Open Flower Fluoroimmunoassay: A General Method To Make

Subscriber access provided by ADAMS STATE UNIVERSITY

Article

Open flower fluoroimmunoassay: a general method to make fluorescent protein-based immunosensor probes Chan-I Chung, Ryoji Makino, Jinhua Dong, and Hiroshi Ueda Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.5b00088 • Publication Date (Web): 17 Feb 2015 Downloaded from http://pubs.acs.org on February 18, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Open flower fluoroimmunoassay: a general method to make fluorescent protein-based immunosensor probes Chan-I Chung,† Ryoji Makino, † Jinhua Dong,‡ Hiroshi Ueda ‡* †

Department of Chemistry and Biotechnology, School of Engineering, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656, Japan; ‡ Chemical Resources Laboratory, Tokyo Institute of Technology, 4259-R1-18, Nagatsuta-cho, Midori-ku, Yokoyama, Kanagawa 226-8503, Japan; *

Corresponding author. Phone/Fax: +81-45-924-5248, E-mail: [email protected]

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 19

Abstract

Fluorescence-based probes, especially those utilize Förster resonance energy transfer (FRET) between fluorescent protein (FP) variants, are widely used to monitor various biological phenomena, most often detecting its ligand-induced conformational change through the receptor domain. While antibody provides a fertile resource of a specific receptor for various biomolecules, its potential has not been fully exploited. An exception is a pair of donor FP-fused VH and acceptor FP-fused VL fragments, which has been proven useful when their association increases in the presence of antigen (open sandwich fluoroimmunoassay, OS-FIA). However, probes for larger proteins such as serum albumin (SA) were difficult to produce, since the interaction between VH and VL of these antibodies is barely affected by the bound antigen. Here we propose a novel strategy, called open flower fluoroimmunoassay (OF-FIA) using a probe composed of a donor-fused VH and an acceptor-fused VL linked by a disulfide bond between VH and VL (CyPet/YPet-dsFv). The probe gave high FRET efficiency due to the dimerization propensity of the FP pair, while the efficiency got lower as SA concentration increased, probably due to dimer disruption. The constructed probe could detect clinically relevant range of SA, showing its potential as a diagnostic reagent.


2

Page 3 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Biomarkers are measurable substances which can monitor the state of biological processes, pathogenic processes, or pharmacological responses1. Thus, the detection of biomarkers is important to diagnosis, clinical endpoint measurement and disease process measurement. Nowadays a wide range of biomarkers are being used, such as protein, peptide, RNA, small molecule, and carbohydrate. In this study, we focus on the detection of a cellular biomarker, which is a protein secreted from the cells. As detection methods for cellular biomarkers, immunoassays such as sandwich ELISA and RIA are well-established methods exhibiting high sensitivity and selectivity2. However, these immunoassays usually require several rounds of incubation and washing steps including tedious manipulations, which make them difficult to apply to point of care devices. Thus, a more rapid and handy detection method for diverse target proteins that could be performed by using a simple equipment is greatly demanded in their applications such as high throughput screening and early stage diagnosis. Fluorescence-based probes especially those utilize Förster resonance energy transfer (FRET) between fluorescent proteins (FPs), are widely used to monitor biological phenomena and biomolecular modifications 3. FRET efficiency is affected by the distance and orientation of fluorescence donor and fluorescence acceptor. Thus, it could be used to monitor the spatial relationships or conformational changes of interesting molecules. FRET-based probes are usually composed of reporter domain and sensory domain. Genetically encoded FRET-based probe provide powerful approaches to monitor dynamic changes of analytes in homogeneous solution, such as inside the cells. For example, Ca2+ as second messenger was detected by calmodulin-GFP variants fusion FRET probes in cells and even in vivo by using fluorescence microscopy4-6. Previously, an immunoassay principle based on the interchain interaction of antibody variable region (Fv = VH + VL), open sandwich immunoassay was devised as a powerful method to quantify low molecular weight antigens 7. The principle of open sandwich immunoassay has been applied to various assay formats 8. In order to reduce the manipulations in heterogeneous immunoassay, homogeneous immunoassay using antibody variable region as a sensor and a fluorescent protein pair as a reporter was established, and was named open sandwich fluoroimmunoassay (OS-FIA). To date, hen egg lysozyme9 and protein tyrosine phosphorylation10 were successfully detected by FP-based OS-FIA. Such genetically encoded FRET-based probes can be easily transferred from plasmid DNA clone to the form ready for the assay without significant loss of antigen binding affinity. It also provides a potential to be expressed in situ for live cell imaging. ACS Paragon Plus Environment

