New Surface Capacitive Touchscreen Technology To Detect DNA

Institute of Science and Technology (KAIST), 291, Daehak-ro, Yuseong-gu, Daejeon 305-701, Republic of Korea ... Publication Date (Web): March 11, ...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/acssensors

New Surface Capacitive Touchscreen Technology To Detect DNA Byoung Yeon Won, Jun Ki Ahn, and Hyun Gyu Park* Department of Chemical and Biomolecular Engineering (BK21+ program), Korea Advanced Institute of Science and Technology (KAIST), 291, Daehak-ro, Yuseong-gu, Daejeon 305-701, Republic of Korea S Supporting Information *

ABSTRACT: A new surface capacitive touchscreen technology to detect DNA has been developed. In this approach, advantage is taken of the fact that a signal location is determined by the relative conductivities of touching materials at two points that are simultaneously touched. In the system, buffer and target-specific probe solutions are first applied to two separate positions on the touch panel. The target DNA sample is then applied to both positions. Based on the fact that the electrical conductivity of ssDNA is different from that of dsDNA, a hybridization taking place between the probe and target DNA can be identified by determining the location of the resulting touching signal. A mathematical treatment was employed to model the new detecting principle. By using equations derived from this treatment, the experimental results were correctly estimated. Because the new technology utilizes a simple touchscreen, it should be applicable to the development of POCT or personalized medical devices. KEYWORDS: analytical methods, biosensors, capacitance, DNA detection, touchscreen

T

which could be utilized in the place of current spectrophotometric balances such as Nanodrop.4 In the current extension of our earlier work, we designed a novel method to detect specific target DNA molecules, which relies on the use of a surface capacitive touchscreen. A unique feature of the surface capacitive touchscreen is that a path exists for flow of a small electric current from the touchscreen to the ground via an intervening conducting material. This flow is activated when grounded conducting material, like parts of a human body, touches the touch panel. The amount of induced current or resistance is detected by the touchscreen controller and the location of the touch is determined by calculating distances between the touching point and electrodes at the four corners of the touch panel. In this way, the touchscreen recognizes a single touching point caused by a single touching event. However, when two points on the surface capacitive touchscreen are simultaneously touched, the controller produces a signal at an in-between location as the touching point. Moreover, the location of the signal in between the two touching points varies in a manner that is dependent on the conductivities of the materials deposited at each touching point, being closer to the location of the sample with higher conductivity.

he development of rapid and simple detection systems that can be employed in point-of-care testing (POCT) and decentralized clinical diagnostics has received intense interest recently. Moreover, attention has been given to the design of miniaturized detection instruments, which rely on spectrophotometers or SPR analyzers, for use in hand-held or portable systems.1 Another approach to the development of future diagnostic systems focuses on U-healthcare, which enables the delivery of instantaneous medical care by merging the medical office and living space in a virtual manner. For this purpose, considerable effort has been devoted to strategies that merge BT (biotechnology) and ICT (information and communications technology) and, specifically, to the design of ICT-combined miniaturized diagnostic systems that can be employed for on-site detection of disease markers.2 In recent studies guided by this goal, we designed a biomolecular detection platform that utilizes a capacitive touchscreen which is widely used in current smart mobile devices.3 By utilizing a device based on a small and inexpensive touchscreen, we were able to quantify DNA as a model target biomolecule. The results of this effort suggested that a touchscreen could serve as a novel transducer to design a convenient, cost-effective, and ICT-combined diagnostic systems. In the initial study, we showed that the novel touchscreen based system displays the same performance level for quantitatively assaying purified nonspecific DNA as the currently used absorption spectroscopy based method. This observation shows that touchscreen based approaches should be applicable to the design of electrical nano/microbalance © XXXX American Chemical Society

