Novel Cell Adhesive Glycosaminoglycan-binding Proteins of

Hsinchu 30013, Taiwan, Republic of China. Received April 2 ... evolved to use GAGs as part of their strategy to invade host cells. ... proteins were i...
1 downloads 0 Views 255KB Size
Download PDF
Biomacromolecules 2004, 5, 2160-2164

2160

Novel Cell Adhesive Glycosaminoglycan-binding Proteins of Japanese Encephalitis Virus Suh-Chin Wu,* Jeng-Ru Chiang, and Cheng-Wen Lin Institute of Biotechnology, Department of Life Science, National Tsing Hua University, Hsinchu 30013, Taiwan, Republic of China Received April 2, 2004; Revised Manuscript Received July 14, 2004

Glycosaminoglycans (GAGs) are present in the extracellular matrix and/or tissue cell surface and, by binding to specified GAG-binding proteins, control many important cellular functions. Some animal viruses had evolved to use GAGs as part of their strategy to invade host cells. In this study, two putative GAG-binding proteins were identified from the E protein sequence of the live-attenuated strain CH2195LA of Japanese encephalitis virus (JEV): (i) the first GAG-binding region at residues from E-279 to E-297 (279KLTSGHLKCRLKMDKLALK297) and (ii) the second GAG-binding region at residues from E-397 to E-416 (397KAGSTLGKAFFSTTLKGAQR416). Four recombinant proteins with or without these two GAG-binding regions were expressed in Escherichia coli and purified to examine their GAG-binding properties. The first GAG binding region was demonstrated to exhibit a higher affinity in heparin-Sepharase column. Dosedependent increases of BHK-21 cell binding were also demonstrated by cell binding enzyme-linked immunosorbent assay (ELISA). Immobilized on glass coverslips, the GAG-binding recombinant protein of JEV promoted BHK-21 cell adhesion and proliferation. The present studies demonstrate the recombinant GAG-binding proteins of JEV stimulate cell adhesive and proliferation with a potential for applications in tissue engineering. 1. Introduction Glycosaminoglycans (GAGs) are linear sulfated polysaccharides consisting of a repeating disaccharide unit of uronic acid (or galactose) and hexosamines. Different forms of GAGs exist, including heparin, heparan sulfate, chondroitin sulfate, dermatan sulfate, and keratan sulfate. These different forms of GAGs are present in the extracellular matrix (ECM) and/or tissue cell surface, and by binding to GAG-binding proteins, they control cell adhesion, growth and differentiation, modulation of growth factor activities, maintenance of ECM integrity, and cytokine functions.1 One type of these GAG-binding proteins is the adhesive matrix proteins, which include fibronectin, vitronectin, laminin, collagens, and thrombospondin.1 Recently, the recombinant forms of the adhesive matrix proteins have been obtained in Escherichia coli, yeast, and animal cells to produce human collagen,2 fibronectin,3 vitronectin,4 and laminin.5 Recombinant proteins provide the advantages of an unlimited source for large-scale preparation and offer an enhanced safety profile of these materials to be used for medical treatments. Animal viruses infect the host cells through binding to the cellular receptors of proteins, carbohydrates, or lipids, often in complex cell-surface matrix structures.6 It has been reported that some animal viruses had evolved to use GAGs as part of their strategy to invade host cells.7 Such examples include herpes simplex virus,8,9 picornaviruses,10 human immunodeficiency virus,11 respiratory syncytial virus,12 and dengue virus.13 It is likely that the viral proteins have evolved * Corresponding author: fax 886-3-5715934; e-mail [email protected].

to display a GAG-binding property by spatially mimickry of host cell components present in ECMs (i.e., adhesive matrix proteins) in order to trigger the uptake of virus particles. Therefore, studying the viral GAG-binding proteins may provide useful information that may be applicable to the design of novel ECM materials in tissue engineering. In this study, we identified two GAG-binding fragments from the E protein of Japanese encephalitis virus (JEV). We expressed four recombinant proteins, rE261-420, rE261-402, rE292-420, and rE292-402, in E. coli and purified them through the C-terminal six-histidine fusion tag of the recombinant proteins by immunoblized metal affinity chromatography (IMAC). The GAG-binding properties of these four recombinant proteins were investigated by use of a heparinSepharose column, cell binding enzyme-linked immunsorbent assay (ELISA) to formalin-fixed BHK-21 cells and studies on cell adhesion and proliferation on coated glass coverslips. Our studies indicated that the GAG-binding proteins of JEV can be used as cell substrate coating to promote cell adhesion and proliferation in culture. 2. Materials and Methods 2.1. Viruses and Cells. The JEV live-attenuated strain CH2195LA was selected from a wild-type Taiwanese isolate.14 The virus was propagated in Vero cells in M199 medium (Invitrogen, Life Technologies) with 10% fetal bovine serum (FBS). BHK-21 cells used for cell binding and infectivity assays were cultured in modified Eagle medium (MEM) with 10% FBS. Hybridoma cell E3.3, producing