3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 19

However, the antibodies whose variable domains strongly interact with each other even in the absence of antigen are not suitable for OS-FIA. To device a more universal probe to detect various kinds of biomarkers, here we design a novel fluoroimmunoassay distinct from the OS-FIA principle. If the interaction between VH and VL is fairly strong to form a complex it will cause high FRET efficiency in the absence of antigen. Hence, we connected VH and VL by introducing disulfide bond to make disulfidestabilized Fv (dsFv). Once the antigen with sufficiently large size (several nm in diameter) was added, the decrease of FRET efficiency could be utilized as the indicator of antigen concentration. We named this novel assay based on an FP-antibody fusion FRET probe as “open flower” fluoroimmunoassay (OF-FIA). In this study, we demonstrate that OF-FIA using a simple FP-based FRET immunosensor probe could detect a clinically important protein antigen serum albumin (SA) by simple fluorescence spectroscopy.

Experimental Section Materials pIT2(29IJ6) phagemid encoding anti-SA single chain Fv originally selected by phage display biopanning was kindly provided by Dr. Ian Tomlinson 11, 12, and pCyPet-His and pYPet-His were from Dr. PS Daugherty13. The nucleotide sequences of each DNA primer used in this study are summarized in Table 1. KOD-plus-neo DNA polymerase and Ligation High Ver.2 were from Toyobo (Osaka, Japan). PureYield plasmid miniprep kit was from Promega (Tokyo, Japan). In-Fusion advantage PCR cloning kit and Talon metal affinity resin were form Takara Bio (Otsu, Japan). Human serum albumin (HSA) was from Sigma-Aldrich (St. Louis, MO), while bovine serum albumin (BSA) was from Rockland (Philadelphia, PA). All the water used was purified with Milli-Q (Millipore, Tokyo, Japan).

Construction of expression vectors CyPet-VH and YPet-VL The construction of two FP-antibody fusion expression plasmids pET30b_CyPet-G3S2-Fd(BGP) and pET_YPet-G3S2-Lch (BGP) is described in the Supporting Information. To replace the Fd and L chain genes encoded in these vectors, respectively, with anti-SA variable region genes, VH(SA) fragment was amplified form pIT2(29IJ6) plasmid by PCR using KOD-plus-neo DNA polymerase and the primers VH(SA)backAge and VH(SA)ForNot. The product was gel-purified, and digested with AgeI and NotI, and ACS Paragon Plus Environment

4

Page 5 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


inserted to pET30b_CyPet-G3S2-Fd(BGP) plasmid digested with the same enzymes, using Ligation high Ver.2, resulting in pET30b_CyPet-G3S2- VH(SA). VL(SA) fragment was amplified form pIT2(29IJ6) plasmid by PCR using the primers VL(SA)backSpe and VL(SA)ForBamH. The product was then inserted to SpeI- and BamHI- digested pET_Ypet-G3S2-Lch (BGP) plasmid, resulting in pET_Ypet-G3S2VL(SA).

CyPet/YPet-dsFv (FP2-dsFv) To make dsFv, the codons for VH(SA) at position 44 and VL(SA) at position 100 were substituted with that for cysteine (Cys) by QuikChange site-directed mutagenesis . The mutagenesis was performed using KOD-plus-neo polymerase and the primers VH(SA)G44C_back and VH(SA)G44C_for for VH, and VL(SA)Q100C_back and VL(SA)Q100C_for for VL. To combine the two cistrons into a single vector, CyPet-G3S2-VH(SA)G44C fragment was amplified by PCR using primers pET_SgrBack and pET_SgrHis6for. The PCR product was then inserted to SgrAI-digested pET_Ypet-G3S2-VL(SA)Q100C plasmid, resulting in pET_CyPet/YPet-dsFv.

Fluorescent Proteins with a dimer interface mutation The encoded residues of CyPet and YPet at position 206 were substituted with lysine (K) by QuikChange site-directed mutagenesis. The mutagenesis was performed using KOD-plus-neo polymerase and primer pairs CyPetA206K and CyPetA206K_rc for CyPet, and YpetA206K and YpetA206K_rc for YPet, respectively. To combine the two cistrons, CyPetA206K-G3S2-VH(SA)G44C fragment was amplified by PCR using primers pET_SgrBack and pET_SgrHis6for. The PCR product was digested by SgrAI, and inserted to pET_YpetA206K-G3S2-VL(SA)Q100C digested by the same enzyme, resulting in pET_mCyPet/mYPet-dsFv.