Received: January 19, 2016 Accepted: March 11, 2016

A

DOI: 10.1021/acssensors.6b00040 ACS Sens. XXXX, XXX, XXX−XXX

Article

ACS Sensors

■

MATERIAL AND METHODS

Genomic DNA Isolation. A 30 mL sample of a urine specimen, collected from a patient infected by Chlamydia trachomatis after prostatic massage, was centrifuged at 14 000 g for 2 min. The centrifuged pellet was then washed twice with 1 mL of PBS (0.2 M phosphate, 1.5 M sodium chloride, pH 7.4) and resuspended in 400 μL of PBS. Genomic DNA was extracted by using an Accuprep Genomic DNA Extraction Kit (Bioneer, Korea) according to the manufacturer’s protocol and was stored at −20 °C until use. Preparation of Target and Capture Probe DNA. Amplification of a specific site of Chlamydia trachomatis gene encoding virulence protein was performed on a PTC-0200 (Biorad, Hercules, CA) thermocycler in a 50 μL solution containing 1 μL of template, 5 μL of 10× PCR reaction buffer (500 mM Tris-HCl, 100 mM KCl, 50 mM (NH4)2SO4, 20 mM MgCl2), 0.2 mM dNTPs, and 1.25 U i-StarMAX II DNA polymerase. To amplify the single-stranded PCR product, different amounts of the forward and reverse primers (forward: 5′CCATCTTCTTTGAAGCGTTGT and reverse: 5′-ACAGGATGACTCAAGGAATAG) were introduced in the PCR mixture. To produce single-stranded target DNA, 50 pmol forward primer and 0.5 pmol reverse primer were used while 0.5 pmol forward primer and 50 pmol reverse primer were used to produce capture probe DNA. PCR was programmed for 4 min at 95 °C, followed by 35 cycles of 30 s at 95 °C, 30 s at 55 °C, and 1 min at 72 °C, and finalized for 7 min at 72 °C. The resulting 612-base-long single-stranded PCR product was confirmed by gel electrophoresis. The products separated on the gel (Figure S1, line b) were collected and purified with NucleoSpin (Macherey-Nagel, Duren, Germany) gel extraction kit, and were used as probe or target DNAs in this work. Target DNA Detection Procedure. On a surface capacitive touchscreen system (ESCAP7000, eGALAX_eMPIA technology, Taipei, Taiwan), 5 μL of buffer solution (50 mM PBS) and capture probe solution (40 ng/μL in 50 mM PBS) were applied at two fixed positions A and B in Figure 3. Then, 5 μL of target DNA solutions of various concentrations (10−100 ng/μL) were applied at both A and B positions. The samples were covered with an ITO-coated cover glass connected with conducting wire. By touching the conducting wire with a finger, the touching signal appears on the display. The length (x) from the position A of buffer solution to the signal location was measured as a pixel unit on the display, which was then used to determine the amount of DNA molecules as described in the manuscript.

■

Figure 1. Schematic illustration of the DNA detection system based on the location of a touching signal produced by current through samples at positions A and B.

RESULTS AND DISCUSSION

In order to design a selective DNA detection system that utilizes the operational features of a surface capacitive touchscreen, the relationship between the conductivities of two touching materials on the panel and the location of the signal produced between the touching points must first be elucidated. For this purpose, two DNA samples with different concentrations were applied at two positions (A and B) on the touch panel. The assumption was that the conductivities of DNA solutions would be proportional to their concentration. A transparent ITO (indium tin oxide) layer was then placed above the touch panel so that it could come into contact with the DNA samples (Figure 1). Thus, upon touching the ITO layer with a finger, current flowed from the touch panel to the finger through the two samples and, consequently, a touch signal was generated on the display. The location of the signal (L), defined as the ratio of the distance from position A to the signal (x) to that from position A to B (y) (Figure 2a) was recorded. By assuming that the concentration ratio of the solutions at positions A and B would be the same as the ratio (CA/CB) of conductivities of the respective samples at these positions, a plot of signal location (L) as a function of CA/CB was created (Figure 2b). By utilizing a plot fitting routine, we

Figure 2. Relationships between the touch signal location and the conductivity ratio of two DNA samples at positions A and B. x and y are distances from positions A to the signal location and position B, respectively (a). Plot of the signal location as a function of the conductivity ratio between the two samples at positions A and B (b). Signal locations observed for two sample solutions of single-stranded probe and single-stranded target DNA (c), single-stranded target and double-stranded target DNA (d), and buffer and single-stranded probe DNA (e).

