Oleanane-Type Saponins Biosynthesis in Panax notoginseng via

Article Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX

pubs.acs.org/JAFC

Oleanane-Type Saponins Biosynthesis in Panax notoginseng via Transformation of β‑Amyrin Synthase Gene from Panax japonicus Xiang Zhang,†,∥ Yilin Yu,†,∥ Sen Jiang,† Hong Yu,‡ Yingying Xiang,§ Diqiu Liu,†,# Yuan Qu,†,# Xiuming Cui,†,# and Feng Ge*,†,# †

Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming 650500, China School of Life Science, Yunnan University, Kunming 650500, China § Department of Stomatology, Yan’an Hospital Affiliated to Kunming Medical University, Kunming 650031, China # Yunnan Key Laboratory of Panax notoginseng, Kunming University of Science and Technology, Kunming 650500, China J. Agric. Food Chem. Downloaded from pubs.acs.org by TULANE UNIV on 02/14/19. For personal use only.

‡

S Supporting Information *

ABSTRACT: Oleanane-type saponins considered as the main medicinal ingredients in Panax japonicus are not found in Panax notoginseng. β-Amyrin synthase (βAS) was recognized as the first key enzyme in the biosynthetic branch of oleanane-type saponins. In this study, βAS gene from P. japonicus (PjβAS) was transferred into P. notoginseng cells. Along with PjβAS expression in the transgenic cells, the expression levels of several key enzyme genes related to triterpenoid saponins biosynthesis and the content of P. notoginseng saponins were also increased. Two oleanane-type saponins, chikusetsusaponin IV and chikusetsusaponin IVa, contained in P. japonicus were first discovered in transgenic P. notoginseng cells. This study successfully constructed a biosynthetic pathway of oleanane-type saponins in P. notoginseng by introducing just one gene into the species. On the basis of this discovery and previous studies, the common biosynthetic pathway of triterpenoid saponins in Panax genus may be unified to some extent. KEYWORDS: Panax, Panax notoginseng, β-amyrin synthase, triterpenoid, biosynthesis

■

INTRODUCTION

a new pathway to synthesize oleanane-type ginsenosides in P. notoginseng from the beginning of 2,3-oxidosqualene. Triterpenoid saponins in Panax genus are synthesized by the MVA pathway (Figure 1). 2,3-Oxidosqualene is an important intermediate in triterpenoid saponins biosynthesis.11,12 There are several branches starting from 2,3-oxidosqualene to form triterpenoid skeleton, cycloartenol, and other compounds by the catalysis of cyclases (OSCs), which include β-amyrin synthase, dammarenediol-II synthase, cycloartenol synthase, lanosterol synthase, and so on.3 Oleanane-type and dammarane-type saponins are synthesized through the branches of βamyrin synthase and dammarenediol-II synthase, respectively. After oleanane and dammarane triterpenoid skeletons are synthesized, various modifications (oxidation, substitution, and glycosylation) are carried out to produce triterpenoid saponins.13 β-amyrin synthase (βAS) is the first key enzyme in the branch of oleanane-type saponins biosynthesis, which catalyzes 2,3-oxidosqualene to synthesize the skeleton of oleanane-type saponins (Figure 1). RNAi-mediated down-regulation of βAS gene led to reduced contents of oleanane-type saponins, and expression of key genes involved in dammarane-type saponins were up-regulated in RNAi lines.14 Such results indicated that the biosynthesis of oleanane-type saponins could be altered by regulating the expression of βAS. Although P. notoginseng

Panax notoginseng, a well-known traditional Chinese medicine, is used as a kind of health-care food and plays a significant role in hemostatic processes and prevention of cerebrovascular diseases.1 Triterpenoid saponins that belong to dammaranetype saponins are the main pharmacological active components in P. notoginseng. The previous study has confirmed that there are no oleanane-type saponins in P. notoginseng.2 However, oleanane-type saponins, including ginsenoside R0, chikusetsusaponin IV, chikusetsusaponin IVa, etc., are detected in most Panax species. Ginsenoside R0 is found in Panax ginseng and Panax quinquefolium;3 chikusetsusaponin IV and chikusetsusaponin IVa are the main active components in Panax japonicus.4,5 On the basis of the comparison of saponins, it is interesting to investigate why different Panax species have different types of saponins and whether the biosynthetic pathways of saponins are similar. Up to now, some key enzyme genes related to the biosynthesis of triterpenoid in P. notoginseng, P. ginseng, and P. japonicus have been recognized clearly,6−10 from which it could be summarized that the biosynthetic pathway of saponins had common characters significantly in Panax genus. Oleanane-type and dammarane-type saponins both belong to triterpenoid, which are mainly synthesized by the mevalonic acid (MVA) pathway. Although oleanane-type saponin is not found in P. notoginseng, its biosynthetic pathway partially approaches that of dammarane-type saponins due to both of them being triterpenes and using 2,3-oxidosqualene as the precursor for biosynthesis. Thus, it is possible to construct © XXXX American Chemical Society

Received: December 23, 2018 Revised: January 24, 2019 Accepted: January 25, 2019

A

DOI: 10.1021/acs.jafc.8b07183 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