YPet with quenching mutations To make a dark YPet mutant, the residues of YPet at position 145 and position 148 were substituted with tryptophan (W) and valine (V), respectively, by QuikChange site-directed mutagenesis with KODplus-neo polymerase. The mutagenesis was performed using the primers Ypet-Y145W+H148V_Back and ACS Paragon Plus Environment

5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 19

YPet-Y145W+H148V_For. CyPet-G3S2-VH(SA)G44C fragment was inserted to the resulting plasmid as before, and named pET_CyPet/dYPet-dsFv. Insertion of (Gly3Ser)4 linker between FPs and variable domains (Gly3Ser)4 linkers with different restriction sites were obtained by overlap PCR with primers Ypet_BsrGI_GGGS4back and VH_AgeI_GGGS4For for Cypet-G3S4- VH(SA), and primers Ypet_BsrGI_GGGS4back and VL_SpeI_GGGS4For for Ypet-G3S4- VL(SA). The products were either inserted to AgeI- and BsrGI-digested pET30b_Cypet-G3S2- VH(SA)G44C plasmid, resulting in pET30b_Cypet-G3S4- VH(SA)G44C, or SpeI- and BamHI- digested pET_Ypet-G3S2- VL(SA)Q100C plasmid, resulting in pET_Ypet-G3S4- VL(SA)Q100C. Afterwards, Cypet-G3S4-VH(SA)G44C fragment was amplified by PCR using primers pET_SgrBack and pET_SgrHis6for. The product was then inserted to SgrAI-digested pET_Ypet-G3S2-VL(SA)Q100C plasmid, resulting in pET_Cypet/Ypet-G3S4dsFv(SA).

Protein expression and purification E. coli Rosetta-gami B(DE3) cells harboring one of the expression plasmid for CyPet-G3S2-VH and E. coli SHuffle T7 Express lysY cells harboring one of the expression plasmid Ypet-G3S2-VL were each grown in 200 mL LB broth (1.0% tryptone, 0.5% yeast extract, 1.0% NaCl, pH 7.0) at 30°C until A600 reached 0.5-0.6. The cells were added with 0.4 mM isopropyl-β-galactopyranoside (IPTG) and cultured for 16 h at 16°C, before harvest by centrifugation. The cells with CyPet-VH were suspended in 15 mL of extraction buffer (50 mM sodium phosphate, 300 mM NaCl, pH 7.0) and subjected to sonication. After centrifugation (10,000 g for 20 min), the clarified lysate was rotated with 0.1 mL Talon immobilized metal affinity resin (Clontech) for 2 h. The matrix was poured into a column, washed with 5 mL extraction buffer (50 mM sodium phosphate, 300 mM NaCl, 5 mM imidazole, pH 7.0). The CyPet-VH protein was eluted with 0.5 mL of elution buffer (50 mM sodium phosphate, 300 mM NaCl, 150 mM imidazole, pH 7.0). For the cells containing Ypet-G3S2-VL protein, the cleared lysate was incubated with 0.1 ml anti-Flag antibody agarose slurry (Wako) for 2 h, and washed with 10 mL PBS (10 mM phosphate, 137 mM NaCl, 2.7 mM KCl, pH 7.4). The protein was eluted with 0.2 mL PBS containing 150 µg/mL Flag (DYKDDDDK) peptide.


6

Page 7 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


E. coli Rosetta-gami B cells harboring the plasmids that expresses CyPet/YPet-dsFv and other mutant probes were grown in LB broth at 37°C until the A600 reached 0.5-0.6, followed by the addition of 0.4 mM IPTG, and cultured for 16 h at 16°C. The clarified lysate of CyPet/YPet-dsFv protein was purified by Talon beads then followed by anti-Flag antibody beads as described above.

Fluorescence measurement The probes, CyPet/YPet-dsFv, mCyPet/mYPet-dsFv and CyPet/dYPet-dsFv (final concentration, 100 nM each) were mixed with indicated concentration of either BSA, HSA or hen egg lysozyme (HEL) in PBS, pH 7.4. After incubation at 25°C for 20 min, the fluorescence intensity from 440 nm to 640 nm was recorded with excitation wavelength of 430 nm at 25°C, with the slit widths set to 5 nm each, using fluorescence spectrometer FP-8500 (Jasco, Tokyo, Japan). The fluorescence intensity ratio F525/F475 was calculated as an index of FRET efficiency. For the mutant probes, mCyPet/mYPet-dsFv and CyPet/dYPetdsFv, the same process was performed as described above. The dose-response curves were fitted to a four parameter equation y = a + (b - a)/(1 + (x/c)d) using Kaleida Graph ver. 4.1.3 (Synergy Software, Reading, PA). The EC50 values were estimated based on the c in the formula. The limit of detection (LOD) was obtained as the estimated antigen concentration that shows the mean blank value + 3 SD.