B

DOI: 10.1021/acssensors.6b00040 ACS Sens. XXXX, XXX, XXX−XXX

Article

ACS Sensors obtained the general relationship given in eq 1 that correlates the signal location and the conductivities of the two samples at positions A and B.

The location of the signal (L) was determined in this case to be 0.76, which by using eq 1 gives CA/CB = 0.46. Because a known amount (200 ng) of probe DNA (Wp) was used in this experiment, eq 5 (where α = 172) then correlates the conductivities of single-stranded probe DNA and buffer solution. By inserting eqs 2 and 5 into eq 3, we obtain eq 6 (where β = 1.60), which expresses the relationship between the specific conductivities of ssDNA and dsDNA.

L = x /y = {1.42 − 0.29(CA /C B)}/{1.24 + 1.01(CA /C B)} (1)

In order to apply the surface capacitive touchscreen strategy to target DNA detection, information was required about the effect of the hybridization of single-stranded target DNA with probe DNA on conductivity. For this purpose, the relative conductivities of several components of the samples utilized in this system were determined by employing eq 1 and measured signal locations for various component pair combinations (Figure 2c−e). In the experiments, probe and target DNAs were prepared through asymmetric PCR with a C. trachomatis template DNA by regulating the amount of forward and reverse primers. Following their purification employing the gel extraction technique, the ssDNA products (612 bases) resulting from F-primer excess case and R-primer excess case were used as probe and target DNA, respectively. In the first measurement (Figure 2c), the same amount of probe and target DNAs was applied to positions A and B, respectively. After addition of the ITO layer, simultaneous touching at A and B positions generated a signal located between the positions. By determining the number of pixels between position A and the signal location and fixing the distance (y) between positions A and B at 850 pixels, we found that the touch signal (Figure 2c) is produced at the exact midpoint between positions A and B (L = 0.5). Based on the general relationship embodied in eq 1, the result demonstrates that the specific conductivities (D), defined as the conductivity per nanogram of DNA, of same sized (612 bases) complementary probe (Dp,s) and target (Dt,s) DNAs are identical (eq 2).

Dt,s = Dp,s

Dt,ds = βDp,s

(6)

(2)

Figure 3. Schematic illustration of the detection of single-stranded target DNA on the surface capacitive touchscreen.

this system, 5 μL each of a buffer solution (blank) and a targetspecific probe solution are first applied at respective A and B positions on the surface capacitive touchscreen. Then, 5 μL of an unknown target sample is introduced at both positions. After target addition, the solution at position A contains only singlestranded target DNA (Wt,total) while that at position B could contain single-stranded probe DNA (Wp,s), single-stranded target DNA (Wt,s), and hybridized double-stranded target DNA (Wt,ds). As a result, the final conductivities of the solutions at positions A and B can be expressed as eqs 7 and 8, respectively, where Dp,s, Dt,s, and Dt,ds are specific conductivities of singlestranded probe DNA, single-stranded target DNA, and doublestranded target DNA, respectively.

(3)

Because we are only interested in the change in conductivity of ssDNA caused by hybridization between probe and target DNAs to form dsDNA, another experiment was carried out to eliminate E from eq 3. This was accomplished by applying buffer and probe solutions (Wp) to positions A and B, respectively (Figure 2e). The conductivity ratio (CA/CB) then can be expressed by the relationship given in eq 4, where Dp,s is the specific conductivity of single-stranded probe DNA. CA /C B = E /(WpDp,s + E)

(5)

The mathematical treatments presented above enable all of the relationships between the conductivities of single-stranded probe DNA, single-stranded target DNA, double-stranded hybridized target DNA, and buffer solution to be expressed in terms of a single conductivity of single-stranded probe DNA by using eqs 2, 5, and 6. From the information gained for the conductivities of DNA and by utilizing these equations to correlate the location of a touching signal to the conductivity of a sample solution, we were able to design a new system to detect single-stranded target DNA (Figure 3). In an assay using