■

Article

MATERIALS AND METHODS

Experimental Materials. The three-year-old P. japonicus and P. notoginseng were obtained from Yunnan Province, China. The calli of P. notoginseng and P. japonicus were induced from the roots and subcultured on Murashige and Skoog (MS) medium supplemented with 2.0 mg L−1 2,4-dichlorophenoxyacetic acid (2,4-D) and 1.0 mg L−1 kinetin (KT) every 35 days at pH 5.8 in the dark at about 25 °C and 50% to 60% humidity. The standard compounds (chikusetsusaponin IV, chikusetsusaponin IVa, and oleanolic acid) were derived from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). All other chemicals were purchased from Sangon Biotech Co. Ltd. (Shanghai, China). RNA Isolation and RT-PCR. The guanidine thiocyanate was employed to isolate the total RNA of all the tissue samples.17 The concentration and integrality of RNA were measured using a UV/ visible spectrophotometer (GE, USA) and agarose gel electrophoresis, respectively. The GoTaq Reverse Transcription System (Promega, USA) was adopted to synthesize the first cDNA strand. Bioinformatics Analysis of PjβAS. The ProtParam tool in ExPASy Protromics Server was used to analyze physical and chemical parameters of PjβAS (https://web.expasy.org/protparam/).18 MEGA 6.0 was used to construct the phylogenetic tree of PjβAS with neighbor-joining methods. A bootstrap of 1000 replications was also used to test the confidence levels. The scale bar represented a 0.2 amino acid substitution per site. Construction of the Plant Expression Vector Carrying the PjβAS Gene. PjβAS was amplified with a pair of specific primers (PjβAS-SacI-F, PjβAS-XbaI-R; Table 1). The PCR process was as follows: 94 °C for 5 min; then 32 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 2 min 15 s; and a final 10 min extension at 72 °C. The PCR product was cloned into pGEM-T-Easy Vector (Promega, USA). The plasmids of pGEM-T-PjβAS and pCAMBIA1300s were digested by SacI and XbaI; the desired fragments were ligated to form pCAMBIA1300s-PjβAS (Figure 2). The recombined plasmid pCAMBIA1300s-PjβAS was sequenced and transferred into A. tumefaciens EHA105 by the freeze−thaw method.19

Figure 1. Brief biosynthetic pathway of triterpenoid saponins in Panax genus. AATC, acetoacetyl-CoA acyltransferase; HMGS, 3hydroxy-3-methylglutaryl-CoA synthase; HMGR, 3-hydroxy-3-methylglutaryl-CoA reductase; IDI, isopentenyl diphosphate isomerase; GPS, geranylgeranyl pyrophosphate synthase; FPS, farnesyl diphosphate synthase; SS, squalene synthase; SE, squalene epoxidase; DS, dammarenediol-II synthase; βAS, β-amyrin synthase; P450, cytochrome P450; UGT, UDP-glycosyltransferase. The dotted lines indicate several enzyme reactions. The dark boxes represent the key enzymes in the pathway.

cannot synthesize oleanane-type saponins naturally, 2,3oxidosqualene still exists in P. notoginseng in order to produce dammarane-type saponins. Therefore, using 2,3-oxidosqualene as a precursor to achieve oleanane-type saponins biosynthesis in P. notoginseng by metabolic engineering is a feasible approach. So far, there is no report about gene transformation between two species in Panax genus. The βAS gene from P. japonicus (PjβAS) was expressed in rice, and the transgenic rice contained oleanane-type sapogenin.15 Dammarenediol-II synthase and protopanaxadiol synthase genes from P. ginseng, together with a NADPH-cytochrome P450 reductase gene from Arabidopsis thaliana, were all transformed into Saccharomyces cerevisiae, and protopanaxadiol was synthesized in transgenic S. cerevisiae.16 Therefore, the technology of exogenous genes expression provides with an effective approach for getting new type of bioactive components in species. In this study, PjβAS gene was transformed into P. notoginseng cells to explore whether oleanane-type saponins could be synthesized in transgenic cells. If the transgenic P. notoginseng cells could produce oleanane-type saponins by just introducing one gene, PjβAS, into the biosynthetic pathway, it would suggest that most of the necessary enzymes for skeleton modification of oleanane-type saponins existed in P. notoginseng although there was no oleanane-type saponins in the species. Furthermore, the common biosynthetic pathway of saponins in Panax genus may be unified.

