowpassage isolate SA564, the strain was cultured once and stored frozen at
80 °C. In all of the experiments, we used SA564 and the other strains freshly streaked from the frozen stocks on TSA plates with antibiotics added as required and incubated overnight at 37 °C. The plates were used to inoculate the TSB cultures by transferring a small streak of the colonies into the liquid 96

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

medium. The growth was followed by measuring the optical densities at 600 nm. The starting OD was always below 0.05.

iodoacetamide (buffer B), first in buffer A for 25 min and then in buffer B for 25 min. The strips were loaded on 12% acrylamide gels that were subjected to electrophoresis in an Ettan DALTsix Electrophoresis Unit (GE Healthcare) at 80 V for 15 min and then 400 V for approximately 3 h. The upper buffer was 2 TGS (50 mM Tris, 384 mM glycine, 0.2% (w/v) SDS; Bio-Rad), and the lower buffer was 1 TGS (25 mM Tris, 192 mM glycine, 0.1% (w/v) SDS). The gels were scanned between low-fluorescence glass plates using a FLA-5100 laser scanner (Fujifilm) at wavelengths of 473 nm (for Cy2), 532 nm (Cy3), and 635 nm (Cy5) using voltages of 420, 410, and 400 V, respectively. All of the gels were scanned at 100-μm resolution. The gel images were cropped to an identical size by removing the areas extraneous to the protein spots with the aid of the ImageQuant TL 7.0 software (GE Healthcare). DeCyder Analyses. The image and statistical analyses for the cropped 2-D DIGE gels were performed using the DeCyder 2D 6.5 software (GE Healthcare). With the use of a batch processor function, the gels were first automatically analyzed in a differential in-gel analysis (DIA) module, which normalized the Cy2, Cy3, and Cy5 image from each gel. The spot boundaries were detected, and the spot volumes, analogous to the protein abundances, were calculated. Then, the spot volumes of the Cy3 and Cy5 samples were compared with the spot volumes of the Cy2 sample, as an internal standard, to generate standard spot volumes, thereby correcting intergel variations. In the biological variation analysis (BVA) module, the Cy2 images of four replicate gels were matched, and the standard spot volume ratios between all four of the gels were compared. The spots with at least a 2.0fold spot volume ratio change and p < 0.05 were selected for mass spectrometric (MS) identification. Protein Identification. MS-compatible silver staining30 was performed to visualize the protein spots for identification. The protein spots of interest were in-gel digested with trypsin, and the peptides were recovered as previously described.29 The resulting peptides were analyzed using peptide-mass fingerprinting (PMF) or fragment ion analysis with LC
MS/MS. For the PMF-based identifications, the mass spectra were acquired using an Ultraflex TOF/TOF instrument (Bruker Daltonik, Bremen, Germany) in positive ion reflector mode, and the instrument was externally calibrated using a standard peptide mixture from Bruker (P/N 206195; Bruker Daltonik). The resulting peak lists were generated using the FlexAnalysis software Biotools 3.0 (Bruker Daltonik). The PMF data were interpreted using a local MASCOT server (MASCOT 2.2, Matrix Science, London, U.K.). The protonated molecular ion “MH+” and “monoisotopic” were defined for the peak mass data input. In the case of a low Mowse score identification, a peptide from the PMF analysis was selected as a precursor ion and subjected to MS/MS fragment analysis in the MALDI-TOF/TOF lift-mode to confirm the identification. For the LC
MS/MS-based identification, the tryptic peptides were analyzed using an Ultimate 3000 nano-LC (Dionex, Sunnyvale, CA) and QSTAR Elite hybrid quadrupole TOF mass spectrometer (Applied Biosystems/MDS Sciex, Foster City, CA) with nano-ESI ionization, as detailed by Koskenniemi et al.31 The PMF and LC
MS/MS data were searched using the local Mascot version 2.2 (Matrix Science, London, U.K.) against the in-house database of the published ORF set of S. aureus Newman, which contained 2624 entries,32 and the S. aureus NCTC 8325 strain, which contained 2892 entries,33 using the Biotools 3.0

Construction of clpP Deletion Strains and Complemented Strains

For construction of the clpP deletion in the strains COL, Newman, and SA564, pSaΔclpP from RN4220 was electroporated into competent cells at 30 °C as described by Frees et al.20 A strain containing the desired deletion of the clpP gene in strain Newman was obtained by allelic replacement as described by Frees et al.,20 except that the final plasmid-loss was performed at 42 °C. The chromosomal clpP deletion was verified as described by Frees et al.20 In the COL and SA564 background, we followed the same procedure except that the plasmid loss was done in the presence of 50 μg mL
1 acyldepsipeptide (ADEP), which is detrimental to cells harboring an intact clpP gene.27 With this procedure, the desired clpP deletion mutants were obtained with a frequency of 10
3. In comparison, spontaneous ADEP-resistant colonies were obtained with a frequency of 10
6, in accordance with published results.27 The clpP deletion mutants were complemented with a chromosomally integrated copy of clpP using the single-copy integration vector system described by Luong and Lee.28 The clpP gene with its own promoter was amplified from 8325
4 chromosomal DNA using the primers clpP897f (50 -GCCGTCAAACAATGTAAC) and clpP1644r (50 -ATTGACACCTTGGTTTACTC). The PCR product was cloned into pCR2.1-TOPO (Invitrogen). After verifying that it did not contain any mutations, the fragment was cloned into pCL25 via HindIII and XbaI digestions. The resulting plasmid was transformed into RN4220 containing the pYL112Δ19 plasmid. This plasmid encodes the integrase from the Staphylococcal phage L54a that catalyzes a site-specific integration of the plasmid (pCL25clpP) into the 30 end of the chromosomal geh gene. The integrated copy of clpP was then transduced into the 8325-4ΔclpP, COLΔclpP, and NewmanΔclpP strains. Proteome Analysis

Two-dimensional Difference Gel Electrophoresis (2-D DIGE). Four replicate biological samples of 1.8 mL each from the independent cultures of the SA564, Newman, and 8325
4 wild types and their clpP mutant derivative strains were withdrawn at midlogarithmic phase (OD600 ≈ 0.9
1.1). The cells were broken with glass beads, and the extracted and purified proteins (50 μg) were differentially labeled using Cy2, Cy3, or Cy5 dyes (CyDye DIGE Fluor minimal dyes; GE Healthcare) as described by Koskenniemi et al.29 and using the experimental design outlined in Supplemental Table 1 (Supporting Information). The labeled proteins were separated using isoelectric focusing (IEF). IPG strips (24 cm, pH 3
10 nonlinear; Bio-Rad) were rehydrated overnight at 20 °C in 500 μL of buffer that contained 7 M urea, 2 M thiourea, 4% CHAPS, 50 mM DTT, 2 mM tributylphosphine, and 1% Bio-Lyte pH 3
10 (Bio-Rad) using a Protean IEF Cell (Bio-Rad). Samples containing a total of 150 μg of protein in 50 mM DTT, 4 mM tributylphosphine, and 1% Bio-Lyte pH 3
10 were applied to the IPG strips via cup-loading near the acidic end of the strips. The IEF was performed using a Protean IEF Cell at 20 °C as follows: 15 min at 250 V, then linear ramping to 10000 V for 40000 Vh, and 40000 Vh at 10000 V, using a limit of 50 μA/strip. After the IEF, the strips were equilibrated in buffers containing 50 mM Tris-HCl at pH 6.8, 6 M urea, 2% SDS, 20% glycerol, and alternatively either 2% DTT (buffer A) or 2.5% 97

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

and hla-r: 50 -TGCCATATACCGGGTTC), sbi (sbi-f: 50 -GTTGCTAGTTGGGGCAGCA + sbi-r: 50 - CTGATTTCACACGCTCATC), and rnalll (50 - GATCACAGAGATGTTATGG + 50 CATAGCACTGAGTCCAAGG) were amplified using the depicted primers, and the PCR products were used as a template in the labeling reactions. The spa and sspA genes were amplified with the primers described by Frees et al.21 All of the steps were repeated in at least two independent experiments, which gave similar results.

(Bruker Daltonik) and the ProteinPilot 2.0.1 interfaces (Applied Biosystems), respectively. The S. aureus 8324 and the Newman protein databases were downloaded from the homepage of the genome sequencing projects via the Sanger Centre ftp server (ftp://ftp,ncbi,nih,gov/genbank/genomes/Bacteria/Staphylococcus_aureus_Newman/,ftp://ftp.ncbi.nih.gov/genbank/genomes/Bacteria/Staphylococcus_aureus_NCTC_8325). In selected cases, the LC
MS/MS data were searched against the NCBInr database restricted to the other Firmicutes taxonomy (release 23052010, 1297564 sequences). The search criteria for both of the Mascot searches were trypsin digestion with one missed cleavage allowed, carbamidomethyl modification of cysteine as a fixed modification, and oxidation of methionine as a variable modification. For the LC
MS/MS spectra, both the maximum precursor ion mass tolerance and the MS/MS fragment ion mass tolerance were 0.2 Da, and a peptide charge state of +1, +2, +3 was used. A successful identification was reported when a significant match (p < 0.05) was obtained.