A similar experiment was performed to elucidate the conductivity differences between ssDNA and dsDNA. For this purpose, the same amount of single-stranded target DNA (Wt,s) and double-stranded target DNA (Wt,ds) hybridized with probe DNA was applied to positions A and B, respectively (Figure 2d). The location of the touching signal L in this case (L = 0.6 and CA/CB = 0.75, Figure 2d) was closer to position B, indicating that the conductivity of dsDNA is higher than that of ssDNA. Based on the assumption that the results can be mathematically treated as a simple multicomponent subsystem, the conductivity ratio (CA/CB) can be expressed in terms of the concentrations and specific conductivities of the DNA samples, as shown in eq 3, where Dt,s, and Dt,ds are specific conductivities of single-stranded and double-stranded target DNA, respectively, and E is the conductivity of the buffer solution.5 CA /C B = (Wt,sDt,s + E)/(Wt,dsDt,ds + E) = 0.75

E = αDp,s

CA = Wt,totalDt,s + E

(7)

C B = Wp,sDp,s + Wt,sDt,s + Wt,dsDt,ds + E

(8)

Simple mathematical manipulations can be carried out to reduce the number of the variables in the eqs 7 and 8 corresponding to the amounts of the DNA components. The applied amount of target DNA (Wt,total) is the sum of half the

(4) C

DOI: 10.1021/acssensors.6b00040 ACS Sens. XXXX, XXX, XXX−XXX

Article

ACS Sensors

By substituting Wt,total with X in eqs 14 and 18, we generate eqs 19 and 20 which give the relationships between the amount of target DNA (X) and the conductivity ratios of the samples at positions A and B.

amount of hybridized double-stranded target (Wt,ds/2) and the amount of unhybridized single-stranded target (Wt,s) (eq 9). Wt,total = Wt,ds/2 + Wt,s

(9)

Similarly, the total amount of probe (Wp,total) is the sum of the amounts of hybridized double-stranded probe (Wp,ds) and unhybridized single-stranded probe (Wp,s). Since hybridization forming double-stranded DNA takes place between probe DNA and target DNA, Wp,ds = Wt,ds and eq 9 becomes eq 10. Wp,total = Wp,ds/2 + Wp,s = Wt,ds/2 + Wp,s

CA /C B = (X + 172)/{372 + (1 + 1.2h)X } (Wt,total ≤ Wp,total) CA /C B = (X + 172)/{372 + 240h + X } (Wt,total ≥ Wp,total)

(10)

and

Wt,ds = 2hWt,total

(20)

Finally, through insertion of eqs 19 and 20 into eq 1, final equations are produced that express predicted locations of the touching signal (L) as a function of the amount of target DNA applied on the surface capacitive touchscreen. Plots of signal locations (L) versus concentrations of target DNA applied on the surface capacitive touchscreen, generated by using the mathematical expression, are displayed as dashed−dotted lines in Figure 4. Line “a” in Figure 4 represents the case when h =

Further analysis was carried out by considering situations in which the amount of target applied is less or more than that of probe at position B. In the first case where the amount of target in the analyte sample is less than that of the probe at the position B (Wt,total ≤ Wp,total), we can utilize factor h to represent the hybridization efficiency between the probe and target DNAs as shown in eq 11. Wt,ds/2Wt,total = h

(19)

(11)

Here, h is 1 when all of the applied target DNA is hybridized with the probe DNA. On the other hand, h is zero when none of target DNA is hybridized with probe DNA. Introduction of factor h changes eqs 9 and10 to eqs 12 and 13. Wt,s = Wt,total − Wt,ds/2 = (1 − h)Wt,total

(12)

Wp,s = Wp,total − Wt,ds/2 = Wp,total − hWt,total

(13)