Results and Discussion Construction of CyPet/YPet-Fv (FP2-Fv) probe Previously, we made several antibody-FP fusion FRET probes based on open sandwich immunoassay principle8. In open sandwich immunoassay, antigen-dependent interaction between VH and VL is utilized, thus the FRET efficiency increases upon antigen addition. Based on this idea, construction of antibody-FP fusion FRET probe for serum albumins (SAs) was endeavored by tethering a donor fluorescent protein (FP) to the VH fragment, and an acceptor FP to the VL fragment, respectively. An optimized cyan-yellow FP pair for FRET, CyPet-YPet 13, was used as a donor FP and an acceptor FP, respectively, and they were tethered N-terminally to the V fragments. To connect each FP and V fragment, a flexible linker (GGGS)2 was inserted to avoid unfavorable steric hindrance.


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(a)

(b)

Page 8 of 19

(d)

(c)

(e)

Figure 1. Principle of the FP2-dsFv fusion FRET probe. (a) Scheme of Open-Flower fluoroimmunoassay (b) SDS-PAGE of purified probes stained by Coomassie Brilliant Blue. Lane 1: CyPet/YPet-dsFv without dithiothreitol (DTT) (heterodimer, ~81 kDa). Lane 2: CyPet/YPet-dsFv with 0.5 M DTT (CyPet-VH and YPet-VL, ~40 kDa). (c) SDS-PAGE with the same samples without boiling observed by a transilluminator. (d) Normalized fluorescence intensity at 475 nm, with excitation at 430 nm for 0.1 µM each of CyPet-VH and YPet-VL, with and without 50 µM BSA. (e) The same as (d) except that 0.1 µM FP2-dsFv was used with and without 50 µM HSA.

CyPet-VH and YPet-VL proteins that recognize SA together were expressed individually in E. coli with oxidized cytoplasm, which allowed disulfide bond formation within the cells. The two cell extracts were purified to near homogeneity with either metal affinity resin or anti-Flag antibody beads. When the purified probes were analyzed by 10% SDS-PAGE, a clear monomeric band was observed after CBB staining, and if the samples were loaded without boiling, the fluorescence derived of YPet-VL was clearly observed using a transilluminator with an excitation wavelength at 500 nm (Figure S1 in the Supporting Information). We then mixed the two fusion proteins with and without 50 µM bovine SA (BSA), and recorded for the fluorescence spectra with excitation at 430 nm. While the VH/VL interaction of this antibody is known ACS Paragon Plus Environment

8

Page 9 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to be slightly strengthened by the antigen12, behind our expectation, we observed small but significant antigen-dependent decrease in FRET efficiency (Figure 1d and Figure S-2a in the Supporting Information). We then reasoned that it is probably due to the disruption of CyPet-YPet dimer14 by the bound BSA. The Förster distance, at 50% energy transfer efficiency, for CyPet-YPet pair is reportedly 5.0 nm14. The approximate diameter of human SA (HSA) determined by crystal structure is 8 nm15 and that of BSA in solution determined by light scattering is 7.2 ± 0.2 nm16. Taken together, it is possible that the binding of large SA separates the FP pair interacting near the paratope apart, hence the energy transfer between the two FP is significantly reduced.