10.1021/bm0498068 CCC: $27.50 © 2004 American Chemical Society Published on Web 10/15/2004

Cell Adhesive GAG-Binding Protein of JEV

Biomacromolecules, Vol. 5, No. 6, 2004 2161

Figure 1. Two putative GAG-binding regions located in JEV E protein. (A) Amino acid sequence of the JEV E protein (CH2195LA strain, GenBank Accession Number U92644) in the region of residues E261-E420. Positively charged residues are indicated in boldface type, and two predicted GAG-binding regions are underlined. (B) Delineation of the constructs for the four recombinant protein fragments containing both or each of the two GAG-binding regions.

monoclonal antibody (mAb) E3.3 specific to the domain III of the JEV E protein,14,15 was grown in Iscove’s modified Dulbecco’s medium (Invitrogen) with 10% FBS. 2.2. Construction, Expression, IMAC Purification, and Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis of Recombinant Proteins. The full-length E protein gene of the JEV strain CH2195LA (GenBank Accession Number U92644) was amplified with reverse transcriptase-polymerase chain reaction (RT-PCR) and thereafter cloned into pUC18 vector as described in our previous report.14 The cDNAs of four recombinant proteins (rE261-420, rE261-402, rE292-420, and rE292-420) were amplified by PCR with pairs of following primers: E261forward 5′ATGCGCGGATCCGGGCCTCCATCAGGCGCTGGCA3′, E292forward 5′-ATGCGCGGATCCGGACAAACTGGCCCTGAA-3′,E402reverse 5′-GGGGAAGCTTCGTGCTTCCAGCTTTGTG-CC-3′andE420reverse5′-GGGGAAGCTTCAACGCTGCCAGCCTTTGAGC-3′. The forward primers mentioned above contained a BamHI restriction site, and the reverse primers included a HindIII restriction site. Each RT-PCR product was digested with BamHI and HindIII, and then ligated into the BamHI/HindIII sites of pET22b vector (Novagen). The E. coli strain BL21(DE3) was transformed with the pET22b vector expressing the E protein fragment, followed by culturing in LB medium with 100 µg/mL ampicillin. When the absorbance reached 0.5∼0.6 at 600 nm, the culture was induced by adding 1 mM isopropyl β-D-thiogalactopyranoside (IPTG) and cultivated at 25 °C for 4 h. Finally, the bacterial pellets were resuspended in ice-cold phosphatebuffered saline (PBS) for sonication. The supernatant of cell lysates was flowed through the Ni-NTA agarose column (Qiagen). After being washed with 100 mM imidazole, the recombinant protein was eluted with 500 mM imidazole and then dialyzed against PBS. The concentration of the purified recombinant E protein fragments was determined with BioRad protein assay reagent. The purified recombinant protein was dissolved in 2× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer without