Based on eqs 11, 12, and 13, Wp,s, Wt,s, and Wt,ds can be expressed by a single variable, Wt,total, when the amount of probe DNA (Wp,total) is set at 200 ng. Finally, by integrating the relationships for the conductivities (eqs 2, 5, and 6) and the amounts of the DNA components (eq 11, 12, and 13) into eqs 7 and 8, the conductivity ratio can be expressed as eq 14. CA /C B = (Wt,totalDp,s + 172Dp,s) /(Wp,sDp,s + Wt,sDp,s + 1.6Wt,dsDp,s

Figure 4. Plots of signal location (L) versus target DNA concentration applied on the surface capacitive touchscreen. The dashed−dotted lines are generated by using the mathematical treatment where no hybridization (line a) and perfect hybridization (line b) take place. The experimental data were obtained by employing noncomplementary target (○) and perfectly matched target (•). A 10 μL detection volume was employed by adding 5 μL target sample to the 5 μL probe solution. The dotted line at 200 ng of target DNA is the boundary between the two situations (Wt,total ≤ Wp,total and Wt,total ≥ Wp,total).

+ 172Dp,s) = (Wt,total + 172)/{372 + (1 + 1.2h)Wt,total}

(14)

In the second case where target DNA applied is more than that of the probe DNA at position B (Wt,total ≥ Wp,total) the factor h is defined by eq 15, and the amounts of single-stranded target (Wt,s) and probe (Wp,s) are expressed by eqs 16 and 17. Wt,ds/2Wp,total = h

and

Wt,ds = 2hWp,total

(15)

Wt,s = Wt,total − Wt,ds/2 = Wt,total − hWp,total

(16)

Wp,s = Wp,total − Wt,ds/2 = (1 − h)Wp,total

(17)

zero, that is, when no hybridized DNA exists because the applied sample does not contain sequence-specific target DNA. On the other hand, line b in this figure corresponds to the situation where h = 1, meaning that the applied DNA perfectly matches that of the probe. In order to demonstrate the validity of the mathematical treatment described, locations of signals created by application of various concentrations of target DNA, obtained by amplification using asymmetric PCR, were determined experimentally. A plot of the data obtained in experiments using target DNA (● in Figure 4) was found to overlay with one generated by using the mathematical treatment (dashed− dotted line b in Figure 4) for the perfectly matched scenario (Figure 4). Also, the plot of data arising from an experiment using nonspecific target DNA (○) also nearly matches the

In a similar manner, inserting eqs 2, 5, 6, 15, 16, and 17 into eqs 7 and 8 gives eq 18 that expresses the conductivity ratio (CA/CB) in terms of the single variable, Wt,total. CA /C B = (Wt,totalDp,s + 172Dp,s) /(Wp,sDp,s + Wt,sDp,s + 1.6Wt,dsDp,s + 172Dp,s) = (Wt,total + 172)/{372 + 240h + Wt,total}

(18) D

DOI: 10.1021/acssensors.6b00040 ACS Sens. XXXX, XXX, XXX−XXX

Article

ACS Sensors mathematically derived line “a” that corresponds to no hybridization. The results clearly show that the surface capacitive touchscreen strategy is applicable to the design of a new method to determine the amount of sequence-specific target DNA and/or distinguish complementary target DNA from noncomplementary counterparts.