Figure 2. T-DNA region of the plant expression vector pCAMBIA1300s-PjβAS. Intermediates: 35S poly A, terminator of CaMv 35S gene; 35S P, 35S promoter; hpt, hygromycin phosphotransferase gene. Genetic Transformation of P. notoginseng Cells and PCR Analysis. Genetic transformation of P. notoginseng cells was carried out as described in our previous report.20 The PjβAS-transgenic cells were cultured on MS agar medium with 400.0 mg L−1 cefotaxime, 2.0 mg L−1 2,4-D, and 1.0 mg L−1 KT for 15 days to inhibit the growth of

Table 1. Primers Used for RT-PCR primer name

primer sequence (5′-3′)

PjβAS-Sac I-F PjβAS-Xba I-R htp-F htp-R PjβAS-F PjβAS-R 18S rRNA-F 18S rRNA-R

GAGTCTATGTGGAGGCTAATGACAGCCAAGGG TCTAGATCAGACGCTTTTAGGTGGTAATCGAACA GAAGTGCTTGACATTGGGGAAT AGATGTTGGCGACCTCGTATT ATGTGGAGGCTAATGACAGCCAAGGG TCAGACGCTTTTAGGTGGTAATCGAACA CCGACTTTTGGAAGGGATG AAGTTTCAGCCTTGCGACC B


Article

Journal of Agricultural and Food Chemistry EHA105, and then the cells were transferred to the selective MS agar medium containing 25.0 mg L−1 hygromycin B (Hyg), 2.0 mg L−1 2,4-D, and 1.0 mg L−1 KT and subcultured every 35 days at pH 5.8 in the dark at about 25 °C and 50% to 60% humidity. After four periods, PjβAS-transgenic cell lines could be obtained. PCR analysis of Hyg resistance gene (hpt) was employed to confirm the PjβAS-transgenic cell lines preliminarily. The method of cetyltrimethylammonium bromide (CTAB) was used to extract the genomic DNA from cells.21 The primers of hpt from the transfer DNA (T-DNA) in transgenic cells are shown in Table 1. Expression Analysis by Quantitative Real-Time PCR (qRTPCR). The transcription levels of the enzyme genes in the biosynthetic pathway of saponins were analyzed by qRT-PCR. P. notoginseng 18S rRNA was selected as the reference gene. The relevant primers were listed in Table 2. The GoTaq qPCR Master Mix Real-Time PCR

100% B and 60−0% A. The standard curves were used for the quantitative analysis. UPLC-MS Confirmation of Monomer Saponins and Oleanolic Acid. A Thermo Scientific Dionex Ultimate 3000 UHPLC system with a Thermo High-Resolution Q Exactive Focus mass spectrometer (Thermo, Germany) were used for analysis, and the analytical method was derived from previous studies.24,25 The injection volume was 1.0 μL. The chromatographic column was presented on a 100 mm × 2.1 mm Hypersil Gold instrument (Thermo Fisher Scientific) with a particle size of 1.9 μm. The mobile phase was a gradient prepared from a 0.5% formic acid aqueous solution (A) and methanol (B). The elution began with 25% B, and the proportion of B was increased linearly to 98% at 10 min, held for 2 min, and then brought back to 25% B at 12.1 min and held for 3 min for a total of 15 min. The flow rate of the mobile phase was kept at 300 μL/min. Mass spectrometry was performed on a Thermo Quadrupole Exactive Focus (QEF) system (Thermo Fisher Scientific). The products were analyzed under negative-ion mode. The optimized conditions were Sheath gas at 35 L min−1, Aux gas (Ar) at 10 L min−1, and capillary potentials at 2.5 kV. Statistical Analysis. Data are the averages of three independent sample measurements. The standard deviation from the means of triplicates was indicated by the error bars. The Student’s t-test was employed to analyze the data. The difference between control and transgenic cells was considered significant when p < 0.05.

Table 2. Primers Used for Real-Time PCR primer name

primer sequence (5′-3′)

PjβAS-F PjβAS-R 18S rRNA-F 18S rRNA-R PnHMGR-F PnHMGR-R PnFPS-F PnFPS-R PnSS-F PnSS-R PnSE-F PnSE-R PnCAS-F PnCAS-R PnDS-F PnDS-R

GTATTCCCTGTAGAGCATCGCAT GGCACAGGCGTTGTTTTCAC AACCATAAACGATGCCGACCAG TTCAGCCTTGCGACCATACTCC CTCTTTTTCTCCGTCGCATACTACC GGGAGACAATGGCGGTGAGTT GGTATGATTGCCGTAAATGATGG AGGCTTTTGTCGGAAATGCTT CACTGGGCTTTCTGTTACTCTATGC CATCCTCAACAGTGTCAAGTGCTC TAGGTGAACTTCTACAACCAGGAGG GCTTCTTCCAGCTACATCCGAAT GAACAGAGATGGTGGGTGGGGT GAATCCATTGACGCCCCTTT CAAGCACACGATGGTCACTGG CGTTCCGCTGATATATAGGGC

■

RESULTS Expression of PjβAS in P. notoginseng Cells. The open reading frame (ORF) of PjβAS was 2286 bp encoding a 761amino-acid protein according to the cDNA sequence (GenBank acc. no. KP658156). The structural characteristic of PjβAS amino acids was evaluated with other OSCs proteins by phylogenetic tree. As shown in Figure 3, the cDNA sequence described in this study was a βAS gene from P. japonicus. PjβAS-transgenic cell lines of P. notoginseng were generated by A. tumefaciens-mediated transformation system and subcultured on a selective medium with hygromycin. Four