Construction and evaluation of CyPet/YPet-dsFv (FP2-dsFv) To visualize this SA-dependent FP separation more clearly, we decided to stabilize the VH / VL interaction of this antibody. It is known that many Fv are prone to dissociate into two V fragments at lower concentration, especially in the absence of antigen. Although this property is useful for open sandwich immunoassay, in this case such dissociation will lower basal FRET signal, and also its antigen dependency. Since our first trial to express FP-fused Fab fragment in E. coli cytoplasm was not successful (not shown), then we decided to introduce known Cys mutations17 to make a disulfide bond between VH and VL to stabilize the heterodimer. Namely, two mutations G44C (VH) and Q100C (VL), both in the conserved framework 17 were introduced to make a disulfide-stabilized Fv fragment (dsFv), while keeping minimal structural perturbation (Figure 1a). FP2-dsFv was expressed in E. coli Rosetta-gami B, an engineered strain to enhance both the expression of eukaryotic proteins and the formation of target protein disulfide bonds in the cytoplasm. Since CyPet-VH and YPet-VL have His and Flag tags at the C-terminus, respectively, FP2-dsFv complex was serially purified with metal affinity resin and anti-Flag antibody beads to remove non-bonded monomers and possible homodimers. Then the purified probes were analyzed by 10% SDS-PAGE (Figure 1, b and c). Lane 1 is the FP2-dsFv heterodimer with 81 kDa in molecular weight. Lane 2 is FP2dsFv heterodimer treated with dithiothreitol, where the disulfide bond between CyPet-VH and YPet-VL was cleaved. Monomers with ~40 kDa in molecular weight was clearly observed on the gel after CBB staining (Figure 1b). When the samples were loaded on the gel without boiling, the fluorescence of YPet was clearly observed with a transilluminator with an excitation wavelength at 500 nm (Figure 1c). Open-Flower fluoroimmunoassay ACS Paragon Plus Environment

9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 19

As an initial evaluation of FP2-dsFv as a fluorescent biosensor, the fluorescence spectra with and without SA were compared as before. The fluorescence intensity ratio (acceptor/donor) without antigen was increased from 2.3 for FP2-Fv to 14, clearly reflecting marked stabilization of Fv by the introduced disulfide bond. In addition, once 50 µM HSA was added, the FRET efficiency was more significantly decreased than observed for FP2-Fv probe (Figure 1e and Figure S-2b in the Supporting Information). Then the SA-dose dependencies of FRET were examined by adding each antigen by titration. The fluorescence intensity ratio Ypet/CyPet was taken as an index of FRET efficiency. The normalized fluorescence spectra were obtained by dividing the fluorescence intensity at 475 nm (Figure 2, a–c). Titration curves were obtained by plotting the antigen concentration on the X-axis and the fluorescence intensity ratio of YPet/CyPet on the Y-axis (Figure 2, d–f). As a control, hen egg lysozyme (HEL) was used as a non-relevant protein. As a result, the calculated IC50 value for BSA was 34.5 ± 2.1 μM, while that for HSA was 32.8 ± 1.0 μM. In addition, the LOD for HSA determined with three measurements was 0.55 μM. These values for HSA were sufficiently low to distinguish its normal range (3.4-5.4 g/dL ~ 0.50.8 mM) in human serum18. On the other hand, the addition of HEL showed negligible effect on FRET efficiency (Figure 2, c and f), confirming the specificity of the probe. The kinetics of FRET efficiency change was also examined. When 0.1 µM of FP2-dsFv probe was added with 30 µM HSA in the cuvette and fluorescence spectra were monitored at 2 min intervals, rapid decrease of the peak derived of acceptor was observed within 2 min, while gradual decrease of fluorescence intensity ratio followed for 10-15 min (Figure S-3 in the Supporting Information). The result showed that in spite of the binding of large protein and accompanying conformational change of the probe, FP2-dsFv gives a reasonably fast assay time practically useful as a fluorescent biosensor.


10

Page 11 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(a)

(b)

(d)

(c)

(e)

(f)

IC50=34.5±2.1 μM

IC50=32.8±1.0 μM

Figure 2. Normalized fluorescence intensity, taking donor intensity as a standard in the presence of indicated protein and their titration curve. (a-c) Antigen-dependency of fluorescence intensity normalized at 475 nm. (d-f) Titration curve of fluorescence intensity ratio. BSA (a, d), HSA (b, e) and HEL (c, f) were used as a target protein.

Effect of CyPet-YPet dimerization All the fluorescence proteins derived from Aequorea GFP possess hydrophobic patch, Ala206, Leu221 and Phe223 , which leads to dimerization19. Once a positively charged amino acid is introduced at Ala206, it prevents the protein from dimerization. In this study, both Ala206 of fluorescence donor and acceptor were substituted to Lys (K), to make monomeric variants mCyPet and mYPet, respectively, to investigate the effect of dimerization on FRET efficiency. As a result, the fluorescence intensity ratio derived of the probe declined dramatically form 13.5 for CyPet/YPet-dsFv to 3.6 (Figure S-3 in the Supporting Information) for mCyPet/mYPet-dsFv probe. Clearly, the very high FRET efficiency of YPet/CyPetdsFv probe was attributed to the high dimerization tendency of CyPet/YPet pair as reported previously 14. Furthermore, mCyPet/mYPet-dsFv probe almost completely lost its response to HSA. This result indicates ACS Paragon Plus Environment

11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 19

that acceptor/donor fluorescence intensity ratio of 3.4 is the minimum value obtainable by CyPet/YPetdsFv probe.