’ RESULTS AND DISCUSSION Deletion of clpP in Strains COL, Newman, and SA564

To assess the significance of the ClpP protease for stress tolerance and virulence gene regulation in SigB-proficient S. aureus strains, we deleted the clpP gene in COL and Newman as well as in the less characterized low-passage clinical isolate SA564, originally isolated from a patient with toxic shock syndrome (Table 1). In Newman, we succeeded in obtaining the clpP deletion strain by using the same double crossover recombination strategy as used for constructing our original 8325-4 clpP deletion strain.20 In SA564 and COL, we could select colonies that had obtained the desired chromosomal deletion of clpP. However, following the replacement recombination, these colonies still maintained a plasmid-borne copy of the intact clpP gene, and despite the temperature-sensitive nature of the pAUL-A vector, numerous attempts to achieve plasmid loss by growing the cells at a nonpermissive temperature were unsuccessful. To overcome this problem, the cells were grown at a nonpermissive temperature in the presence of acyldepsipeptide (ADEP). ADEPs constitute a newly described class of antibiotics that specifically inhibits the growth of several Gram-positive bacteria, including S. aureus, by interfering with the function of ClpP.27,35 Hence, the addition of ADEPs to the growth medium inhibits the growth of cells carrying an intact clpP gene, and in the presence of ADEPs, erythromycinsensitive colonies carrying the chromosomal clpP deletion were readily obtained for both COL and SA564. To ascertain that the phenotypes observed for the constructed mutants were linked to the deletion of clpP, the strains were complemented with an intact clpP gene integrated into the chromosome and expressed from its native promoter as described in the Methods section.

Western Blot Analyses

The protein extractions and Western blotting were performed as described by Jelsbak et al.7 The membranes were preblocked with human IgG to avoid a signal from Protein A. The rabbitraised antibodies against Staphylococcal SigB, RsbW and RsbV, were kindly obtained from Jan Pan
e-Farr
e (Ernst-Moritz-ArndtUniversit€at), the MgrA antibody was a generous gift from Adhar Manna (University of South Dakota), and the rabbit antiSbi-antibody was kindly provided by Jean van den Elsen (University of Bath). The Rot antibody was purified in our lab as described in Jelsbak et al.34 The bound antibody was detected using the WesternBreeze Chemiluminescent Anti-Rabbit kit or Antimouse kit (Invitrogen). All of the Western blots were repeated at least three times with similar results. Northern Blot Analysis

The RNA extraction and Northern blotting were performed as described previously.34 Briefly, the cells were lysed mechanically using the FastPrep system (Bio101; Q-biogene), and the RNA was isolated using the RNeasy mini kit (QIAGEN, Valencia, Calif.) according to the manufacturer’s instructions. The total RNA was quantified and checked for quality using the nanodrop2000, and 7 μg of RNA from each preparation was loaded onto a 1% agarose gel. The hybridization was performed according to Frees et al.21 using gene-specific probes labeled with [32P]dCTP (Perkin-Elmer) using the Ready-to-Go DNA-labeling beads from GE-healthcare. Internal fragments of the genes arlS (arlS-f: 50 - GATGATGCAGAACGAACGCTC + arlS-r: 50 GAATACCAATTCCATGATCTG), asp23 (asp23-f: 50 -CAAGCATACGACAATCAAACTG and asp23-r: 50 -CATTACATCATCAACTTGCATG), ureC (ureC-f: 50 -GTAACACGTGATGACGTGAACG + ureC-r: 50 -CATGAC CGC CACCAGCACCTT), femD (femD-f: 50 -CAGACGGAGTAAGAGGTGTC + femD-r: 50 - CGATATGCCCAGATTGTTCTC), defB (defB-f: 50 -TGGTCATCCAACTTTGCGTCA and defB-r: 50 -CTTCTACTGTGGTTGTAATG), typA (typA-f: 50 -GGATACACCAGGACATGCAG + typA-r: 50 CGTAACCTCTTGTCATTGAC), sarR (sarR-f: 50 TGACATTAATGATTTAGTAACGCand sarR-r 50 : AATGTATTCTTCTAATTCTGAAATCCAG), sarS (sarS-f: 50 - CAAGCCTGAAGTCGATATGACT + sarS-r: 50 -GTCTTGCTGCGCGTCATC), sarZ (sarZ-f: 50 -AGCTATCTTAGCAAGCAGTTG + sarZ-r: 50 -TACTTTCTGTCGGAATAGTCAR), hla (hla-f: 50 -TTAGCCTGGCCTTCAGCCTTT

Inactivation of ClpP Stimulates the Spontaneous Release of Prophages

We first noted that the clpP mutants from the Newman and COL backgrounds formed colonies of a very reduced size on TSA plates incubated overnight at 37 °C (Figure 1A), suggesting that ClpP had a profound negative effect on the nonstressed growth of these strains. Consistently, the early exponential doubling time was increased from 39 to 66 min in the COL background and from 30 to 51 min in the Newman background, compared to the minor increases from 27 to 39 min in SA564 and from 30 to 36 min in 8325-4. Moreover, the final optical density reached by the clpP mutants was reduced about 50% in all of the strains except for the strains from the 8325-4 background. Strikingly, the deletion of clpP in 8325, the parent strain of 8325-4, also had a more severe effect on growth, with an increase in the doubling time from 30 to 48 min (Figure 1A). The 8325-4 strain was derived from 8325 by UV-curing the strain of its 3 prophages.36 We therefore assessed if the spontaneous induction of phages was affected by the inactivation of ClpP. Indeed, the spontaneous release of phages was

98

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

Figure 2. Spontaneous release of pro-phages is enhanced by the deletion of clpP. The wild-type and clpP mutant strains were inoculated and grown in TSB + 10 mM CaCl2. At OD600/mL = 1.5, 1 mL of culture was withdrawn, the cells were precipitated by centrifugation, and the supernatant was sterile-filtrated (pore size 0.45 μM). Next the supernatant was assayed for the content of phages by serially diluting it in 0.9% NaCl, 10 mM CaCl2, and mixing 100 μL of each dilution with 100 μL of indicator strain (8325-4) and incubating for 5 min before adding 3 mL TSB-softagar (TSB, 0.5 mM CaCl2, 0.5% agar) and pouring onto TSA plates that were incubated ON at 37 °C. The pfu/mL in the sterile spent growth medium was approximately 2  105 (8325), 10  106 (8325ΔclpP), 3  105 (Newman), 9  106 (NewmanΔclpP). Figure 1. Impact of ClpP on stressed and nonstressed growth in various strain-backgrounds. (A) Cultures of wild type strains (8325-4, Newman, COL, SA564, and 8325) and the corresponding clpP mutant strains were inoculated from fresh plates (incubated ON at 37 °C) into TSB to a starting OD of 0.01 or below. The cultures were grown exponentially at 37° with shaking at 200 rpm and a flask/culture of 10/1. At OD600 = 0.2 the cultures were diluted 10
1, 10
2, 10
3, and 10
4 fold and 10 μL of each dilution was spotted on TSA plates (or TSA pH 9). The plates were incubated at the indicated temperatures. (B) Cultures of SH1000 and 8325-4 were grown as described above and spotted on TSA plates with a pH of 9. The plate was incubated ON at 44°.

form colonies at 45 °C, in the presence of 2 M NaCl, or at pH 9 at 44 °C (Figure 1A and data not shown). Generally, the rsbU-negative strains 8325-4 and 8325 tolerated temperature stress and osmotic stress equally as well as strains with a high SigB activity (Figure 1A and data not shown). However, although a moderately high pH (pH 9) and moderately high temperature (44 °C) did not reduce the number of colonies formed by the Newman and SA564 strains, the strains 8325-4, 8325, and COL were unable to form colonies under these conditions (Figure 1A). Individually, alkalinity and heat stress conditions have both been reported to induce SigB activity, raising the possibility that the growth defect of the 8325-derivatives at pH 9 at 44 °C is linked to the reduced SigB activity of these strains.37 In support of this assumption, SH1000, which is an rsbU+ derivative of 8325-4, grew as well as Newman and SA564 at pH 9 at 44 °C (Figure 1B). These results strongly indicate that SigB is specifically required for S. aureus to mount an adaptive response to allow growth at an alkaline pH at a high temperature. The deletion of clpP conferred a strong stress-sensitive phenotype to all of the strains, as shown by the fact that all of the clpP mutants formed no colonies or colonies of much reduced sizes at 15 °C, at 45 °C, in the presence of 2 M NaCl, or at pH 9 at 44 °C (Figure.1A). The growth defects were all complemented in the clpP mutant strains (data not shown). Generally, the clpP mutants in the rsbU-deficient strains did not appear to be more stress-sensitive than clpP mutants in rsbU-proficient strains. We conclude that there is a natural variation in the stress tolerance of the wild-type strains, with the COL strain being clearly more stress-sensitive than other strains despite that COL is SigBpositive. However, the clpP mutation confers the same stresssensitive phenotype to all of the tested strains.

stimulated approximately 30
50-fold by the clpP mutation in the 8325 and Newman backgrounds, whereas in COL, the stimulation was only about 4-fold (Figure 2 and data not shown). In contrast, we did not observe a spontaneous or mitomycin-induced induction of prophages in SA564 or its clpP mutant. Interestingly, the clpP deletion in the SA564 strain had a less severe effect on the growth rate, and similar to 8325-4, the SA564 clpP mutant formed colonies of almost the same size as the wild-type cells at 37 °C (Figure 1A). We therefore speculate that the lysogenization by prophages of 8325, Newman, and COL contributed to the poorer growth of the clpP mutants during nonstressed conditions in these backgrounds. Natural Variation in the Stress-tolerance of the Wild-type and clpP Mutant Strains