System (Promega, USA) was carried out for quantitative analysis, which was programmed at 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 55 °C for 30 s, and 72 °C for 30 s. The 2−ΔΔCT method was used to analyze gene expression changes.22 Quantitative Analysis of Total Triterpenoid Saponins. According to our previous study, the improved method of extract total saponins was accepted.7 The fresh cells were collected and dehydrated to the constant weight at 55 °C. Then, the dried cells (0.5 g) were transferred into a tube supplemented with 25.0 mL of methanol, followed by ultrasonic extraction (60 W) for 2.0 h. Subsequently, the methanol extract was collected by centrifugation, and the solvent was evaporated. The residue was dissolved in 10.0 mL of distilled water and then extracted with the same volume of watersaturated butanol. The butanol layer was evaporated to produce the saponin fraction and dissolved in methanol. The mixture of vanillin− perchloric acid as a coloring reagent was added to the concentrate, and the coloring reaction lasted 15 min at 60 °C. According to the absorbance at 550 nm of reaction product and standard curve, the content of total triterpenoid saponins could be calculated. HPLC Analysis of Monomer Saponins. Saponin fraction was prepared as described above. The high-performance liquid chromatography (HPLC) analysis conducted on an Agilent 1260 system (Agilent, USA) with a Waters XTerra MS C18 column (5 μm, 4.6 mm × 250 mm; Waters, USA) was similar to our previous studies.7 The mobile phase was formed by 0.05% phosphoric acid aqueous solution (A) and acetonitrile (B). The detection wavelength was 203 nm.23 The flow rate was 1.0 mL min−1, and the sample injection volume was 10.0 μL. The column temperature was 30 °C. The gradient elution was conducted as follows: 0−20 min, 20% B and 80% A; 21−30 min, 20−35% B and 80−65% A; 31−40 min, 35% B and 65% A; 41−50 min, 35−40% B and 65−60% A; and 51−60 min, 40−

Figure 3. Phylogenetic analysis of PjβAS protein sequence with other βAS and oxidosqualene cyclases. All the relevant sequences are listed in Table S1 of the Supporting Information. The black circular symbols indicated the PjβAS protein. C


Article


that in the control cell line (Figure 6). Furthermore, the contents of dammarane-type saponins and ginsenosides Rb1

transgenic cell lines (T1, T2, T3, and T4) were selected for further analysis. RT-PCR confirmed that the four cell lines contained hpt gene, thus to be conferred hygromycin resistance (Figure 4). There was no obvious change in morphological traits between the PjβAS-transgenic and control cells.

Figure 4. PCR analysis of hpt (320 bp) in transgenic P. notoginseng cells. M, DNA Marker DL 2000; 1−4, PjβAS-transgenic P. notoginseng cell lines; 5, negative control (non-transgenic cells); 6, positive control (vector carrying hpt gene).

Figure 6. Content of total saponins in transgenic P. notoginseng cells. The standard deviation (SD) of means from three independent experiments was indicated by error bars. Significant difference between the control (non-transgenic cells), and the transgenic cell line was indicated by asterisks (*P < 0.05; **P < 0.01).

The relative expression level of PjβAS gene in transgenic cells was analyzed by qPCR. All four transgenic cell lines gave high expression levels of PjβAS (Figure 5), which suggested

and Rd were also analyzed (Figure 7A). In all transgenic cell lines, the contents of ginsenosides Rb1 and Rd were both increased significantly compared with the control cell line (Figure 7B). Dammarane-type saponins do not belong to the branch of βAS in the biosynthetic pathway of triterpenoid saponins (Figure 1). It was interesting to explore why the PjβAS expression could enhance the contents of dammaranetype saponins; after all, PjβAS was not a key enzyme in the branch of dammarane-type saponins biosynthesis. Promoting the Expression of Key Enzyme Genes Involved in the Biosynthesis of Triterpenoid Saponins in the Transgenic Cells. The expression levels of HMGR, FPS, SS, SE, and DS genes were detected; such genes were considered as the key enzyme genes in the biosynthetic pathway of triterpenoid saponins (Figure 1). The result showed that expression levels of the above five genes were all increased to some extent in PjβAS-transgenic cell lines (Figure 5). The transcription of SE in T2 cell line had the most significant enhancement, which was approximately 6.45 times higher than that in the control. The up-regulated expression of key enzyme genes might promote the biosynthesis of total triterpenoid and dammarane-type saponins in the transgenic cells. Oleanane-Type Saponins First Found in the Transgenic Cells of P. notoginseng. The purpose of this research was to establish an effective pathway to produce oleanane-type saponins in P. notoginseng. Chikusetsusaponin IV and chikusetsusaponin IVa are two representative compounds in P. japonicus, which belong to oleanane-type saponins and are not found in P. notoginseng. In this study, PjβAS gene from P. japonicus was transformed into P. notoginseng cells in order to construct the biosynthetic branch of oleanane-type saponins in it. Fortunately, the PjβAS-transgenic P. notoginseng cells successfully synthesized oleanane-type saponins, chikusetsusaponin IV and chikusetsusaponin IVa. LC-MS confirmed that chikusetsusaponin IV and chikusetsusaponin IVa exactly existed in the transgenic cells (Figure 8). Oleanolic acid was also found, which was considered as the precursor of oleananetype saponins (Figure 8). Such results indicated that PjβAS-