Bioelectron. 2002, 17, 573−584. (c) Couture, M.; Zhao, S. S.; Masson, J. F. Modern surface plasmon resonance for bioanalytics and biophysics. Phys. Chem. Chem. Phys. 2013, 15, 11190−11216. (d) Capitan-Vallvey, L. F.; Palma, A. J. Recent developments in handheld and portable optosensing-A review. Anal. Chim. Acta 2011, 696, 27−46. (e) Shin, Y. B.; Kim, H. M.; Jung, Y.; Chung, B. H. A new palm-sized surface plasmon resonance (SPR) biosensor based on modulation of a light source by a rotating mirror. Sens. Actuators, B 2010, 150, 1−6. (f) Preechaburana, P.; Gonzalez, M. C.; Suska, A.; Filippini, D. Surface plasmon resonance chemical sensing on cell phone. Angew. Chem., Int. Ed. 2012, 51, 11585−11588. (2) (a) Martinez, A. W.; Phillips, S. T.; Carrilho, E.; Thomas, S. W.; Sindi, H.; Whitesides, G. M. Simple Telemedicine for Developing Regions: Camera Phones and Paper-Based Microfluidic Devices for Real-Time, Off-Site Diagnosis. Anal. Chem. 2008, 80, 3699−3707. (b) Zhu, H.; Mavandadi, S.; Coskun, A. F.; Yaglidere, O.; Ozcan, A. Optofluidic fluorescent imaging cytometry on a cell phone. Anal. Chem. 2011, 83, 6641−6647. (c) Zhu, H.; Sikora, U.; Ozcan, A. Quantum dot enabled detection of Escherichia coli using a cell-phone. Analyst 2012, 137, 2541−2544. (d) Zhu, H.; Sencan, I.; Wong, J.; Dimitrov, S.; Tseng, D.; Nagashima, K.; Ozcan, A. Cost-effective and rapid blood analysis on a cell-phone. Lab Chip 2013, 13, 1282−1288. (e) Tseng, D.; Mudanyali, O.; Oztoprak, C.; Isikman, S. O.; Sencan, I.; Yaglidere, O.; Ozcan, A. Lensfree microscopy on a cellphone. Lab Chip 2010, 10, 1787−1792. (f) Gallegos, D.; Long, K. D.; Yu, H.; Clark, P. P.; Lin, Y.; George, S.; Nath, P.; Cunningham, B. T. Label-free biodetection using a smartphone. Lab Chip 2013, 13, 2124−2132. (g) Mudanyali, O.; Dimitrov, S.; Sikora, U.; Padmanabhan, S.; Navruz, I.; Ozcan, A. Integrated rapid-diagnostic-test reader platform on a cellphone. Lab Chip 2012, 12, 2678−2686. (h) Kadlec, M. W.; You, D.; Liao, J. C.; Wong, P. K. A cell phone-based microphotometric system for rapid antimicrobial susceptibility testing. J. Lab. Autom. 2014, 19, 258−266. (i) Wang, Q.; Wang, H.; Yang, X.; Wang, K.; Liu, F.; Zhao, Q.; Liu, P.; Liu, R. Multiplex detection of nucleic acids using a low cost microfluidic chip and a personal glucose meter at the pointof-care. Chem. Commun. 2014, 50, 3824−3826. (j) Giavazzi, F.; Salina, M.; Ceccarello, E.; Ilacqua, A.; Damin, F.; Sola, L.; Chiari, M.; Chini, B.; Cerbino, R.; Bellini, T.; Buscaglia, M. A fast and simple label-free immunoassay based on a smartphone. Biosens. Bioelectron. 2014, 58, 395−402. (k) Xiang, Y.; Lu, Y. Using personal glucose meters and functional DNA sensors to quantify a variety of analytical targets. Nat. Chem. 2011, 3, 697−703. (l) Ma, X.; Chen, Z.; Zhou, J.; Weng, W.; Zheng, O.; Lin, Z.; Guo, L.; Qiu, B.; Chen, G. Aptamer-based portable biosensor for platelet-derived growth factor-BB (PDGF-BB) with personal glucose meter readout. Biosens. Bioelectron. 2014, 55, 412− 416. (m) Won, B. Y.; Shin, S.; Cho, D. Y.; Park, H. G. A one-step, electrochemical biosensing strategy that is based on transport of signaling CdS nanoparticles controlled by biomolecules. Biosens. Bioelectron. 2013, 42, 603−607. (n) Won, B. Y.; Shin, S.; Fu, R.; Cho, D. Y.; Park, H. G. A one-step electrochemical method for DNA detection that utilizes a peroxidase-mimicking DNAzyme amplified through PCR of target DNA. Biosens. Bioelectron. 2011, 30, 73−77. (o) Won, B. Y.; Shin, S.; Baek, S.; Jung, Y. L.; Li, T.; Shin, S. C.; Cho, D. Y.; Lee, S. B.; Park, H. G. Investigation of the signaling mechanism and verification of the performance of an electrochemical real-time PCR system based on the interaction of methylene blue with DNA. Analyst 2011, 136, 1573−1579. (p) Honrado, C.; Dong, T. A Capacitive Touch Screen Sensor for Detection of Urinary Tract Infections in Portable Biomedical Devices. Sensors 2014, 14, 13851− 13862. (3) Won, B. Y.; Park, H. G. A touchscreen as a biomolecule detection platform. Angew. Chem., Int. Ed. 2012, 51, 748−751. (4) http://www.nanodrop.com. (5) Anderko, A.; Lencka, M. M. Computation of electrical conductivity of multicomponent aqueous systems in wide concentration and temperature ranges. Ind. Eng. Chem. Res. 1997, 36, 1932− 1943. (6) https://www.qiagen.com.