2-mercaptoethanol and boiled for 10 min. Protein samples were resolved on SDS-12% SDS-polyacrylamide gels and analyzed by coomassie blue staining. 2.3. Binding of Recombinant Proteins to HeparinSepharose Column. The binding ability of recombinant E protein to immobilized heparin was determined with heparin-Sepharose CL-6B (Amersham Pharmacia Biotech). Recombinant E protein was dissolved in 10 mM PBS containing 0.1 M NaCl and applied to a heparin-Sepharose CL-6B column equilibrated with the same buffer. The column was washed with the equilibration buffer and the protein was eluted with a gradient of 0.1-2 M NaCl in 10 mM PBS. Each fraction was collected and used in triplicate to coat microtiter wells at 4 °C overnight, which were then blocked with 5% skim milk in TBST. Recombinant protein in the effluent was detected by ELISA with mAb E3.3 as described in our previous report.15 The bound antibodies were detected after incubation with the anti-mouse IgG conjugated to peroxidase (KPL) for 1 h at room temperature. The ELISA products were developed with a chromogen solution containing 2,2′-azinodi(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and hydrogen peroxide and then A405 was measured. 2.4. Cell Binding ELISA. To determine the binding ability of recombinant proteins to cell, serial dilutions of the sample proteins were directly incubated with BHK-21 cells. Confluent monolayers of BHK-21 cells in 96-well plates were rinsed with PBS and then fixed by adding 10% formaldehyde overnight prior to blocking with 5% skim milk in TBST. Recombinant E protein fragment was incubated with fixed BHK-21 cell monolayers for 1 h at room temperature. After being washed with TBST, bound recombinant E protein fragment was quantified by ELISA analysis with mAb E3.3. The bound antibodies were detected after incubation with the anti-mouse IgG conjugated to peroxidase (KPL) for 1 h at room temperature. The ELISA products were developed with a chromogen solution containing ABTS and hydrogen peroxide and then the A405 was measured.

2162

Biomacromolecules, Vol. 5, No. 6, 2004

Wu et al.

Figure 2. Heparin-binding properties of E261-42, E261-402, E292-420, and E292-402 recombinant proteins to the heparin-Sepharose CL-6B column. The samples were eluted with a gradient of 0.1-2 M NaCl in 10 mM phosphate-buffered saline, and each fraction in the effluent was analyzed by measuring A405 through ELISA.

For binding inhibition assays by GAGs, each recombinant E protein fragment (20 µg/mL) was preincubated with PBS, and GAGs, including heparin, heparan sulfate, chondroitin sulfates A, B, and C, and hyaluronic acid (Sigma Chemical Co., St. Louis, MO), at room temperature for 1 h. The GAG-E protein mixture was added into fixed BHK-21 cell monolayers for additional 1-h incubation at room temperature. After being washed with TBST, bound recombinant E protein fragment was quantified by ELISA analysis. 2.5. Immobilized Recombinant Proteins on Glass Coverslips. Glass coverslips were treated with concentrated sulfuric acid containing a strong oxidizing agent (Chromerge) for 24 h, washed with deionized water, and dried at 100 °C for 20 min to completely remove water. Amino groups were deposited on the surfaces of coverslips by silane chemistry with the following steps. Under nitrogen, coverslips were immersed in 10% (w/w) APTS/toluene at 100 °C for 24 h and then washed with toluene, acetone, and deionized water. To convert amino groups to carboxyl groups, coverslips were immersed in 4% (w/w) succinic anhydride/N,N-dimethylformamide (DMF) at room temperature for 24 h. After thorough washing, samples were activated by treating with 0.03 M EDAC/0.01 M phosphate buffer, pH 4.8, for 1 h at 4 °C, washed with 0.01 M phosphate buffer, pH 7.5, followed by reaction with 10-6 M protein solution for 24 h at 4 °C. After immobilization, samples were washed with PBS and immersed in 70% ethanol. The immobilized proteins on the glass coverslips were confirmed by X-ray photoelectron spectrometry. 2.6. Glass Coverslip Immobilization for Cell Adhesion. Modified coverslips were placed in 24-well plates; BHK-21 cells were trypsinized, diluted with MEM plus 10% fetal bovine serum, and applied to wells at a concentration of 50,000 cells/well. After adhesion for 1 h at 37 °C, coverslips were removed, washed with PBS, and put in wells containing