Figure 5. Relative expression levels of HMGR, FPS, SS, SE, DS, and PjβAS genes in four PjβAS-transgenic P. notoginseng cell lines. Standard deviation (SD) of means from three independent experiments was indicated by error bars. 18S rRNA was selected as the internal reference gene. The 2−ΔΔCT method was used to calculate the relative expression levels. Significant difference between the control (non-transgenic cells) and the transgenic cell line was indicated by asterisks (*P < 0.05; **P < 0.01).

that the PjβAS gene was introduced into P. notoginseng cells successfully. Furthermore, as the random insertion character of the transgenic process by A. tumefaciens-mediated system, the PjβAS expression in different transgenic cell lines was not the same and T2 cell line showed the highest expression level of PjβAS. Increasing the Biosynthesis of Total Triterpenoid and Dammarane-Type Saponins in the Transgenic Cells. The PjβAS expression in P. notoginseng cells might affect the biosynthesis of triterpenoid saponins. In this study, total triterpenoid saponins in transgenic cell lines were all higher than those in control cells. Especially in the T2 cell line, the content of total triterpenoid saponins was about 1.75 times D


Article


Figure 7. Contents of monomer saponins in P. notoginseng cell lines. A, HPLC chromatograms of standards (SMS), PjβAS-transgenic P. notoginseng (TCL), non-transgenic P. notoginseng (control); B, the contents of four monomer saponins in TCL and control. The standard deviation (SD) of means from three independent experiments was indicated by error bars. The significant difference between the control (non-transgenic cells) and the transgenic cell line was indicated by asterisks (*P < 0.05; **P < 0.01).

transgenic cells of P. notoginseng were conferred the ability on the biosynthesis of oleanane-type saponins. Further, besides the new saponins (chikusetsusaponin IV and chikusetsusaponin IVa) that emerged in the transgenic cells of P. notoginseng, the contents of some dammarane-type saponins were also increased (Figure 7B); that is to say, the biosynthesis of all the main triterpenoid saponins in the cells might be promoted by just introducing one gene, PjβAS, into the biosynthetic pathway.

Triterpenoid saponins are important active ingredients in many medicinal herbs, especially in Panax genus. But, such herbs mainly belong to perennial plants, and the yield is difficult to increase. Therefore, it is valuable to synthesize triterpenoid saponins through metabolic engineering. For example, three key enzyme genes, namely, β-amyrin synthase, oleanolic acid synthase, and NADPH-cytochrome P450 reductase, were transferred into Saccharomyces cerevisiae, and this transgenic yeast could produce oleanolic acid which did not exist in yeast originally.28 The biosynthetic pathways of triterpenoid saponins were also applied on the microbial cell factories developed to produce some monomer saponins not just for precursor’s biosynthesis.29 To do this, the exact roles of some enzyme genes in the biosynthetic pathway of triterpenoids should be explored based on the herbs. In the present study, the PjβAS from P. japonicus could be expressed in P. notoginseng efficiently and confer the host to have the ability on oleanane-type saponins biosynthesis. In general, a new end product cannot be synthesized by just introducing one intermediate gene into the host. But, when PjβAS from P. japonicus was expressed in P. notoginseng, oleanane-type saponins (chikusetsusaponin IV and chikusetsusaponin IVa) were found in the transgenic cells, which were the main bioactive compounds in P. japonicus but not discovered in P. notoginseng. PjβAS is the first key enzyme gene in the branch of oleanane-type saponins biosynthesis (Figure 9), which acted as a bridge to construct a new biosynthetic pathway of oleanane-type saponins in P. notoginseng. On the basis of the end product of the biosynthesis, such as chikusetsusaponin IV and chikusetsusaponin IVa, we also speculated that a series of enzymes for skeleton modifications of oleanane-type saponins should have already existed in P. notoginseng, which belonged to cytochrome P450 (P450) and uridine diphosphate (UDP)dependent glycosyltransferases (UGTs).30 These enzymes might also play the similar functions for skeleton modification of dammarane-type saponins in P. notoginseng.

■

DISCUSSION The utilization of callus has become a fast and efficient way to study the function of genes in medicinal plants. For example, to analyze the responses of possible defense genes in P. ginseng, the suspension cells were treated with MeJA;26 and in our previous studies, genes of key enzymes and transcription factors related to the biosynthesis of triterpenoid saponins were cloned and overexpressed in P. notoginseng cells to explore their functions in the pathway of saponins biosynthesis.6,20,27 These studies indicated that cell culture was an effective means to study physiology and metabolism in perennial plants. βAS is a key enzyme gene in the branch of oleanane-type saponins biosynthesis. In this study, the exogenous PjβAS from P. japonicus was expressed in P. notoginseng cells successfully and led to the biosynthesis of oleanane-type saponins. In the meantime, the expression levels of some key enzyme genes (HMGR, FPS, SS, SE, and DS) were also enhanced in the PjβAS-transgenic cells (Figure 5), which was consistent with our previous study.20 When RNA interference of cycloartenol synthase gene caused the decreased content of phytosterol and increased content of triterpenoid saponins in P. notoginseng, the expression levels of some key enzyme genes involved in the biosynthesis of triterpenoid saponins were increased too.6 It is speculated that no matter the overexpression or interference, the gene in the biosynthetic pathway could change the secondary metabolic flux, thus inducing the expression variation of other relevant key enzyme genes indirectly in order to adapt the fluctuation of metabolism. E