■

CONCLUSIONS The key concept, which was used advantageously in the design of the new technique for DNA detection, is that ssDNA and dsDNA hybridized with target DNA show different electric conductivities on a surface capacitive touchscreen. Simple mathematical manipulations were used to derive equations that correlate the amount of target DNA undergoing sequencespecific target hybridization with the location of a signal on the touchscreen. It should be noted that the detection principle of our system is based on the conductivity difference between the single stranded DNA and double stranded DNA and there should be no interfering component present in the sample which might affect the electrical properties of DNA solution. Therefore, the samples should be purified to eliminate the interfering components prior to the touchscreen-based analysis, which might be a limitation for the practical application of this method. However, the purification step can be simply accomplished by employing currently commercialized technique6 and there have been great efforts devoted to develop the miniaturized technique for sample preparation.7 By integrating those techniques, our method could realize new ICT-combined diagnostic systems in a POCT manner because this technology can be directly integrated into touchscreen-equipped smart phones and smart pads.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssensors.6b00040. Gel image after asymmetric PCR (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel: +82-42-350-3932. Fax: +8242-350-3910. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This investigation was financially supported by BioNano Health-Guard Research Center funded by the Ministry of Science, ICT & Future Planning (MSIP) of Korea as Global Frontier Project (Grant Number H-GUARD_2013M3A6B2078964) and by Basic Science Research Program through the NRF funded by the Ministry of Education (No. 2015R1A2A1A01005393).

■

REFERENCES

(1) (a) Robertson C. W. Liquid photometer using surface tension to contain sample; US Patent No. 6,809,826 B2, 2002, . (b) Naimushin, A. N.; Soelberg, S. D.; Nguyen, D. K.; Dunlap, L.; Bartholomew, D.; Elkind, J.; Melendez, J.; Furlong, C. E. Detection of Staphylococcus aureus enterotoxin B at femtomolar levels with a miniature integrated two-channel surface plasmon resonance (SPR) sensor. Biosens. E

DOI: 10.1021/acssensors.6b00040 ACS Sens. XXXX, XXX, XXX−XXX

Article

ACS Sensors (7) (a) Reinholt, S. J.; Baeumner, A.; Microfluidic, J. Microfluidic Isolation of Nucleic Acids. Angew. Chem., Int. Ed. 2014, 53, 13988− 14001. (b) Strohmeier, O.; Keller, M.; Schwemmer, F.; Zehnle, S.; Mark, D.; von Stetten, F.; Zengerle, R.; Paust, N. Centrifugal microfluidic platforms: advanced unit operations and applications. Chem. Soc. Rev. 2015, 44, 6187−6229. (c) Golden, A. L.; Battrell, C. F.; Pennell, S.; Hoffman, A. S.; Lai, J. J.; Stayton, P. S. Simple fluidic system for purifying and concentrating diagnostic biomarkers using stimuli-responsive antibody conjugates and membranes. Bioconjugate Chem. 2010, 21, 1820−1826.

F

DOI: 10.1021/acssensors.6b00040 ACS Sens. XXXX, XXX, XXX−XXX