Construction of signal-on biosensors using dark YPet While the constructed FP2-dsFv probes so far showed antigen-dependent decrease in overall fluorescence intensity as well as the FRET ratio, signal-on type biosensor might be preferred in some applications. Previous report showed that fluorescence intensity of YFP introduced with Y145W/H148V mutations dropped to 3% of the wild-type YFP22. To make a signal-on biosensor, we replaced YPet with its Y145W/H148V mutant (dark YPet, dYPet) as a quencher, which receives energy form CyPet but emits far weaker fluorescence. This will give a biosensor with positive donor fluorescent response. The probes with two different donor FPs, CyPet and cerulean, were made for comparison, and they both demonstrated antigen-dependent fluorescence enhancement (Figure 3). When IC50 and LOD were calculated from the titration curve of relative fluorescence intensity at 475 nm, 21.2 ±3.6 μM, and 10 μM for CyPet/dYPet-dsFv and 14.5 ±3.2 μM, and 3 μM for cerulean/dYPet-dsFv were obtained, respectively. Compared with CyPet, cerulean showed ~2.5-fold higher fluorescence intensity and smaller spectral change, while keeping its maximum response. Furthermore, it showed somewhat higher sensitivity. Although it is not clear whether it is due to somewhat reduced dimerization tendency of cerulean-dYPet pair or not, this FP pair will be more suitable as a signal-on biosensor. Recently, Quenchbody, a novel biosensor based on the principle of fluorescence quenching by endogenous tryptophan in antibody variable domain was reported 20, 21. In the Quenchbodies, fluorescent dyes are typically incorporated at the N-terminal of antibody fragment by cell-free translation-mediated labeling system or by chemical labeling. Quenchbodies show antigen-dependent fluorescence increase due to the removal of quenching effect by antigen binding. It might be possible that here we succeeded in making “genetically encoded” Quenchbodies.


12

Page 13 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(a)

(b)

(c)

(d)

EC50= 21.2 ±3.6 μM

EC50= 14.5 ±3.2 μM

Figure 3. Fluorescent property of signal-on biosensors, with excitation at 430 nm in the presence of indicated concentration of HSA. Fluorescence spectra of (a) CyPet/dYPet-dsFv and (b) Cerulean/dYPetdsFv are shown. Titration curves of the fluorescence intensity at 475 nm for (a) and (b), normalized at 0 µM HSA are shown as (c) and (d), respectively. Averages of three measurements are shown.

Effect of linker length between FP and dsFv Although good antigen dependent fluorescent responses are obtained, it is not clear whether the length of the linkers between each FP and V region is optimal for the response and also sensitivity. To investigate on this issue, another CyPet/YPet-dsFv protein with two longer linkers (GGGS)4 was prepared as before (Figure S-5 in the Supporting Information). As a result, the new probe showed similar antigen HSA-dependent FRET decrease (Figure 4a). However, the observed change in the FRET index was significantly smaller than the original probe with (GGGS)2 linkers (Figure 4b). Both the dimerization ACS Paragon Plus Environment

13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 19

efficiency and its antigen-dependent abrogation were decreased, suggesting that the insertion of longer linker resulted in lower FP dimerization, which was less sensitive to antigen binding. Moreover, no significant change in IC50 (31.9 ± 2.3 µM) was observed. Hence, we concluded that the original 8-residue flexible linker had a nearly optimal property. Based on the crystal structure of FP dimer and the modeled structure of this Fv, a 3D model of FP2-scFv in the absence of bound antigen was built (Figure 4c). According to this model, the minimum length between the C-terminus (excluding 8 disordered C-terminal residues) and the N-terminus of the V region would be 26-27 Å. In the original construct, the length of the linker was 8+8+2 = 18 residues, including the C-terminal of FP and AgeI-derived Gly-Thr. Considering the commonly used length of the linkers used to connect VH and VL to make a single chain Fv (15-20 aa), and preliminary result for a shorter linker variant (GGGS)1 showing inefficient FRET signal, the (GGGS)2 linker is recommended as a first choice for those who will try OF-FIA for other antigen-antibody pairs.