To examine whether the stress-related phenotypes reported for the clpP mutants in 8325-4 and 8325 (both rsbU
) are conserved in SigB-proficient strains, the growth of the strains COL, Newman, SA564, 8325
4, 8325, and the derived clpP mutants was compared by spotting cells in early exponential growth phase onto TSA plates and growing under different conditions: 15 °C, 37 °C, 45 °C, pH 9 at 37 °C, pH 9 at 44 °C, or (2 M NaCl. The growth under stressful conditions revealed a varying stress tolerance among the wild-type strains; in all of the tested conditions, the growth of COL was the most severely inhibited by stress, and in contrast to the other wild-type strains, COL was not able to

Proteomic Analysis of the clpP Mutants Reveals Conserved and Strain-specific Changes between Strains

A previous microarray analysis of the S. aureus 8325 strain has revealed that ClpP has a broad impact on the regulons associated with primarily virulence and stress responses.22 To complement 99

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

these findings and to expand our knowledge of the role of ClpP in S. aureus, we performed proteome-wide analyses of the wild type versus the clpP mutant in 8325-4, Newman, and SA564, using strains with high or low SigB activity and strains with or without prophages. Fluorescent 2-D DIGE was used as the proteomic tool because, unlike the classical 2D gel electrophoresis, this multiplexed dye-based technique provides increased confidence in the detection of protein differences.38 To this end, quadruplicate protein samples extracted from cells at a midlogarithmic growth phase (OD600 = 1.0 ( 0.1) were differentially labeled with CyDye labels and pooled for IEF and 2D separation, as outlined in Supplemental Table 1 (Supporting Information). After the gel electrophoresis, codetection of the scanned 2D gel images using DeCyder software enabled the detection of 2244 (8324
5), 2116 (SA564), and 2181 (Newman) spot features in the indicated S. aureus proteomes over the pI range of 3
10 (Figure 3). The DIA analyses of the 2D gels indicated 1322 (Newman), 1338 (SA564), and 1147 (8325-4) spot features per image pair (Cy5/Cy3) with normally distributed volume ratios, with an average of 2 SD corresponding to a threshold value of (2.0 (data not shown). Using this threshold as a cut off to track proteome changes, a statistically significant difference in the relative protein abundance could be indicated for 44, 47, and 27 protein spots (p < 0.05) in the Newman, SA564, and the 8324-5 proteomes, respectively (Figure 3). From these protein spots (117 in total), mass spectrometry analyses identified 115 proteins, which are detailed in Supplemental Table 2 (Supporting Information). In each of the three proteomes, several of the identified proteins are thought to undergo charged post-translational modification because the same protein was identified in multiple protein spots (Figure 3, Supplemental Table 2). Using the selected quantification criteria (>2.0-fold and p < 0.05) and excluding the charge-isomer proteins, the number of commonly identified proteins in at least two of the three S. aureus strains was 26, whereas the total number of uniquely identified proteins from only one strain was 27: nine proteins in SA564, six proteins in 8325-4, and twelve proteins in Newman (Tables 2 and 3). However, a reinspection of the DeCyder data revealed that for the majority of these ‘uniquely’ identified proteins, an equivalent protein can be found in each strain and that their expression is changed similarly but less than 2.0-fold (p < 0.05) by the clpPmutation (Tables 2 and 3). Thus, taking these findings into account, we conclude that the inactivation of clpP generally results in relatively conserved changes in protein expression in S. aureus. Intriguingly, among the proteins accumulating solely in Newman were two phage-proteins encoded by the ϕNM4 prophage.39 The accumulation of the ϕNM4 antirepressor and major capsid protein in the NewmanΔclpP mutant supports the hypothesis that ClpP controls the spontaneous induction of some pro-phages and suggests that ClpP may do so by controlling the stability of the antirepressor of the lytic switch. We are currently investigating this issue in more detail. Proteins Up-regulated in the clpP Mutants. The proteins that exhibited an significant increase in abundance (>2-fold and p < 0.05) in the absence of ClpP are listed in Table 2. These proteins accumulating in the clpP mutants may be potential substrates of ClpP or they may accumulate because of the increased expression in the absence of clpP. To roughly differentiate between these two possibilities, we compared the proteomic data to the transcriptomic data previously obtained for the 8325 strain and its clpP mutant in exponential growth phase22 (Table 2).

Figure 3. Representative overlay image of fluorescent 2D-gels containing proteins extracted from the clpP proficient and deficient Newman, SA564 and 8324
5 strains. The total amount of protein used for CyDye labeling was 150 μg. Protein spots appearing in purple (Newman, SA564), or green (8324-5) were more abundant in indicated strains lacking clpP. Protein spots appearing in white showed no differences in abundance between the wild-type and the clpP mutant strains. The numbered protein spots cut from the same gels stained with silver were identified and are listed in Supplemental Table 2 (Supporting Information). White circles refers to proteins exhibiting less than 2-fold change (p < 0.05) due to the clpP mutation. Protein spots marked with a star were found to contain two proteins.

This comparison revealed that most of the accumulating proteins exhibited increased transcription in the absence of ClpP, suggesting that an increased synthesis and not a decreased degradation causes the observed accumulation. However, three proteins, TypA (BipA), DefB, and GlmM, accumulated in at least two strains despite a lack of change in their transcription between 100

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

Table 2. Proteins Showing Increased Abundance in S. aureus ΔclpP Strains

genea clpC

N315 synonymb SA0483

ahpC

SA0366

l

ahpF

SA0365 I

glmM (femD)

SA1965

l

clpB

SA0835

I

typA ureC

SA0959 SA2084

dnaK

SA1409

groEL

SA1836

Mw/ pIc 91.0/5.51 21.1/4.88

transcriptomics

8325-4

proteomics

Newman

ΔclpP/wt

ΔclpP/wtd

SA564 ΔclpP/wt

ΔclpP/wt

fold-changee

foldchangee

10

4.4
5.6g

3

54.9/4.68

2.5

49.3/4.65




Mowse scoresf h

5.2

147

h

3.8

148

3.8

h

43 g

4.9
5.1

69.3/4.94 61.7/5.19


10

4.9 4.2

49 225i

3.3

Upk




Up




h

153 , 262 h

foldchangee

Mowse scoresf

223
368h, 624i 8.1
8.5

74
335h

h

3.4

71 , 125

2.9

133j

3.4

h

4.5

94h

3.9
4.3

i

134

h

3.4 h

20

2.5

Mowse scoresf

124
338h 6.6
8.5g

98.4/4.97

57.6/4.55

foldchangee

116 g

82h

4.5 h

192, 362

3.6
7.4

g

253h

3.9 9.3

h

76 121h

3.6 2.7

55h 176i

2.0

57h

2.5

131h

2.2

h

81

2.5

294h

i

ctsR

SA0480

17.9/5.93

3.5

Up




3.0

40

3.2




mcsB

SA0482

38.8/5.09

10

Up




2.4

97i

Up




oppF

SA0859

69.9/5.14/4.92

2.5

Up




2.9

91h

2.3

148h

Up




2.4

i

ctgS

SA0419

40.4/5.48

2.5

m

2.7

554i

i

57

opuCA znADH

SA2237 SA2160

46.2/5.82 32.9/5.66

2.4 2

NP 2.4


133h

4.8 2.0

293 46i

NP Up





ssaA

SA2093

29.4/8.96

2

3.1

957i

4.8

305i

Up




20.6/5.68




5.2

h

NP




7.4

102h

h

defB

SA0942

k

124

rhbC

SA1983

76.2/5.74




2.2

115

NP




NP




sbi

SA2206

50/9.38

0.22

Up




8.7

58h

Up




SA0231

43.0/4.98

0.5

NP




2.2

93i

NP







28.5/9.38




NP




NP




4.9

SA0983

33.6/5.07 40.0/5.48





NP Up





NP Up





2.5
4.2 2.7

fhuC

SA0602

29.5/5.64




Up




Up




2.6

butA

SA0122

27.2/4.79




Up




Up




2.6

hmp NWMN_0268

phage anti repressor

NWMN_0294 pheT

phage

117i g

47h, 73j 263j 192h 83h

fba

SA2399

33.0/4.6

2.0

NC




NC




2.4
2.5

proRS

SA1106

63.9/4.85




Up




NC




2.3

110h

pdxS

SA0477

32.0/4.83




Up




Up




2.2

347i

NWMN_1728 (ecsA)

SA1655

27.8/4.92




Up




Up




2.2

251i

msrA NWMN_ 2072

SA1257 SA1974

20.6/6.88 44.9/4.6





Up Up





NP Up





2.1 2.0

187i 132h

k

g

113h, 264h

a Gene annotations for the identified proteins were retrieved from the Sanger Centre at ftp://ftp,ncbi,nlm,nih,gov/genomes/Bacteria/Staphylococcus_aureus_Newman/,ftp://ftp.ncbi.nih.gov/genbank/genomes/Bacteria/Staphylococcus_aureus_NCTC_8325 installed in the in-house Mascot server or from the NCBInr database. Spot number for the corresponding protein in each strain can be found in Supplemental Table 2, Supporting Information. b Equivalent protein in the S. aureus strain N315 (NC_002745) to facilitate comparison of transcriptome and proteome results with those published from other S. aureus strains. c Theoretical MW (kDa) and pI values were obtained from MASCOT search results. d ClpP-dependent changes in the expression of the corresponding gene in S. aureus 8324 assessed by microarray analysis.22 e The average volume value ratio based on the normalized spot volume standardized against the intragel standard provided by DeCyder software analysis. f Propability based Mowse scores (p < 0.05) revealing significant identifications by MALDI-TOF PMF (MS), MS coupled with an additional tandem fragment analysis in the MALDI-TOF/TOF lift- mode (MS/(MS)), or by LC
MS/MS (MS/MS). Protein identification scores. g Protein was identified in multiple protein spots suggesting that it has undergone charged post-translational modification, possibly involving phosphorylation. h Mowse score for MS. i Mowse score for MS/MS. Further details are provided in Supplemental Table 2, Supporting Information. j Combined Mowse score for MS/(MS). k DeCyder analysis indicating proteins not present (NP), showing no change (NC), or showing less than 2-fold increase (Up) due to clpP mutation. l AhpF and GlmM were identified from the same spot; but after visual examination of 3D views and comparison of changes in protein abundance with theoretical pI and Mw values of the two proteins we conclude that the increased protein abundance originates from AhpF. In case of TypA and ClpB, the 3D view analysis and theoretical pI/Mw values suggests that both proteins accumulate in the clpP mutant strain. m This protein spot shows more than 3-fold increase due to clpP mutation but could not be identified.