Article


Figure 8. UPLC-MS profiles of sample and standards. (A) The mass spectra and chromatograms of standards. (B) The chromatograms of the transgenic cells. TIC showed the total ion chromatogram. SIM925 showed the specific ion of chikusetsusaponin IV selected ion monitoring (SIM) peak at m/z 925 [M−H]−. SIM793 showed the specific ion of chikusetsusaponin IVa SIM peak at m/z 793 [M−H]−. SIM455 showed the specific ion of oleanolic acid SIM peak at m/z 455 [M−H]−.

saponins.32 Overexpression of UGTPg71A29 in P. ginseng could significantly enhance the content of dammarane-type saponins.31 As we still do not know the detailed postmodification process for the formations of chikusetsusaponin IV and chikusetsusaponin IVa, the next study will clarify the complex mechanism of why oleanane-type saponins could be synthesized in transgenic P. notoginseng cells. In conclusion, oleanane-type saponins (chikusetsusaponin IV and chikusetsusaponin IVa) as found in P. japonicus could be synthesized in transgenic P. notoginseng. The biosynthetic pathway of oleanane-type saponins might be constructed by just introducing PjβAS into P. notoginseng. Such results

In the biosynthetic pathway of triterpenoid saponins, the process of triterpenoid skeleton formation is similar among different species in Panax genus. After the skeleton was formed, post-modification of oxidation and glycosylation regulated the structure diversities by cytochrome P450s and UGTs, and a variety of monomer saponins were biosynthesized in the end.31−34 So far, more than 100 saponins have been found and identified from P. notoginseng and P. japonicus.10,35 Due to P450s and UGTs all belonging to superfamily, only a few of them have been identified, and most of them are still unclear.36 In P. ginseng, the CYP716A52v2 has been verified to participate in the biosynthesis of oleanane-type F


Article


Figure 9. Biosynthetic branch of chikusetsusaponin IV and chikusetsusaponin IVa. The dotted lines indicate several enzyme reactions.

synthase; AATC, acetoacetyl-CoA acyltransferase; HMGS, 3hydroxy-3-methylglutaryl-CoA synthase; HMGR, 3-hydroxy-3methylglutaryl-CoA reductase; IDI, isopentenyl diphosphate isomerase; GPS, geranylgeranyl pyrophosphate synthase; FPS, farnesyl diphosphate synthase; SS, squalene synthase; SE, squalene epoxidase; βAS, β-amyrin synthase; P450, cytochrome P450; UGT, UDP-glycosyltransferase

indicated that most of the necessary enzymes for skeleton modification of oleanane-type saponins have already existed in P. notoginseng although there were no oleanane-type saponins in the species. The common biosynthetic pathway of saponins in Panax genus may be unified to some extent.

■

ASSOCIATED CONTENT

■

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.8b07183. Relevant OSCs sequences for phylogenetic analysis (Table S1) (PDF)

■

REFERENCES

(1) Ng, T. B. Pharmacological activity of sanchi ginseng (Panax notoginseng). J. Pharm. Pharmacol. 2006, 58, 1007−1019. (2) Liu, M. H.; Yang, B. R.; Cheung, W. F.; Yang, K. Y.; Zhou, H. F.; Kwok, J. S. L.; Liu, G. C.; Li, X. F.; Zhong, S.; Lee, S. M. Y.; Tsui, S. K. W. Transcriptome analysis of leaves, roots and flowers of Panax notoginseng identifies genes involved in ginsenoside and alkaloid biosynthesis. BMC Genomics 2015, 16, 265. (3) Luo, H. M.; Sun, C.; Sun, Y. Z.; Wu, Q.; Li, Y.; Song, J. Y.; Niu, Y. Y.; Cheng, X. L.; Xu, H. X.; Li, C. Y.; Liu, J. Y.; Steinmetz, A.; Chen, S. L. Analysis of the transcriptome of Panax notoginseng root uncovers putative triterpene saponin-biosynthetic genes and genetic markers. BMC Genomics 2011, 12, S5. (4) Yoshizaki, K.; Devkota, H. P.; Fujino, H.; Yahara, S. Saponins composition of rhizomes, taproots, and lateral roots of Satsuma-ninjin (Panax japonicus). Chem. Pharm. Bull. 2013, 61 (3), 344−350. (5) Kochkin, D. V.; Kachala, V. V.; Shashkov, A. S.; Chizhov, A. O.; Chirva, V. Y.; Nosov, A. M. Malonyl-ginsenoside content of a cellsuspension culture of Panax japonicus var. repens. Phytochemistry 2013, 93, 18−26. (6) Yang, Y.; Ge, F.; Sun, Y.; Liu, D. Q.; Chen, C. Y. Strengthening triterpene saponins biosynthesis by over-expression of farnesyl pyrophosphate synthase gene and RNA interference of cycloartenol synthase gene in Panax notoginseng cells. Molecules 2017, 22 (4), 581. (7) Deng, B.; Huang, Z. J.; Ge, F.; Liu, D. Q.; Lu, R. J.; Chen, C. Y. An AP2/ERF family transcription factor PnERF1 raised the biosynthesis of saponins in Panax notoginseng. J. Plant Growth Regul. 2017, 36 (3), 691−701. (8) Park, S. B.; Chun, J. H.; Ban, Y. W.; Han, J. Y.; Choi, Y. E. Alteration of Panax ginseng saponin composition by overexpression and RNA interference of the protopanaxadiol 6-hydroxylase gene (CYP716A53v2). J. Ginseng Res. 2016, 40, 47−54. (9) Rai, A.; Yamazaki, M.; Takahashi, H.; Nakamura, M.; Kojoma, M.; Suzuki, H.; Saito, K. RNA-seq transcriptome analysis of Panax japonicus, and its comparison with other Panax species to identify potential genes involved in the saponins biosynthesis. Front. Plant Sci. 2016, 7, 481. (10) Zhang, S. P.; Wu, Y. Y.; Jin, J.; Hu, B. X.; Zeng, W. Y.; Zhu, W. J.; Zheng, Y. L.; Chen, P. De novo characterization of Panax japonicus C. A. Mey transcriptome and genes related to triterpenoid saponin biosynthesis. Biochem. Biophys. Res. Commun. 2015, 466, 450−455.