(a)

(b)

(c)

VH

VL

Figure 4. Effect of linker length. (a) Normalized fluorescence spectra of FP2-dsFv with (GGGS)4 linkers in the presence of indicated HSA concentrations. Conditions are the same as in Figure 2. (b) HSA dose dependency of the longer linker probe (filled circle) is compared with the probe with (GGGS)2 linkers (open circle). (c) A model of FP2-dsFv in the absence of antigen. The dimeric FPs are drawn based on the structure for Venus (pdb 1myw), with their hydrophobic patch residues shown in space filling model. Fv is drawn based on the model made by WAM antibody modeling 23. The neighboring FP C-terminus (excluding disordered 8 residues) and the V region N-terminus are each connected by a dotted line.

Conclusions As an extension of FP-based open sandwich immunoassay, we developed a novel antibody-based FRET assay termed Open flower FIA, which could detect serum albumins with large signal change. The method is based on the dimerization propensity of GFP variants and its abrogation by bound antigen, and ACS Paragon Plus Environment

14

Page 15 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the FRET efficiency significantly decreased as antigen concentration increased. The FRET response was greatly improved after introducing a disulfide bond between the two variable region fragments VH and VL. The donor fluorescence can be also used as a signal-on biosensor, especially when dark YFP variant was used as an acceptor. Based on this approach, in theory, similar fluorescent probes will be easily constructed to other protein antigens of similar size. Since the antibody gene used in this study is derived of a human single chain Fv clone selected from a phage display library, use of other binders selected from this or similar scFv library, or from established hybridoma clones will be a straightforward and general way to construct assays to many protein biomarkers. Compared with conventional FRET probe pairs 9, 10, 24, 25, the FRET efficiency and response of this single molecule probe does not rely on probe concentrations and their balance. It means subtle spectral change can be quantitatively tracked. Hence, the novel probe has a great potential as a diagnostic reagent, and possibly for bio-imaging. In future, it might provide a powerful approach in cellular engineering field such as monitoring hepatic differentiation of mesenchymal stem cells.

Associated Content Supporting Information. Supporting methods. Figures for the expression of CyPet-VH/YPet-VL, raw fluorescence spectra, fluorescence time course, the effect of monomer mutation, and expression of FP2-dsFv with different linker lengths. This material is available free of charge via the Internet at http://pubs.acs.org.

Author Information Corresponding Author

*E-mail: [email protected].

Acknowledgment ACS Paragon Plus Environment

15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 19

We thank Dr. Ian Tomlinson and Dr. Patrick S. Dougherty for kindly providing pIT2(21IJ6) and pCyPetHis / pYPet-His plasmids, respectively. This study was supported by a Grant-in-Aid for Scientific Research (B24360336), and a Grant-in-Aid for Challenging Exploratory Research (25123456) from Japan Society for the Promotion of Science.

References

(1)

Biomedical, F. Clin. Pharmacol. Ther. 2001, 69, 89-95.

(2)

Rifai, N.; Gillette, M. A.; Carr, S. A. Nat. Biotechnol. 2006, 24, 971-983.

(3)

Clegg, R. M. Curr. Opin. Biotechnol. 1995, 6, 103-110.

(4)

Miyawaki, A.; Llopis, J.; Heim, R.; McCaffery, J. M.; Adams, J. A.; Ikura, M.; Tsien, R. Y. Nature 1997, 388, 882-887.

(5)

Truong, K.; Sawano, A.; Mizuno, H.; Hama, H.; Tong, K. I.; Mal, T. K.; Miyawaki, A.; Ikura, M. Nat. Struct. Mol. Biol. 2001, 8, 1069-1073.

(6)

Krebs, M.; Held, K.; Binder, A.; Hashimoto, K.; Den Herder, G.; Parniske, M.; Kudla, J.; Schumacher, K. The Plant Journal 2012, 69, 181-192.

(7)

Ueda, H.; Tsumoto, K.; Kubota, K.; Suzuki, E.; Nagamune, T.; Nishimura, H.; Schueler, P. A.; Winter, G.; Kumagai, I.; Mahoney, W. C. Nat. Biotechnol. 1996, 14, 1714-1718.

(8)

Ueda, H. J. Biosci. Bioeng. 2002, 94, 614-619.

(9)

Arai, R.; Ueda, H.; Tsumoto, K.; Mahoney, W. C.; Kumagai, I.; Nagamune, T. Protein Eng. 2000, 13, 369-376.

(10)

Sasajima, Y.; Aburatani, T.; Sakamoto, K.; Ueda, H. Biotechnol. Prog. 2006, 22, 968-973.