of certain mRNAs, such as the E. coli fis mRNA encoding the universal regulator Fis.40 Interestingly, TypA was recently shown to accumulate in a chloroplast clpP2
1 mutant, indicating a universally conserved link between ClpP and TypA.41 DefB (peptide deformylase) is responsible for removing the formyl group from

the wild-type and the mutant strains, as confirmed by Northern blotting (Supplemental Figure 1, Supporting Information). Homologues of both TypA and DefB fulfill roles in the translational process: TypA is a widely conserved GTP-binding protein that associates with the ribosomes and promotes the translation 101

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

Table 3. Proteins Showing Decreased Abundance in S. aureus ΔclpP Strains

genea mgrA asp23 sdhA

N315 synonymb SA0641 SA1984 SA0995

Mw/pIc 17.1/7.6 19.9/4.84

transcriptomics

8325-4

proteomics

Newman

ΔclpP/wt

ΔclpP/wt

SA564 ΔclpP/wt

ΔclpP/wt

fold-changed

foldchangee

0.25

4.71

0.34

h

65.5/5.32

0.4

Mowse scoresf 146g


NP

2.89

68

g

purC

SA0918

26.7/5.07




2.66

52

SA0925

54.5/6.01




2.72

165g

42.4/6.02 52.9/5.69


0.33

2.55 Down

65


purL

SA0921

79.6/4.51




Down


j

2.2

purH

SA0917 SA0375

Mowse scoresf

Down h 2.53
2.89

g

purK impDH (guaB)

foldchangee

Mowse scoresf 664i

2.87 i

52, 967 51

foldchangee

i

j

2.93
3.78

75, 56g,i

3.18

132g

2.3

104

Down




2.5

78i

2.02
2.08

81, 247g

i

2.02 2.11
2.63 j

70 152, 1583i

Down 2.07
2.43 j


116, 223g




2.18

1417i

g

i

Down




fusA

SA0505

76.6/4.52




NC




2.18

1983i

NC




purR

SA0916

17.1/6.52




Down




2.02

152i

Down




fbaA

SA1927

30.8/4.72

0.42

2.11

94g

2.1

162, 485i

2.09

143g

5.82

k

NP




2.71

78k

adhE

SA0143

95.07/5.85

0.17

j

64

ftfL/fhs

SA1553

60.0/5.62




2.02

129

2.34

283

Down




pgaM cidC

SA2204 SA2327

26.7/5.05 63.9/6.91





NPj 2.04


527i

3.52 NCj

42i


2.1 NC

228g


adh1

SA0562

36.1/5.31

0.29

4.16

128g

Down




Down




sodA

SA1382

22.7/4.86




4.71

61g

Down




Down




pycA

SA0963

128.6/4.93

0.27

5.41

139g

Down




Down




ackA

SA1533

44.1/5.89




Down




1.99

26i

Down




ABC transporter

SA2302

25.8/6.54

0.03

NP




NP




2.21

251i

aroA

SA1558

40.6/6.03




Down




2.7

100i

Down




mhpC

SA2367

31/4.72




NC




Down

2.36

78g

g

i

a

Gene annotations for the identified proteins were retrieved from the Sanger Centre at ftp://ftp,ncbi,nlm,nih,gov/genomes/Bacteria/Staphylococcus_aureus_Newman/,ftp://ftp.ncbi.nih.gov/genbank/genomes/Bacteria/Staphylococcus_aureus_NCTC_8325 installed in the in-house Mascot server or from the NCBInr database. Spot number for the corresponding protein in each strain can be found in Supplemental Table 2, Supporting Information. b Equivalent protein in the S. aureus strain N315 (NC_002745) to facilitate comparison of transcriptome and proteome results with those published from other S. aureus strains. c Theoretical MW (kDa) and pI values were obtained from MASCOT search results. d ClpP-dependent changes in the expression of the corresponding gene in S. aureus 8324 assessed by microarray analysis22 e The average volume value ratio based on the normalized spot volume standardized against the intragel standard provided by DeCyder software analysis. Propability based Mowse scores (p < 0.05) revealing significant identifications by MALDI-TOF PMF (MS), MS coupled with an additional tandem fragment analysis in the MALDI-TOF/TOF lift- mode [(MS/(MS)], or by LC
MS/MS (MS/MS). Protein identification scores. f DeCyder analysis indicating proteins not present (NP), showing no change (NC) or showing less than 2-fold decrease (Down) due to clpP mutation. g Mowse score for MS. h Protein was identified in multiple protein spots, suggesting that it has undergone charged post-translational modification, possibly involving proteolysis and/or phosphorylation. i Mowse score for MS/ MS. Further details are provided in Supplemental Table 2, Supporting Information. j DeCyder analysis indicating proteins not present (NP), showing no change (NC), or showing less than 2-fold increase (Up) due to clpP mutation. k Combined Mowse score for MS/(MS).

(ctsR-mcsA-mcsB-clpC), groE, and dnaK is induced in response to an accumulation of misfolded proteins, which supports the notion that ClpP proteases serve to degrade misfolded proteins even in the unstressed cells.16,46 The ahpCF transcription is strongly induced in the clpP mutant22 and the proteomic data indicate that this up-regulation is common to all of the tested strains. The ahpCF operon is subject to regulation by PerR; however, because we do not see a strong induction of other PerR-regulated genes, the specific induction of this operon seems to occur by a PerR-independent mechanism. We know that Spx, a transcriptional regulator responding to thiol and oxidative stress, accumulates strongly in the absence of ClpP.47 However, because Spx does not control ahpCF transcription (our unpublished data), the mechanism underlying the strong induction of the ahpCF operon in the clpP mutants remains unexplained. When we searched for overlap between the Bacillus Spx regulon and the proteins accumulating in the clpP mutants, we only

the amino-terminal formylated methionine of newly synthesized polypeptides as they emerge from the ribosomal tunnel.42 GlmM/ FemD (phosphoglucosamine mutase) catalyzes the first step in the biosynthetic pathway leading to UDP-N-acetylglucosamine (UDP-GlcNAc), which is one of the main cytoplasmic precursors of bacterial cell wall peptidoglycan.43 We are presently investigating whether TypA, DefB, and/or GlmM are bona fide substrates of ClpP proteases. Strikingly, the majority of proteins accumulating in the clpP mutants in all three of the tested backgrounds can be categorized as stress proteins (Table 2). Examples include the alkyl hydroperoxidase (AhpC/F) and the genuine chaperones ClpB, DnaK, and GroEL, as well as, ClpC and its adaptor McsB,44 which all play indispensable roles in the protein quality homeostasis of the cell as reviewed by Frees et al.16,45 The transcriptomic data suggest that all of these proteins accumulate because of increased transcription. The transcription of the clpC operon 102

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

Figure 4. clpP mutants possess increased urease activity. Urease activity was examined in liquid urease containing medium after 20 h of growth as described by Christensen.66 (1) Newman; (2) COL; (3) SA564; (4) 8325; (5) 8325-4.

identified a single protein of unknown function, OppF (SA0859), encoded by an spx-neighboring gene.48 The enzyme urease encoded by the ureABCDERGD operon has been shown to be an important virulence factor for certain Staphylococcus strains.49 Here we show that the strong accumulation of this enzyme in the clpP mutants was accompanied by urease positive reactions; in comparison, wild-type strains appeared weakly positive or negative in a urease tube assay (Figure 4). In the 8325 mutant, the transcription of the urease operon was stimulated 10-fold, and the high urease activity in all of the clpP mutants suggests that this trait is conserved among strains.22 The transcription of the urease operon is highly induced in an mgrA mutant strain.50 MgrA is a global regulator of genes involved in antibiotic resistance and virulence that, in the present study, was found to be significantly down-regulated by the clpP deletion in all of the tested strain backgrounds (see below). ClpP may therefore control transcription of the urease operon by modulating the MgrA level. In addition, the IgG-binding protein Sbi accumulated strongly in the SA564 clpP mutant strain (Table 2, Supplemental Table 2, Supporting Information). In contrast, sbi transcription was reported to decrease in the 8325 clpP mutant.22 To examine whether the effect of ClpP on Sbi expression is strain-dependent, we monitored the sbi transcript and protein levels in all of the strains using Northern and Western blot analysis (Figure 5). From this analysis, it is clear that the expression of Sbi is stimulated both at the transcript and protein level in all of the strains lacking the ClpP proteases. Thus, the mechanism responsible for the ClpP-dependent down-regulation of sbi transcription appears to be conserved among strains. Curiously, we observed two accumulating proteins at the expected size of Sbi in all of the clpP mutants (Figure 5B). It was recently reported that Sbi is found both extracellularly and bound to the cell envelope, and that both forms contribute to immune evasion.51 The two protein bands cross-reacting with Sbi antibodies are likely to represent the nonmature Sbi carrying the signal-peptide and the envelope-associated form of the Sbi containing the C-terminal membrane-binding domain (Figure 5B). After an inspection of Sbi in the SA564 proteome (Figure 3) and the 3D-view of the corresponding 2D gel region surrounding Sbi (Figure 5C), it is tempting to speculate that the identified protein showing a significant increase in abundance (Figure 3; spot 3) in the clpP mutant correlates to the nonmature Sbi with the signal peptide. On the other hand, no apparent accumulation of a lower molecular weight protein corresponding to the potential envelopeassociated form of Sbi was observed in the SA564 clpP mutant