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel./Fax: +8687165920621. ORCID

Yuan Qu: 0000-0001-8423-3976 Feng Ge: 0000-0003-1127-7120 Author Contributions ∥

These authors contributed equally to this work. F.G. conceived and designed the experiments. D.L. and Y.Q. provided technical guidance. X.Z. and Y.Y. performed the experiments. S.J. and X.Z. contributed to the data analysis. H.Y., X.C., and Y.X. provided the experimental materials. X.Z. wrote this paper. X.Z. and Y.Y. contributed to the work equally and were regarded as co-first authors. All authors approved the final manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (81560616, 31260070). Notes

The authors declare no competing financial interest.

■ ■

ACKNOWLEDGMENTS We are grateful for the help from Prof. Peiji Zhao in the analysis of saponins. ABBREVIATIONS USED HPLC, high-performance liquid chromatography; MVA, mevalonic acid; 2,4-D, 2,4-dichlorophenoxyacetic acid; Hyg, hygromycin B; βAS, β-amyrin synthase; KT, kinetin; CTAB, cetyltrimethylammonium bromide; DS, dammarenediol-II G


Article


(30) Huang, Z. J.; Liu, D. Q.; Ge, F.; Chen, C. Y. Advances in studies on key post-modification enzymes in triterpenoid saponins biosynthesis. Acta Bot. Boreal. 2014, 34, 2137−2144. (31) Lu, J.; Yao, L.; Li, J. X.; Liu, S. J.; Hu, Y. Y.; Wang, S. H.; Liang, W. X.; Huang, L. Q.; Dai, Y. J.; Wang, J.; Gao, W. Y. Characterization of UDP-glycosyltransferase involved in biosynthesis of ginsenosides Rg1 and Rb1 and identification of critical conserved amino acid residues for its function. J. Agric. Food Chem. 2018, 66, 9446−9455. (32) Han, J.-Y.; Kim, M.-J.; Ban, Y.-W.; Hwang, H.-S.; Choi, Y.-E. The involvement of β-Amyrin 28-oxidase (CYP716A52v2) in oleanane-type ginsenoside biosynthesis in Panax ginseng. Plant Cell Physiol. 2013, 54, 2034−2046. (33) Han, J.-Y.; Kim, H.-J.; Kwon, Y.-S.; Choi, Y.-E. The Cyt P450 enzyme CYP716A47 catalyzes the formation of protopanaxadiol from dammarenediol-II during ginsenoside biosynthesis in Panax ginseng. Plant Cell Physiol. 2011, 52, 2062−2073. (34) Wei, G. F.; Wei, F. G.; Yuan, C.; Chen, Z. J.; Wang, Y.; Xu, J.; Zhang, Y. Q.; Dong, L. L.; Chen, S. L. Integrated chemical and transcriptomic analysis reveals the distribution of protopanaxadioland protopanaxatriol-type saponins in Panax notoginseng. Molecules 2018, 23, 1773. (35) Wang, T.; Guo, R. X.; Zhou, G. H.; Zhou, X. D.; Kou, Z. Z.; Sui, F.; Li, C.; Tang, L. Y.; Wang, Z. J. Traditional uses, botany, phytochemistry, pharmacology and toxicology of Panax notoginseng (Burk.) F.H. Chen: A review. J. Ethnopharmacol. 2016, 188, 234−258. (36) Kang, K. B.; Jayakodi, M.; Lee, Y. S.; Nguyen, V. B.; Park, H.-S.; Koo, H. J.; Choi, I. Y.; Kim, D. H.; Chung, Y. J.; Ryu, B.; Lee, D. Y.; Sung, S. H.; Yang, T.-J. Identification of candidate UDPglycosyltransferases involved in protopanaxadiol-type ginsenoside biosynthesis in Panax ginseng. Sci. Rep. 2018, 8, 11744.