fresh medium with 10% fetal bovine serum. Cells were photographed after 24 h of incubation. 3. Results 3.1. Recombinant GAG-Binding Proteins Derived from JEV CH2195LA Strain. According to sequence analysis of the JEV E protein (CH2195LA strain, GenBank Accession Number U92644), two putative GAG-binding regions were identified as (i) the first GAG-binding region at residues from E-279 to E-297 (279KLTSGHLKCRLKMDKLALK297) and (ii) the second GAG-binding region at residues from E-397 to E-416 (397KAGSTLGKAFFSTTLKGAQR416) (Figure 1). We thus expressed four overlapping recombinant proteins of different JEV E fragments in E. coli and examined their GAG-binding properties. These four recombinant proteins include (1) rE261-420 (containing two GAG-binding regions), (2) rE261-402 (containing the first GAG-binding region), (3) rE292-420 (containing the second GAG-binding region), and (4) rE292-402 (not containing either GAG-binding region) (Figure 1). Overexpression of these four proteins was obtained in pET22b vector (also containing a C-terminal sixhistidine fusion tag for IMAC purification). The recombinant proteins purified from IMAC columns had apparent molecular masses of 20 kDa for rE261-420, 18 kDa for rE261-402, 16 kDa for rE292-420, and 15 kDa for rE292-402 (data not shown). 3.2. Recombinant GAG-Binding Proteins to HeparinSepharose Column. The heparin-binding properties of IMAC-purified rE261-420, rE261-402, rE292-420, and rE292-402 were then investigated by heparin affinity chromatography (Figure 2). Each purified recombinant protein was applied to the heparin-Sepharose chromatography column and eluted with a gradient concentration of NaCl (0.1-2.0 M). The concentrations of NaCl required to elute these recombinant fragments were found to be 1.4-1.6 M (rE261-420), 0.9-1.1

Cell Adhesive GAG-Binding Protein of JEV

Biomacromolecules, Vol. 5, No. 6, 2004 2163

Figure 3. Recombinant GAG-binding proteins for BHK-21 cell binding. The four purified recombinant proteins at amounts of 50 and 200 ng were added to monolayer BHK-21 cells fixed with 10% formaldehyde. The amounts of protein binding to BHK-21 cells were quantified by measuring A405 through ELISA.

Figure 5. Glass coverslips immobilized with (A) E261-420 (with two GAG-binding regions) and (B) E292-402 (without GAG-binding regions) for promoting BHK cell adhesion and proliferation. BHK cells at a concentration of 50 000 cells/well for 1 h, washed with medium, and incubated for 24 h prior to microscopic investigation. Figure 4. Specificity of the recombinant GAG-binding protein (E261-420) for BHK-21 cells. Different forms of GAGs including heparin, heparan sulfate, chondroitin sulfates A, B, and C, and hyaluronic acid were investigated for inhibition of the interaction of the GAG-binding protein with BHK-21 cells.

M (rE261-402), 0.4-0.6 M (rE292-420), and 0.3-0.5 M (rE292-402). Significantly higher concentrations of NaCl were required for the recombinant fragments of rE261-420 and rE261-402 compared to rE292-420 and rE292-402. This result indicated that the first GAG-binding region presented a higher binding affinity for heparin. 3.3. Recombinant GAG-Binding Proteins for BHK-21 Cell Binding. The GAG-binding properties of the JEV proteins rE261-420, rE261-402, rE292-420, and rE292-402 to BHK cells were investigated by cell binding ELISA. The purified proteins at amounts of 50 and 200 ng were added to each well in which monolayer BHK-21 cells had been previously fixed with 10% formaldehyde. The ELISA assay, performed by detection with a mAb (E3.3) specific to JEV domain III (E292-402), showed that the binding to the formalin-fixed BHK-21 cells was highest for rE261-420, followed by rE261-402 and rE292-420, and was least for rE292-402 for two fixed amounts of proteins (Figure 3). Under the two concentrations used, the increases of ELISA binding of rE261-402 were approximately 30% higher than that of rE292-420 (Figure 3). Again, the first GAG-binding region demonstrated the highest levels of BHK cell binding. The specificity of the GAG-binding protein rE261-420 to BHK-21 cells was further demonstrated for different forms of GAGs in binding competition experiments. Our results showed that the binding of rE261-420 (containing two GAG-