Figure 5. sbi mRNA and Sbi protein levels are increased in clpP mutants regardless of the strain background. (A) Northern blot detection of the sbi transcript. RNA was extracted from exponential growth phase (OD600 = 1.0 ( 0.1). Equal loading was confirmed by visualization of the rRNAs
data not shown. (B) Western blot detection of the Sbiprotein using Sbi antibodies generously supplied by Dr. Jean van den Elsen (University of Bath). Proteins were extracted in exponential growth phase (OD600 = 1.0 ( 0.1). (C) Representative three-dimensional (3D) image of DIGE spot identified as Sbi (spot 2) exhibiting differential abundance in the wild-type and the clpP mutant strain of SA564. 3D images and statistics were generated using the BVA module of the DeCyder software. Proteins were extracted from midexponential phase cells (OD600 = 1.0).

Figure 6. mgrA transcription is decreased by the clpP deletion in all strains. The mgrA transcipt was detected by Northern blot analysis: RNA was extracted from all strains in exponential growth phase (OD600 = 1.0). Five μg of RNA was loaded in each lane of an agarose gel (equal loading was confirmed by visualization of the rRNAs
data not shown) and blotted to a Nylon-membrane as described in the experimental section. The mgrA transcript was detected using a radioactively labeled probe, and were quantified using the Cyclone Plus Phosphor imager from PerkinElmer.

proteome (Figure 5C), which can be due to the under-representation of membrane proteins are in 2-D gels. Proteins Down-regulated in the clpP Mutants. The majority of proteins that exhibited a decrease in relative protein abundance in the clpP mutants function in the de novo synthesis of purines or in the metabolism of sugars (Table 3). The amount of reduction of these proteins was close to the cutoff, and the specific reduction of these proteins may be linked to the reduced growth rate of the clpP mutants. Interestingly, the global transcriptional regulator MgrA was found to be among the most down-regulated proteins in the clpP mutants derived from 8325 to 4 and Newman, and Northern and Western blotting showed that the expression of MgrA is reduced in the clpP mutants from all of the strain backgrounds (Figure 6 and data not shown). 103

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

The relative abundance of native, or unprocessed, alkaline shock protein 23 (Asp23) was reduced 2.2-fold (p < 0.05) in the SA564 strain (spot 42), whereas the corresponding protein in the Newman clpP mutant had less than a 2-fold reduction (p < 0.05) in relative abundance (Table 3). The protein spot corresponding to native Asp23 was not found in the wild-type 8325-4 proteome, implying that its expression in this strain is below the detection limit (Figure 3). Interestingly, the 2-D DIGE analyses strongly suggest that the native Asp23 is targeted to proteolytic cleavage because this protein appears in vertical protein spots migrating with somewhat lower molecular weight values (Figure 3, Supplemental Table 2, Supporting Information). Notably, these proteins (spots 38 and 40 in Newman and spots 40 and 42 in SA564) show a 2.5
3.8fold reduction in their relative abundance in the Newman and SA564 clpP mutants (Supplemental Table 2), indicating that the relative amount of these cleavage products is reduced in the absence of ClpP. These findings suggest that ClpP could play a role in controlling the proteolytic cleavage of the native Asp23 or that the stability of the cleavage products is decreased in the strains lacking ClpP. The transcriptional level confirmations assessed by Northern blotting demonstrated that the down-regulation of Asp23 expression occurs at the level of transcription and is also conserved in the COL strain (Figure 7A). This observation is interesting because asp23 is transcribed solely from SigB-dependent promoters, suggesting that SigB activity is reduced in the absence of ClpP. 8325-4 does not encode the SigB activator RsbU; hence, SigB activity is severely decreased in this strain.10,23 This absence of SigB explains why Asp23 was not detected in the proteomic analysis of this strain (Figure 3). However, transcriptomic data revealed that asp23 transcription is also reduced 3-fold in 8325.22 We found it intriguing that ClpP positively controls the activity of SigB in both RsbU-positive and -negative strains, implying that the stimulatory effect of ClpP on SigB activity is not linked to the RsbU-dependent activation of SigB. We therefore decided to investigate this observation in more detail. A Western blot analysis revealed that, in all of the tested strains, the low SigB activity in the clpP mutants was accompanied by a clear decrease, up to 4-fold, in the cellular level of SigB, the antisigma factor RsbW, and the anti-anti-sigma factor RsbV (Figure.7B and data not shown). Importantly, this finding does not support the hypothesis that SigB or the antisigma factor RsbW are substrates of ClpP, as has been shown for σs in E.coli and the anti-ECF sigma factors in B. subtilis.17,18,52 Instead, we speculate that the reduced activity of SigB in the clpP mutants, as measured by the expression of the SigB target gene asp23, may simply reflect the lower level of SigB in these strains. However, we have no explanation at present for how ClpP stimulates SigB expression.

Figure 7. SigB activity and synthesis are decreased in the clpP mutant regardless of the RsbU status of the cells. (A) Northern blot detection of the three asp23 transcripts that all originate from SigB-dependent promoters. RNA was extracted from late-exponential growth phase (OD600 = 2.0). The asp23 transcripts were detected using a radioactively labeled probe. (B) Western blot detection of SigB and the antisigma factor RsvW in late-exponential growth phase (OD600 = 2.0). To visualize equal loading, the signals detected from nonspecific binding of the RsbW antibody to an unknown cellular protein is shown.

strains (Figure 8A).22 The genes encoding the extracellular proteases are among the most down-regulated virulence genes in the 8325 clpP mutant, and accordingly, the extracellular proteolytic activity on plates containing skimmed milk was eliminated in clpP mutants in the 8325-4 backgrounds.20
22 Here, we examined the expression of sspA encoding the extracellular serine protease with Northern blotting and confirmed an sspA down-regulation in 8325-4ΔclpP; however, the sspA transcript level was below the limit of detection in the remaining strains (data not shown). Instead, we tested the extracellular proteolytic activity of the strains on plates containing skimmed milk. Interestingly, we observed that ClpP had a nonconserved role in extracellular protease activity: the deletion of clpP slightly increased the activity in COL, Newman, and SA564 while eliminating the activity in 8325 and 8325-4 (Figure 8B and data not shown). Finally, we examined the transcription of the important virulence factor ProteinA, encoded by the spa gene. In the strains Newman and SA564, the spa transcription was reduced substantially (5
10-fold) by the absence of ClpP, and spa transcription was restored by complementing the clpP deletion (Figure 8C). In contrast, the spa transcription was slightly enhanced by inactivating clpP in the 8325-4 and COL strain backgrounds, whereas we did not observe any effect of the clpP deletion in 8325. In conclusion, the effect of the clpP deletion on spa transcription appears to be strain-dependent in a manner that did not correlate to the SigB status of the cell. In regard to extracellular virulence factors, the inactivation of clpP in SigBproficient strains did not result in the same dramatic downregulation of hla and extracellular proteases as has previously been published from studies on ClpP in 8325 and 8325-4.20
22 A mechanism that might explain these observations is discussed below.

Differential Effect of ClpP on the Expression of Selected Virulence Genes (hla, sspA, spa)

RNAIII Expression Is Reduced by the Inactivation of clpP in All Strains

One of the most significant phenotypes of the clpP deletion in strains 8325-4 and 8325 is the dramatic effect of the deletion on global virulence gene regulation.20
22 To assess if this effect of ClpP is conserved among strains, we examined the expression of the selected virulence genes hla, sspA, and spa. Northern blotting revealed that hla expression varied widely among strains, with 8325-4 exhibiting the highest expression (Figure 8). Although the absence of clpP substantially decreased the transcription of hla in the 8325 and 8325-4 backgrounds, the inactivation of clpP only modestly affected the hla transcription in the rsbU-positive

ClpP is a protease and thus cannot control the transcription of virulence genes directly. Previous attempts to pinpoint the factor(s) through which ClpP controls virulence gene expression revealed that clpP mutants derived from 8325 and 8325-4 express approximately 3-fold less RNAIII than the wild type strains, and hence, it was suggested that the role of ClpP in virulence regulation is mediated through RNAIII.20
22 Therefore, we assessed the RNAIII level in all of the clpP mutants and found that 104

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

Figure 9. Transcription of rnaIII, sarZ, and sarR is reduced by the clpP deletion in all strains while the effect of ClpP on sarS transcription is strain-dependent. The levels of (A) rnaIII, (B) sarR, (C) sarZ, and (D) sarS transcripts in wild-type and clpP mutant cells were assessed by Northern blot analysis in exponential growth phase, OD600 = 1.0 (sarR, sarZ, and sarS) or in late-exponential cells OD600 = 2.0 (rnaIII). The radioactive signals were quantified using the Cyclone Plus Phosphor imager from PerkinElmer.