(11)

de Wildt, R. M.; Mundy, C. R.; Gorick, B. D.; Tomlinson, I. M. Nat. Biotechnol. 2000, 18, 989-994.

(12)

Aburatani, T.; Ueda, H.; Nagamune, T. J. Biochem. (Tokyo). 2002, 132, 775-782.

(13)

Nguyen, A. W.; Daugherty, P. S. Nat. Biotechnol. 2005, 23, 355-360. ACS Paragon Plus Environment

16

Page 17 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(14)

Ohashi, T.; Galiacy, S. D.; Briscoe, G.; Erickson, H. P. Protein Sci. 2007, 16, 1429-1438.

(15)

Sugio, S.; Kashima, A.; Mochizuki, S.; Noda, M.; Kobayashi, K. Protein Eng. 1999, 12, 439-446.

(16)

Wang, S.; Chen, K.; Li, L.; Guo, X. Biomacromolecules 2013, 14, 818-827.

(17)

Brinkmann, U.; Reiter, Y.; Jung, S.-H.; Lee, B.; Pastan, I. Proc. Natl. Acad. Sci. USA 1993, 90, 7538-7542.

(18)

2013.

(19)

Zacharias, D. A.; Violin, J. D.; Newton, A. C.; Tsien, R. Y. Science 2002, 296, 913-916.

(20)

Abe, R.; Ohashi, H.; Iijima, I.; Ihara, M.; Takagi, H.; Hohsaka, T.; Ueda, H. J. Am. Chem. Soc. 2011, 133, 17386-17394.

(21)

Abe, R.; Jeong, H.-J.; Arakawa, D.; Dong, J.; Ohashi, H.; Kaigome, R.; Saiki, F.; Yamane, K.; Takagi, H.; Ueda, H. Sci. Rep. 2014, 4, 4640.

(22)

Ganesan, S.; Ameer-Beg, S. M.; Ng, T. T.; Vojnovic, B.; Wouters, F. S. Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 4089-4094.

(23)

R.J.Whitelegg, N.; R.Rees, A. Protein Eng. 2000, 13, 819-824.

(24)

Ohiro, Y.; Arai, R.; Ueda, H.; Nagamune, T. Anal. Chem. 2002, 74, 5786-5792.

(25)

Ohiro, Y.; Ueda, H.; Shibata, N.; Nagamune, T. Anal. Biochem. 2007, 360, 266-272.


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 19

Table 1. Nucleotide sequences of primers used in this study. Primer name VH(SA)backAge VH(SA)ForNot VL(SA)backSpe VL(SA)ForBamH VH(SA)G44C_back VH(SA)G44C_for VL(SA)Q100C_back VL(SA)Q100C_for pET_SgrBack pET_SgrHis6for CyPetA206K CyPetA206K_rc YPetA206K YPetA206K_rc YPetY145W+H148V_Back YPet-Y145W+H148V_For YPet_BsrGI_GGGS4back VH_AgeI_GGGS4For VL_SpeI_GGGS4For

Nucleotide sequence (5′–3′) tggcggttcaaccggtgaggtgcagctgttg tgctcgagtgcggccgcgctcgacacggtgacca ggcgggactagtgacatccagatgacc atgtgcggatccccgtttgatttccac gctccagggaagtgcctggagtgggtctca gagacccactccaggcacttccctggagc cctgcgacgttcggctgcgggaccaaggtgg ccaccttggtcccgcagccgaacgtcgcagg caaccgcacctgtggcgccg gtggccggcatcaccggcgtcagtggtggtggtggtggtg gacaaccattacttatccactcaatctAAAttatctaaagatccaaacgaaaagagag ctctcttttcgtttggatctttagataaTTTagattgagtggataagtaatggttgtc cagacaaccattacttatccTAtcaatctAAAttatTcaaagatccaaacgaaaagagag ctctcttttcgtttggatctttgAataaTTTagattgaTAggataagtaatggttgtctg actggaactctgtcaatgtttacatcactgctgac tgacagagttccagttgtattccaatttgtgacct gggtatggatgaattgtacaaaggtggcggttcaggtggcgggagcggcg caacagctgcacctcaccggttgaaccgccacctgaacctccgccgctcccgc ggtcatctggatgtcactagttgttgaaccgccacctgaacctccgccgctcccgc


18

Page 19 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for TOC only

430 nm


19

Open Flower Fluoroimmunoassay: A General Method To Make

Recommend Documents