binding regions) to BHK-21 cells was significantly inhibited by heparin competition, as compared to heparan sulfate, chondroitin sulfates A, B, and C, and hyaluronic acid (Figure 4). The specificity of GAG-binding to BHK-21 cells was thus demonstrated only for heparin. 3.4. Glass Coverslips Immobilized with Recombinant GAG-Binding Proteins to Enhance BHK Cell Adhesion. To investigate whether the GAG-binding proteins can promote cell adhesion, rE261-420 (containing two GAGbinding regions) and rE292-402 (not containing either GAGbinding region) were immobilized onto the glass coverslips via amino group deposition by the silane chemical method. The immobilized glass coverslips were then treated with BHK cells at the concentration of 50 000 cells/well for 1 h, washed with medium, and incubated for 24 h for microscopic investigation. Our results showed that significantly more cells adhered to the glass slips coated with rE261-420 (containing two GAG-binding regions) as compared to those coated with rE292-402 (not containing either GAG-binding region) (Figure 5). Most of the BHK-21 cells adhered on E262-420immobilized slips underwent cell spreading with spindle formation (Figure 5). This result indicates that the GAGbinding proteins of JEV can be used as a cell substrate coating to promote cell adhesion and proliferation in culture. 4. Discussion In this study, two putative GAG-binding proteins were identified from the E protein sequence of JEV CH2195LA strain, including (i) the first GAG-binding region at residues

2164

Biomacromolecules, Vol. 5, No. 6, 2004

from E-279 to E-297 (279KLTSGHLKCRLKMDKLALK297) and (ii) the second GAG-binding region at residues from E-397 to E-416 (397KAGSTLGKAFFSTTLKGAQR416). Four recombinant proteins with or without these two GAGbinding regions were expressed in E. coli to examine their GAG-binding properties. The first GAG binding region was demonstrated to exhibit a higher affinity for a heparinSepharose column (Figure 2). Similarly, other ECM proteins, like tenascin-C, have been shown to exhibit two heparinbinding motifs with one having higher affinity compared to the second motif,16-18 In this study, the amino acid sequence of the first GAG-binding region (279KLTSGHLKCRLK290) of the JEV E protein has the same motif of XBXBXBX (B as a positively charged residue and X usually as an uncharged hydrophobic residue) as identified for herpes simplex virus type 1(9). Our results were also correlated with other findings reported for the GAG-binding properties of the E protein of dengue virus (i.e., residues 284-310 and 386-411).13 BHK-21 cells contain a large number of cell surface GAGs and thus were used in the investigation for cell binding and cell adhesion experiments. Our ELISA binding assay demonstrated that the binding to the formalin-fixed BHK-21 cells was highest for rE261-420, followed by rE261-402 and rE292-420, and was least for rE292-402 with two fixed amounts of proteins (Figure 3). We also found these bindings were strongly inhibited by heparin, to a lesser degree by heparan sulfate and chondroitin sulfate A, whereas chondroitin sulfates B and C and hyaluronic acid had no effect (Figure 4). The inhibition by heparin was also found to reduce the infectivity of JEV in BHK-21 cells (data not shown), which is in agreement with several recent studies.19,20 The GAG-binding proteins may display a unique spatial conformation to interact with the specific GAG forms present in neuron tissues for disease development. Using the glass coverslips immobilized with the recombinant proteins with or without GAG-binding regions, we demonstrated that parts of the GAG-binding recombinant protein promoted cell adhesion as well as cell proliferation, as judged by increased spreading of spindle-formed cells after 24 h (Figure 5). To the best of our knowledge, our finding is the first report to show the recombinant GAG-binding proteins from animal viruses to stimulate the adhesive and proliferation of cultured cells. Further studies are being undertaken to investigate the use of various recombinant forms of the GAG-binding proteins with other adhesive matrix proteins or biomaterials currently used for applications in cell and tissue engineering. Acknowledgment. We thank Dr. Hsin-Hsin Shen, Biomedical Engineering Center, Industrial Technology Research Institute, Hsinchu, Taiwan for technical assistance in protein immobilization. This research was supported by Ministry of Economic Affairs, Taiwan, Republic of China, under Technology Development Program for Academia Grant 91-EC17A-17S1-0009.

Wu et al.