Figure 8. Strain dependent effects of the clpP deletion on expression of selected virulence genes. The level of (A) hla and (C) spa transcripts in wild-type and clpP mutant cells was assessed by Northern blot analysis. RNA was extracted from late-exponential growth phase OD600 = 2.0 ( 0.1 (hla) or from exponential growth phase OD600= 0.9 ( 0.1 (spa). Equal loading was confirmed by visualization of the rRNAs
data not shown. The radioactive signals were quantified using the Cyclone Plus Phosphor imager from PerkinElmer. (B) Proteolytic activity was determined by streaking the strains (from TSA plates grown ON at 37 °C) on plates containing 10% skimmed milk and incubating 24 h at 37 °C. Extracellular proteolytic activity is observed as a clearance-zone.

that the effect of ClpP on SigB and MgrA expression is conserved in all of the tested clpP mutants. Similarly, a substantial reduction of the transcription of sarR (∼3-fold), sarZ (∼5-fold), and arlRS (∼2-fold) was conserved in all of the clpP mutants (Figure 9, and data not shown). We did not detect changes in the SarA level between mutant and wild-type strains in any of the tested strain backgrounds (data not shown). Interestingly, SarZ is a functional homologue of MgrA.55 The activity of both SarZ and MgrA is controlled by a redox-sensitive Cys, the oxidation of which leads to the dissociation of MgrA/SarZ dimers and a release from target DNA.55,56 Hence, similar to many other proteins with changed expression in the clpP mutants, SarZ and MgrA have a role in the oxidative stress response. Interestingly, the effect of ClpP on the sarS transcription turned out to be strain-dependent: although the sarS transcription was unaffected by the clpP deletion in the 8325 background,22 and in the COL background, Northern blotting confirmed increased sarS transcription in the 8325-4 clpP mutant (Figure 9). In contrast, Newman and SA564 harbored high wild-type levels of the sarS transcript, and in these strains the sarS mRNA level was reduced substantially (5-fold) by the absence of ClpP (Figure 9). Hence, the effect of the clpP deletion on sarS transcription is strain-dependent in a manner that did not correlate to the SigB status of the cell. Notably, the level of sarS transcript was similar in all clpP mutants. The same pattern was observed for the effect of ClpP on spa transcription. Oscarsson et al.12 showed that the low expression of sarS in 8325-4 explains why the inactivation of sarA leads to a decreased transcription of hla in 8325-4 and an increased hla transcription in other strains. SarA and SarS are both repressors of hla transcription; additionally, SarA represses sarS transcription. In 8325-4, the inactivation of SarA increased the sarS levels 15-fold, leading to a net increase in repressor activity and hence reduced hla transcription.12 In strains with a high SarS expression, however, the inactivation of sarA resulted in a net decrease in repressor activity resulting in an enhanced transcription of hla.12 Inspired by this study, we suggest that the differential effect of ClpP on spa, sspA, and hla expression may be linked to the strain-dependent effect of ClpP on sarS expression because SarS has also been shown to bind to the promotor of sspA and to activate the transcription of spa. A model of this process is depicted in Figure 10.57 In 8325-4, the inactivation of clpP increases the expression of SarS,

the clpP deletions slightly decreased the RNAIII levels in the Newman and SA564 strains (Figure 9). In the COL strain, we did not detect the RNAIII signal, which is in accordance with a number of previous publications.7,9 Recent findings indicate that RNAIII generally acts through an antisense base-pairing mechanism and regulates the transcription of many virulence genes by inhibiting the translation of the transcriptional regulator Rot.53,54 We tried to determine if the lower expression of RNAIII in the clpP mutants led to enhanced levels of the Rot protein. However, similar amounts of Rot protein were observed in the wild-type and mutant strains (data not shown). Hence, the reduction in RNAIII expression in the clpP mutant does not seem to be severe enough to interfere with the normal RNAIII-dependent downregulation of Rot. Moreover, the effect of ClpP on RNAIII/Rot did not differ among the strains. These data do not support the hypothesis that the differential effect of the ClpP virulence gene expression is mediated through RNAIII/Rot. Strain-dependent Effect of ClpP on sarS Expression May Explain the Nonconserved Effect of ClpP on Virulence Gene Regulation

In the 8325 strain background, the deletion of clpP significantly changed the transcription (>2-fold) of a number of global virulence regulators: sigB, the genes encoding the two component systems agrAC and arlRS, as well as mgrA, sarA and sarR, which encode the transcriptional regulators of the SarA family.22 A similar DNA microarray comparing the transcription between 8325
4 and its clpP mutant in a late-exponential growth phase (OD600 = 2.0) confirmed the findings from 8325 and added sarS and sarZ to the list of virulence regulators that significantly change expression in the clpP mutants (respectively 23-fold upregulated and 5- fold down-regulated in the 8325-4 clpP mutant; manuscript in preparation). To learn more about the straindependent effect of ClpP on virulence gene expression, we here assessed the expression of the affected virulence regulators in all of the tested strain backgrounds. As described above, we revealed 105

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

Figure 10. Model depicting how the strain-dependent effect of ClpP inactivation on expression of hla, sspA, and spa may be mediated by the strain-dependent effect of ClpP on SarS expression. SarS is depicted as gray spheres. The relative size of the spheres reflects the relative concentration of SarS (low in 8325-4, but increased in 8325ΔclpP; high in Newman and SA564 wild-type cells but decreased upon deletion of clpP). MgrA is depicted as black spheres. The relative sizes of the spheres reflect the relative concentrations of MgrA (high in wild-type cells and reduced in clpP mutant cells). hla, sspA, and spa transcripts are depicted as arrows and the size of the arrows reflect the concentration of transcripts. Details are described in the text.

leading to a repression of sspA and hla. In contrast, in Newman and SA564, the inactivation of clpP resulted in a reduction in sarS transcription; hence, the derepression of extracellular proteases. However, the model does not explain why a slight decrease in hla transcription was observed in Newman and SA564. This finding suggests that ClpP stimulates hla transcription via additional transcriptional regulators that counteract the effect of SarS derepression. This factor may be MgrA because MgrA binds to the hla promotor and stimulates transcription, at least in some strains.50,58 The strong reduction of the hla transcription in the 8325-4 strain can therefore be explained as the combined increase of SarS-repressor activity and reduction of MgrA activation. In contrast, the reduction in MgrA activation in SA564 and Newman is counteracted by the reduced SarS repression, with the net effect of only a slight reduction in the hla transcription. SarS is an activator of spa transcription, and the differential expression of sarS may also explain why ClpP affects spa transcription oppositely in Newman, SA564, and 8325-4. In 8325-4ΔclpP, the increased expression of spa is in line with the increased transcription of sarS, whereas in Newman and SA564, the inactivation of ClpP reduced the expression of both sarS and spa. Notably, the expression of sarS, spa, and hla in the wild-type COL and its clpP mutant derivative did not follow the same pattern as in the other RsbU-positive strains. The differences may be linked to the RNAIII deficiency of the COL strain and emphasize the fact that the virulence regulation in strain COL sets this strain apart from other strains.7,9

’ CONCLUDING REMARKS The presented data stress the importance of ClpP-mediated proteolysis for the general fitness of S. aureus regardless of the SigB status of the cells. Our data suggest that the strain-dependent effects of the clpP deletion may be linked to the strain content of prophages. Phage regulatory proteins were among the first-identified substrates of the ClpP protease in E. coli, and we find it highly likely that an inactivation of ClpP interferes with the regulatory switch of some pro-phages.59
61 The role of ClpP in

ARTICLE

phage regulatory switches has been hitherto overlooked in S. aureus, and our results emphasize the fact that many factors contribute to the severity of inactivating a protease with a very broad repertoire of substrates. A comparative proteomic analysis revealed that the major proteomic change accomplished by the inactivation of ClpP was the up-regulation of chaperones and other stress-proteins, mainly oxidative stress proteins, underscoring the important role of the ClpP protease in protein homeostasis. The inactivation also led to major perturbations in the cellular content of global virulence regulators. At present, we cannot rule out that the changes are epigenetic or that the link between ClpP and virulence gene regulation is indirect in the sense that the cellular stress imposed by the lack of ClpP, demonstrated by the up-regulation of stress pathways, may create some general physiological or metabolic signals that may be sensed by the regulatory network controlling virulence determinants, as proposed by Somerville and Proctor.62 However, this would not explain why the clpP deletion has a strain-dependent effect on the expression of the central virulence regulator, SarS. An important challenge for the future will be to solve this issue and to more directly identify the substrates of the ClpP protease.

’ ASSOCIATED CONTENT

bS

Supporting Information Supplemental tables and figure. This material is available free of charge via the Internet at http://pubs.acs.org.

’ AUTHOR INFORMATION Corresponding Author

*Kirsi Savijoki, Department of Food and Environmental Sciences, University of Helsinki, Finland. Tel. +358 9 191 583 08; Fax +358 9 191 584 60; e-mail: kirsi.savijoki@helsinki.fi.