(11) Thimmappa, R.; Geisler, K.; Louveau, T.; O’Maille, P.; Osbourn, A. Triterpene Biosynthesis in Plants. Annu. Rev. Plant Biol. 2014, 65, 225−257. (12) Liang, Y.; Zhao, S. Progress in understanding of ginsenoside biosynthesis. Plant Biol. 2008, 10, 415−421. (13) Ghosh, S. Triterpene structural diversification by plant cytochrome P450 enzymes. Front. Plant Sci. 2017, 8, 1886. (14) Zhao, C.; Xu, T. H.; Liang, Y. L.; Zhao, S. J.; Ren, L. Q.; Wang, Q.; Dou, B. Functional analysis of b-amyrin synthase gene in ginsenoside biosynthesis by RNA interference. Plant Cell Rep. 2015, 34, 1307−1315. (15) Huang, Z. W.; Lin, J. C.; Cheng, Z. X.; Xu, M.; Guo, M. S.; Huang, X. Y.; Yang, Z. J.; Zheng, J. G. Production of oleanane-type sapogenin in transgenic rice via expression of β-amyrin synthase gene from Panax japonicus C. A. Mey. BMC Biotechnol. 2015, 15, 45. (16) Dai, Z. B.; Liu, Y.; Zhang, X. N.; Shi, M. Y.; Wang, B. B.; Wang, D.; Huang, L. Q.; Zhang, X. L. Metabolic engineering of Saccharomyces cerevisiae for production of ginsenosides. Metab. Eng. 2013, 20, 146−156. (17) Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extration. Anal. Biochem. 1987, 162, 156−159. (18) Tang, Y. B.; Yang, S. Q.; Yan, Q. J.; Zhou, P.; Cui, J.; Jiang, Z. Q. Purification and characterization of a novel β-1,3−1,4-glucanase (lichenase) from thermophilic Rhizomucor miehei with high specific activity and its gene sequence. J. Agric. Food Chem. 2012, 60, 2354− 2361. (19) Hofgen, R.; Willmitzer, L. Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res. 1988, 16, 9877. (20) Zhang, X.; Ge, F.; Deng, B.; Shah, T.; Huang, Z. J.; Liu, D. Q.; Chen, C. Y. Molecular cloning and characterization of PnbHLH1 transcription factor in Panax notoginseng. Molecules 2017, 22, 1268. (21) Tamari, F.; Hinkley, C. S.; Ramprashad, N. A comparison of DNA extraction methods using Petunia hybrida tissues. J. Biomol. Technol. 2013, 24, 113−118. (22) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402−408. (23) Xia, P. G.; Bai, Z. Q.; Liang, T. Y.; Yang, D. F.; Liang, Z. S.; Yan, X. J.; Liu, Y. High-performance liquid chromatography based chemical fingerprint analysis and chemometric approaches for the identification and distinction of three endangered Panax plants in Southeast Asia. J. Sep. Sci. 2016, 39, 3880−3888. (24) Chan, H.-H.; Hwang, T.-L.; Reddy, M. V. B.; Li, D.-T.; Qian, K.; Bastow, K. F.; Lee, K.-H.; Wu, T.-S. Bioactive constituents from the roots of Panax japonicus var. major and development of a LC-MS/ MS method for distinguishing between natural and artifactual compounds. J. Nat. Prod. 2011, 74, 796−802. (25) Tao, Y.; Du, Y. S.; Li, W. D.; Cai, B. C. Development and validation of an UHPLC−MS/MS approach for simultaneous quantification of five bioactive saponins in rat plasma: Application to a comparative pharmacokinetic study of aqueous extracts of raw and salt-processed Achyranthes bidentata. J. Pharm. Biomed. Anal. 2018, 151, 164−169. (26) Kim, Y.-K.; Kim, Y. B.; Kim, J. K.; Kim, S.-U.; Park, S. U. Molecular cloning and characterization of mevalonic acid (MVA) pathway genes and triterpene accumulation in Panax ginseng. Han'guk Eungyong Sangmyong Hwahakhoeji 2014, 57, 289−295. (27) Deng, B.; Zhang, P.; Ge, F.; Liu, D. Q.; Chen, C. Y. Enhancement of triterpenoid saponins biosynthesis in Panax notoginseng cells by co-overexpressions of 3-hydroxy-3-methylglutaryl CoA reductase and squalene synthase genes. Biochem. Eng. J. 2017, 122, 38−46. (28) Dai, Z. B.; Wang, B. B.; Liu, Y.; Shi, M. Y.; Wang, D.; Zhang, X. N.; Liu, T.; Huang, L. Q.; Zhang, X. L. Producing aglycons of ginsenosides in bakers’ yeast. Sci. Rep. 2015, 4, 3698. (29) Zhao, Y. J.; Li, C. Biosynthesis of plant triterpenoid saponins in microbial cell factories. J. Agric. Food Chem. 2018, 66, 12155−12165. H


Oleanane-Type Saponins Biosynthesis in Panax notoginseng via

Recommend Documents