References and Notes (1) http://www.glycoforum.gr.jp. (2) Olsen, D.; Yang, C.; Bodo, M.; Chang, R.; Leigh, S.; Baez, J.; Carmichael, D.; Perala, M.; Hamalainen, E. R.; Jarvinen, M.; Polarek, J. Recombinant collagen and gelatin for drug delivery. AdV. Drug DeliVery ReV. 2003, 55 (12), 1547-67. (3) Kapila, Y. L.; Niu, J.; Johnson, P. W. The high affinity heparinbinding domain and the V region of fibronectin mediate invasion of human oral squamous cell carcinoma cells in vitro. J. Biol. Chem. 1997, 272 (30), 18932-8. (4) Jang, J. H.; Koak, J. Y.; Kim, S. C.; Hwang, J. H.; Lee, J. B.; Jang, I. T.; Chung, C. P.; Heo, S. J. Expression and characterization of recombinant NH2-terminal cell binding fragment of vitronectin in E. coli. Biotechnol. Lett. 2003, 23, 1973-5. (5) Mathus, T. L.; Yurchenco, P. D. Analysis of laminin structure and function with recombinant glycoprotein expressed in insect cells. Methods Mol. Biol. 2000, 139, 27-37. (6) Baranowski, E.; Ruiz-Jarabo, C. M.; Domingo, E. Evolution of cell recognition by viruses. Science 2001, 292, 1102-1105. (7) Rostand, K. S.; Esko, J. D. Microbial adherence to and invasion through proteoglycans. Infect. Immun. 1997, 65, 1-8. (8) Lycke, E.; Johansson, M.; Svennerholm, B.; Lindahl, U. Binding of herpes simplex virus to cellular heparan sulfate, an initial step in the adsorption process. J. Gen. Virol. 1991, 72, 1131-1137. (9) Trybala, E.; Bergstrom, T.; Svennerholm, B.; Jeansson, S.; Glorioso, J. C.; Olofsson, S. Localization of a functional site on herpes simplex virus type 1 glycoprotein C involved in binding to cell surface heparan sulphate. J. Gen. Virol. 1994, 75, 743-752. (10) Jackson, T.; Ellard, F. M.; Ghazaleh, R. A.; Brookes, S. M.; Blakemore, W. E.; Corteyn, A. H.; Stuart, D. I.; Newman, J. W.; King, A. M. Efficient infection of cells in culture by type O footand-mouth disease virus requires binding to cell surface heparan sulfate. J. Virol. 1996, 70, 5282-5287. (11) Roderiquez, G.; Oravecz, T.; Yanagishita, M.; Bou-Habib, D. C.; Mostowski, H.; Norcross, M. A. Mediation of human immunodeficiency virus type 1 binding by interaction of cell surface heparan sulfate proteoglycans with the V3 region of envelope gp120-gp41. J. Virol. 1995, 69, 2233-2239. (12) Feldman, S. A.; Hendry, R. M.; Beeler, J. A. Identification of a linear heparin binding domain for human respiratory syncytial virus attachment glycoprotein. J. Gen. Virol. 1999, 73, 6610-6617. (13) Chen, Y.; Maguire, T.; Hileman, R. E.; Fromm, J. R.; Esko, J. D.; Linhardt, R. J.; Marks, R. M. Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate. Nat. Med. 1997, 3, 866-871. (14) Wu, S. C.; Lian, W. C.; Hsu, L. C.; Liau, M. Y. Japanese encephalitis virus antigenic variants with characteristic differences in neutralization resistance and mouse virulence. Virus Res. 1997, 51, 173-181. (15) Lin, C. W.; Wu, S. C. A Functional epitope determinant on domain III of the Japanese encephalitis virus envelope protein interactions with neutralizing -antibody combining sites. J. Virol. 2003, 77, 2600-2606. (16) Aukhil, I.; Joshi, P.; Yan, Y.; Erickson, H. P. Cell- and heparinbinding domains of the hexabrachion arm identified by tenascin expression proteins. J. Biol. Chem. 1993, 268, 2542-2553. (17) Weber, P.; Zimmermann, D. R.; Winterhalter, K. H.; Vaughan, L. Tenascin-C binds heparin by its fibronectin type III domain five. J. Biol. Chem. 1995, 270, 4619-4623. (18) Jang, J. H.; Hwang, J. H.; Chung, C. P.; Choung, P. H. Identification and Kinetics Analysis of a Novel Heparin-binding Site (KEDK) in Human Tenascin-C. J. Biol. Chem. 2004, Apr 6 [Epub ahead of print]. (19) Su, C. M.; Liao, C. L.; Lee, Y. L; Lin, Y. L. Highly sulfated forms of heparin sulfate are involved in Japanese encephalitis virus infection. Virology 2001, 286, 206-215. (20) Liu, H.; Chiou, S. S.; Chen, W. J. Differential binding efficiency between the envelope protein of Japanese encephalitis virus variants and heparan sulfate on the cell surface. J. Med. Virol. 2004, 72 (4), 618-24.

BM0498068