’ ACKNOWLEDGMENT The gift of ADEPS from Heike Br€otz-Oesterhelt is greatly appreciated. For supply of strains or plasmids, we thank Chia Y. Lee (University of Arkansas), Knut Ohlsen (University of W€urzburg), Greg Somerville (University of Nebraska), Simon Foster (University of Sheffield), and Markus Bischoff (University of Saarland Hospital). For donating antibodies, we express our gratitude to Jan Pan
e-Farr
e (Ernst-Moritz-Arndt University, Greifswald), Adhar Manna (University of South Dakota), and Jean van den Elsen (University of Bath). Ewa Kuninska is greatly acknowledged for valuable technical assistance. This work was supported by grants from the Danish Research Council on Technology and Production to D.F. and from NKJ to D.F. and P.V. and from the Academy of Finland (grants 1123208, 114529, 139296) to K.S. and P.V. ’ REFERENCES (1) Lowy, F. D. Staphylococcus aureus infections. N. Engl. J. Med. 1998, 339 (8), 520–532. (2) DeLeo, F. R.; Chambers, H. F. Reemergence of antibioticresistant Staphylococcus aureus in the genomics era. J. Clin. Invest. 2009, 119 (9), 2464–2474. (3) Novick, R. P. Staphylococcal pathogenesis and pathogenicity factors: genetics and regulation. In Gram-positive Pathogens; Fischetti, V. A., Novick, R., Ferretti, J. J., Portnoy, D. A., Rood, J. I., Eds.; ASM Press: Washington, D.C., 2006. 106

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

(23) Kullik, I.; Giachino, P.; Fuchs, T. Deletion of the alternative sigma factor σB in Staphylococcus aureus reveals its function as a global regulator of virulence genes. J. Bacteriol. 1998, 180 (18), 4814–4820. (24) Hecker, M.; Pan
e-Farr
e, J.; V€ olker, U. SigB-dependent general stress response in Bacillus subtilis and related Gram-positive bacteria. Annu. Rev. Microbiol. 2007, 61, 215–236. (25) Cebri
an, G.; Cond
on, S.; Ma~ nas, P. Heat-adaptation induced thermotolerance in Staphylococcus aureus: Influence of the alternative factor σB. Int. J. Food Microbiol. 2009, 135 (3), 274–280. (26) Cebri
an, G.; Sagarzazu, N.; Aertsen, A.; Pag
an, R.; Cond
on, S.; Ma~ nas, P. Role of the alternative sigma factor σB on Staphylococcus aureus resistance to stresses of relevance to food preservation. J. Appl. Microbiol. 2009, 107 (1), 187–196. (27) Br€otz-Oesterhelt, H.; Beyer, D.; Kroll, H.-P.; Endermann, R.; Ladel, C.; Schroeder, W.; Hinzen, B.; Raddatz, S.; Paulsen, H.; Henninger, K.; Bandow, J. E.; Sahl, H.-G.; Labischinski, H. Dysregulation of bacterial proteolytic machinery by a new class of antibiotics. Nat. Med. 2005, 11 (10), 1082–1087. (28) Luong, T. T.; Lee, C. Y. Improved single-copy integration vectors for Staphylococcus aureus. J. Microbiol. Methods 2007, 70 (1), 186–190. (29) Koskenniemi, K.; Koponen, J.; Kankainen, M.; Savijoki, K.; Tynkkynen, S.; de Vos, W. M.; Kalkkinen, N.; Varmanen, P. Proteome analysis of Lactobacillus rhamnosus GG using 2-D DIGE and mass spectrometry shows differential protein production in laboratory and industrial-type growth media. J. Proteome Res. 2009, 8 (11), 4993–5007. (30) O’Connell, K. L.; Stults, J. T. Identification of mouse liver proteins on two-dimensional electrophoresis gels by matrix-assisted laser desorption/ionization mass spectrometry of in situ enzymatic digests. Electrophoresis 1997, 18 (3
4), 349–359. (31) Koskenniemi, K.; Laakso, K.; Koponen, J.; Kankainen, M.; Greco, D.; Auvinen, P.; Savijoki, K.; Nyman, T. A.; Surakka, A.; Salusj€arvi, T.; de Vos, W. M.; Tynkkynen, S.; Kalkkinen, N.; Varmanen, P. Proteomics and transcriptomics characterization of bile stress response in probiotic Lactobacillus rhamnosus GG. Mol. Cell. Proteomics 2011, 10 (2), M110.002741. (32) Baba, T.; Bae, T.; Schneewind, O.; Takeuchi, F.; Hiramatsu, K. Genome sequence of Staphylococcus aureus strain Newman and comparative analysis of staphylococcal genomes: polymorphism and evolution of two major pathogenicity islands. J. Bacteriol. 2008, 190 (1), 300–310. (33) Gillaspy, A. F.; Worrell, V.; Orvis, J.; Roe, B. A.; Dyer, D. W.; Landolo, J. J. The Staphylococcus aureus NCTC 8325 genome. In Grampositive Pathogens; Fischetti, V. A., Novick, R. P., Ferretti, J. J., Portnoy, D. A., Rood, J. I., Eds.; ASM Press: Washington, D.C., 2006. (34) Jelsbak, L.; Ingmer, H.; Valihrach, L.; Cohn, M. T.; Christiansen, M. H. G.; Kallipolitis, B. H.; Frees, D. The chaperone ClpX stimulates expression of Staphylococcus aureus protein A by Rot dependent and independent pathways. PLoS One 2010, 5 (9), e12752. (35) Lee, B.-G.; Park, E. Y.; Lee, K.-E.; Jeon, H.; Sung, K. H.; Paulsen, H.; R€ubsamen-Schaeff, H.; Br€otz-Oesterhelt, H.; Song, H. K. Structures of ClpP in complex with acyldepsipeptide antibiotics reveal its activation mechanism. Nat. Struct. Mol. Biol. 2010, 17 (4), 471–478. (36) Novick, R. P. Properties of a cryptic high-frequency transducing phage in Staphylococcus aureus. Virology 1967, 33 (1), 155–166. (37) Pan
e-Farr
e, J.; Jonas, B.; F€orstner, K.; Engelmann, S.; Hecker, M. The σB regulon in Staphylococcus aureus and its regulation. Int. J. Med. Microbiol. 2006, 296 (4
5), 237–258. € u, M.; Minden, J. S. Two-dimensional (38) Viswanathan, S.; Unl€ difference gel electrophoresis. Nat. Protoc. 2006, 1 (3), 1351–1358. (39) Bae, T.; Baba, T.; Hiramatsu, K.; Schneewind, O. Prophages of Staphylococcus aureus Newman and their contribution to virulence. Mol. Microbiol. 2006, 62 (4), 1035–1047. (40) Owens, R. M.; Pritchard, G.; Skipp, P.; Hodey, M.; Connell, S. R.; Nierhaus, K. H.; O’Connor, C. D. A dedicated translation factor controls the synthesis of the global regulator Fis. EMBO J. 2004, 23 (16), 3375–3385. (41) Zybailov, B.; Friso, G.; Kim, J.; Rudella, A.; Rodríguez, V. R.; Asakura, Y.; Sun, Q.; van Wijk, K. J. Large scale comparative proteomics

(4) Dreisbach, A.; Hempel, K.; Buist, G.; Hecker, M.; Becher, D.; van Dijl, J. M. Profiling the surfacome of Staphylococus aureus. Proteomics 2010, 10 (17), 3082–3096. (5) Ziebandt, A.-K.; Kusch, H.; Degner, M.; Jaglitz, S.; Sibbald, M. J. J. B.; Arends, J. P.; Chlebowicz, M. A.; Albrecht, D.; Pantucek, R.; Doskar, J.; Ziebuhr, W.; Br€oker, B. M.; Hecker, M.; van Dijl, J. M.; Engelmann, S. Proteomics uncovers extreme heterogeneity in the Staphylococcus aureus exoproteome due to genomic plasticity and variant gene regulation. Proteomics 2010, 10 (8), 1634–1644. (6) Lindsay, J. A.; Holden, M. T. G. Staphylococcus aureus: superbug, super genome? Trends Microbiol. 2004, 12 (8), 378–385. (7) Jelsbak, L.; Hemmingsen, L.; Donat, S.; Ohlsen, K.; Boye, K.; Westh, H.; Ingmer, H.; Frees, D. Growth phase-dependent regulation of the global virulence regulator Rot in clinical isolates of Staphylococcus aureus. Int. J. Med. Microbiol. 2010, 300 (4), 229–236. (8) Li, M.; Diep, B. A.; Villaruz, A. E.; Braughton, K. R.; Jiang, X.; DeLeo, F. R.; Chambers, H. F.; Lu, Y.; Otto, M. Evolution of virulence in epidemic community-associated methicillin-resistant Staphylococcus aureus. Proc. Natl. Acad. Sci. U.S.A. 2009, 106 (14), 5883–5888. (9) Herbert, S.; Ziebandt, A.-K.; Ohlsen, K.; Sch€afer, T.; Hecker, M.; Albrecht, D.; Novick, R.; G€otz, F. Repair of global regulators in Staphylococcus aureus 8325 and comparative analysis with other clinical isolates. Infect. Immun. 2010, 78 (6), 2877–2889. (10) Giachino, P.; Engelmann, S.; Bischoff, M. σB activity depends on RsbU in Staphylococcus aureus. J. Bacteriol. 2001, 183 (6), 1843–1852. (11) Horsburgh, M. J.; Aish, J. L.; White, I. J.; Shaw, L.; Lithgow, J. K.; Foster, S. J. σB modulates virulence determinant expression and stress resistance: characterization of a functional rsbU strain derived from Staphylococcus aureus 8325-4. J. Bacteriol. 2002, 184 (19), 5457–5467. (12) Oscarsson, J.; Kanth, A.; Tegmark-Wisell, K.; Arvidson, S. SarA is a repressor of hla (alpha-hemolysin) transcription in Staphylococcus aureus: its apparent role as an activator of hla in the prototype strain NCTC 8325 depends on reduced expression of sarS. J. Bacteriol. 2006, 188 (24), 8526–8533. (13) Mainiero, M.; Goerke, C.; Geiger, T.; Gonser, C.; Herbert, S.; Wolz, C. Differential target gene activation by the Staphylococcus aureus two-component system saeRS. J. Bacteriol. 2010, 192 (3), 613–623. (14) Maurizi, M. R.; Clark, W. P.; Kim, S.-H.; Gottesman, S. ClpP represents a unique family of serine proteases. J. Biol. Chem. 1990, 265 (21), 12546–12552. (15) Kessel, M.; Maurizi, M. R.; Kim, B.; Kocsis, E.; Trus, B. L.; Singh, S. K.; Steven, A. C. Homology in structural organization between E. coli ClpAP protease and the eukaryotic 26 S proteasome. J. Mol. Biol. 1995, 250 (5), 587–594. (16) Frees, D.; Savijoki, K.; Varmanen, P.; Ingmer, H. Clp ATPases and ClpP proteolytic complexes regulate vital biological processes in low GC, Gram-positive bacteria. Mol. Microbiol. 2007, 63 (5), 1285–1295. (17) Becker, G.; Klauck, E.; Hengge-Aronis, R. Regulation of RpoS proteolysis in Escherichia coli: The response regulator RssB is a recognition factor that interacts with the turnover element in RpoS. Proc. Natl. Acad. Sci. U.S.A. 1999, 96 (11), 6439–6444. (18) Zhou, Y.; Gottesman, S.; Hoskins, J. R.; Maurizi, M. R.; Wickner, S. The RssB response regulator directly targets σS for degradation by ClpXP. Genes Dev. 2001, 15 (5), 627–637. (19) Turgay, K.; Hahn, J.; Burghoorn, J.; Dubnau, D. Competence in Bacillus subtilis is controlled by regulated proteolysis of a transcription factor. EMBO J. 1998, 17 (22), 6730–6738. (20) Frees, D.; Qazi, S. N. A.; Hill, P. J.; Ingmer, H. Alternative roles of ClpX and ClpP in Staphylococcus aureus stress tolerance and virulence. Mol. Microbiol. 2003, 48 (6), 1565–1578. (21) Frees, D.; Sørensen, K.; Ingmer, H. Global virulence regulation in Staphylococcus aureus: pinpointing the roles of ClpP and ClpX in the sar/agr regulatory network. Infect. Immun. 2005, 73 (12), 8100–8108. (22) Michel, A.; Agerer, F.; Hauck, C. R.; Herrmann, M.; Ullrich, J.; Hacker, J.; Ohlsen, K. Global regulatory impact of ClpP protease of Staphylococcus aureus on regulons involved in virulence, oxidative stress response, autolysis, and DNA repair. J. Bacteriol. 2006, 188 (16), 5783–5796. 107

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108

Journal of Proteome Research

ARTICLE

of a chloroplast Clp protease mutant reveals folding stress, altered protein homeostasis, and feedback regulation of metabolism. Mol. Cell. Proteomics 2009, 8 (8), 1789–1810. (42) Bingel-Erlenmeyer, R.; Kohler, R.; Kramer, G.; Sandikci, A.; Antoli
c, S.; Maier, T.; Schaffitzel, C.; Wiedmann, B.; Bukau, B.; Ban, N. A peptide deformylase
ribosome complex reveals mechanism of nascent chain processing. Nature 2008, 452 (7183), 108–111. (43) Glanzmann, P.; Gustafson, J.; Komatsuzawa, H.; Ohta, K.; Berger-B€achi, B. glmM operon and methicillin-resistant glmM suppressor mutants in Staphylococcus aureus. Antimicrob. Agents Chemother. 1999, 43 (2), 240–245. (44) Kirstein, J.; Dougan, D. A.; Gerth, U.; Hecker, M.; Turgay, K. The tyrosine kinase McsB is a regulated adaptor protein for ClpCP. EMBO J. 2007, 26 (8), 2061–2070. (45) Genevaux, P.; Georgopoulos, C.; Kelley, W. L. The Hsp70 chaperone machines of Escherichia coli: a paradigm for the repartition of chaperone functions. Mol. Microbiol. 2007, 66 (4), 840–857. (46) Kock, H.; Gerth, U.; Hecker, M. The ClpP peptidase is the major determinant of bulk protein turnover in Bacillus subtilis. J. Bacteriol. 2004, 186 (17), 5856–5864. (47) Pamp, S. J.; Frees, D.; Engelmann, S.; Hecker, M.; Ingmer, H. Spx is a global effector impacting stress tolerance and biofilm formation in Staphylococcus aureus. J. Bacteriol. 2006, 188 (13), 4861–4870. (48) Nakano, S.; K€uster-Sch€ock, E.; Grossman, A. D.; Zuber, P. Spxdependent global transcriptional control is induced by thiol-specific oxidative stress in Bacillus subtilis. Proc. Natl. Acad. Sci. U.S.A. 2003, 100 (23), 13603–13608. (49) Staphylococci in Human Disease; Crossley, K. B., Jefferson, K. K., Archer, G. L., Fowler, V. G., Jr., Eds.; Blackwell Publishing Ltd: West Sussex, U.K., 2009. (50) Luong, T. T.; Dunman, P. M.; Murphy, E.; Projan, S. J.; Lee, C. Y. Transcription profiling of the mgrA regulon in Staphylococcus aureus. J. Bacteriol. 2006, 188 (5), 1899–1910. (51) Smith, E. J.; Visai, L.; Kerrigan, S. W.; Speziale, P.; Foster, T. J. The Sbi protein is a multifunctional immune evasion factor of Staphylococcus aureus. Infect. Immun. 2011, 79 (9), 3801–3809. (52) Zellmeier, S.; Schumann, W.; Wiegert, T. Involvement of Clp protease activity in modulating the Bacillus subtilis σW stress response. Mol. Microbiol. 2006, 61 (6), 1569–1582. (53) Geisinger, E.; Adhikari, R. P.; Jin, R.; Ross, H. F.; Novick, R. P. Inhibition of rot translation by RNAIII, a key feature of agr function. Mol. Microbiol. 2006, 61 (4), 1038–1048. (54) Boisset, S.; Geissmann, T.; Huntzinger, E.; Fechter, P.; Bendridi, N.; Possedko, M.; Chevalier, C.; Helfer, A. C.; Benito, Y.; Jacquier, A.; Gaspin, C.; Vandenesch, F.; Romby, P. Staphylococcus aureus RNAIII coordinately represses the synthesis of virulence factors and the transcription regulator Rot by an antisense mechanism. Genes Dev. 2007, 21 (11), 1353–1366. (55) Chen, P. R.; Nishida, S.; Poor, C. B.; Cheng, A.; Bae, T.; Kuechenmeister, L.; Dunman, P. M.; Missiakas, D.; He, C. A new oxidative sensing and regulation pathway mediated by the MgrA homologue SarZ in Staphylococcus aureus. Mol. Microbiol. 2009, 71 (1), 198–211. (56) Chen, P. R.; Bae, T.; Williams, W. A.; Duguid, E. M.; Rice, P. A.; Schneewind, O.; He, C. An oxidation-sensing mechanism is used by the global regulator MgrA in Staphylococcus aureus. Nat. Chem. Biol. 2006, 2 (11), 591–595. (57) Tegmark, K.; Karlsson, A.; Arvidson, S. Identification and characterization of SarH1, a new global regulator of virulence gene expression in Staphylococcus aureus. Mol. Microbiol. 2000, 37 (2), 398–409. (58) Ingavale, S.; van Wamel, W.; Luong, T. T.; Lee, C. Y.; Cheung, A. L. Rat/MgrA, a regulator of autolysis, is a regulator of virulence genes in Staphylococcus aureus. Infect. Immun. 2005, 73 (3), 1423–1431. (59) Geuskens, V.; Mhammedi-Alaoue, A.; Desmet, L.; Toussanint, A. Virulence in bacteriphage Mu: a case of trans-dominant proteolysis by the Escherichia coli Clp serine protease. EMBO J. 1992, 11 (13), 5121– 5127.

(60) Wojtkowiak, D.; Georgopoulos, C.; Zylicz, M. Isolation and characterization of ClpX, a new ATP-dependent specificity component of the Clp protease of Escherichia coli. J. Biol. Chem. 1993, 268 (30), 22609–22617. (61) Lehnherr, H.; Yarmolinsky, M. B. Addiction protein Phd of plasmid prophage P1 is a substrate of the ClpXP serine protease of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1995, 92 (8), 3274–3277. (62) Somerville, G. A.; Proctor, R. A. At the crossroads of bacterial metabolism and virulence factor synthesis in staphylococci. Microbiol. Mol. Biol. Rev. 2009, 73 (2), 233–248. (63) Dyke, K. G. H.; Jevons, M. P.; Parker, M. T. Penicillinase production and intrinsic resistance to penicillins in Staphylococcus aureus. Lancet 1966, 1 (7442), 835–838. (64) Duthie, E. S.; Lorenz, L. L. Staphylococcal coagulase: mode of action and antigenicity. J. Gen. Microbiol. 1952, 6 (1
2), 95–107. (65) Somerville, G. A.; Beres, S. B.; Fitzgerald, J. R.; DeLeo, F. R.; Cole, R. L.; Hoff, J. S.; Musser, J. M. In vitro serial passage of Staphylococcus aureus: changes in physiology, virulence factor production, and agr nucleotide sequence. J. Bacteriol. 2002, 184 (5), 1430–1437. (66) Christensen, W. B. Urea decomposition as a means of differentiating Proteus and paracolon cultures from each other and from Salmonella and Shigella types. J. Bacteriol. 1946, 52 (4), 461–466.

108

dx.doi.org/10.1021/pr200956s |J. Proteome Res. 2012, 11, 95–108