Oppositely Charged Polyurethane Microspheres ... - ACS Publications

Subscriber access provided by UNIV OF DURHAM

Article

Oppositely Charged Polyurethane Microspheres with Tunable Zeta Potentials as an Injectable Dual-Loaded System for Bone Repair Yi Hou, Nan Jiang, Li Zhang, Yubao Li, Yuezhong Meng, Dongmei Han, Chen Chen, Yuan Yang, and Song Zhu ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b06673 • Publication Date (Web): 13 Jul 2017 Downloaded from http://pubs.acs.org on July 19, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Oppositely Charged Polyurethane Microspheres with Tunable Zeta Potentials as an Injectable Dual-Loaded System for Bone Repair Yi Houa†, Nan Jiangb†, Li Zhanga*, Yubao Lia, Yuezhong Mengc, Dongmei Hanc, Chen Chena, Yuan Yangd, Songsong Zhub* a

Analytical & Testing Center, Sichuan University, Chengdu 610064, PR China

b

State Key Laboratory of Oral Diseases and Department of Oral and Maxillofacial Surgery, West

China Hospital of Stomatology, Sichuan University, Chengdu 610041, PR China c

The Key Laboratory of Low-carbon Chemistry & Energy Conservation of Guangdong Province /

State Key Laboratory of Optoelectronic Materials and Technologies, School of Materials Science and Engineering, Sun Yat-sen University, Guangzhou 510275, PR China d

Institute of Biomaterials and Biomedical Engineering, University of Toronto, Toronto M5S 3E3,

Canada

KEYWORDS: Polyurethane, Oppositely charged microspheres, Electrostatic interaction, Self-assembly, Bone repair ABSTRACT: To effectively repair irregular shaped bone defects by minimally invasive procedure, exploring an injectable gel to fill the defect is desirable. Herein, positively and negatively charged polyurethane microspheres (PU-A and PU-B) with adjustable zeta potentials as well as the hydroxyapatite-loaded PU microsphere (PU-A/HA) and the dexamethasone-loaded PU microsphere (PU-B/Dex) were successfully prepared, and the oppositely charged microspheres could self-assemble into injectable gels with 3D structures by muturally electrostatic attraction. The self-assembly PU-A/HA+PU-B/Dex gel exhibited a much higher elastic modulus (about 0.20 MPa) and excellent shear-thinning and self-recovery behaviors, which would make the gel be injected to fill the irregular defect through a fine syringe. The in † These authors contribute equally to this work. * Corresponding authors. Tel.: +86 28 85411552. E-mail addresses: [email protected] (Li Zhang), zss [email protected] (Songsong Zhu).

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

vitro and in vivo experiments demonstrated that the co-existence of HA and Dex in PU-A/HA+PU-B/Dex gel had a synergistic effect on cell differentiation and accelerating new bone formation, displaying a good prospect as an injectable gel for bone repair in minimally invasive surgery.

1. INTRODUCTION Over the past few decades, tissue engineering has provided a promising approach for the repair and regeneration of bone defects. Recently, there has been increasing interest in a self-assembly technology1-3 which involves the preparation of injectable material with shape-specific three-dimensional (3D) structure to fill tissue defects or wounds of irregular size and shape.4, 5 From a clinical perspective, injectable material allows for easy manipulation and minimally invasive procedures by surgeons,6 which could reduce the risk of infection and scar formation, lower the cost of treatment and improve patient comfort.7,

8

In current practice, injectable scaffolds are polymerized or

chemically crosslinked in order to stiffen the material. However, these scaffolds often have limited clinical application, as toxic chemical agents used during the process of solidification may adversely affect the scaffolds, destabilize activity of the encapsulated biomolecules, or pose toxicity concerns.9, 10 In order to overcome these deficiencies, physical cohesion forces between inter-particles such as the Van der Waals force,11 hydrophobic interactions,9 electrostatic force,12, 13 magnetic force,14 and so on, can be exploited to induce self-assembly of micro- or nano-particles into integrated scaffolds. Previous reports have shown that poly(lactic-co-glycolic acid)


Page 2 of 34

Page 3 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(PLGA) and gelatin particles self-assembled through electrostatic forces to form a 3-D network structure that was easily molded into the desired shape,10, 15 but weak bonding between these oppositely charged particles could result in a mechanical mismatch with surrounding tissues and poor stability, which would then affect tissue regeneration. It was concluded that if we could explore the oppositely charged microspheres with adjustable zeta potentials making the microspheres self-assemble into a block with adjustable bonding strength, perhaps the above-mentioned problems could be overcome. Polyurethane (PU) is a large family of versatile polymers whose properties are highly influenced by their segments. They have been widely used as biomaterials owing to their excellent physical properties, good biocompatibility and high bioactivity that benefit cell growth and proliferation.16-18 PU has been extensively studied as microspheres, scaffolds and injectable materials and widely used in many applications.19-22 Previous studies have proven that microcapsules or microspheres allow for efficient loading of guest materials such as proteins,23 drugs,24 bioactive molecules,25 and so on.

For this reason, PU microspheres have displayed great

potential for application in the fields of controlled release, medical diagnosis, chemical protection, etc. Hydroxyapatite (HA) with excellent biocompatibility and high bioactivity has been widely used for bone repair and regeneration due to its similar composition to the apatite found in natural bone.26-28 HA can be compounded with PU to prepare



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 34

composite microspheres. In addition, dexamethasone (Dex), a synthetic steroidal anti-inflammatory drug,29 has been reported to induce the initiation of bone marrow cell differentiation and also direct cells toward terminal maturation at the late stage of differentiation,30, 31 and can be used as a model bioactive molecule32 encapsulated in polymer microspheres. The application of injectable materials double-loaded with HA and Dex appears to be the best strategy to promote cell differentiation and produce sufficient drug exposure for proliferating cells in the medullary cavity for extended periods, in order to have a good effect on bone repair in minimally invasive treatment. Oppositely charged PU microspheres with tunable zeta potentials and double-loaded PU microspheres (PU-A/HA and PU-B/Dex) were prepared, in the hope that they would self-assemble into an injectable scaffold with a 3D structure just by being mixed together. The self-assembling mechanism, the stack structure, rheological behavior, and immersion experiment in different mediums of gels as well as its possible applications in the field of bone repair will be investigated and assessed.

2. EXPERIMENTAL SECTION 2.1 Fabrication of microspheres and self-assembled gels 2.1.1 Materials. Isophorone diisocyanate (IPDI), 2,2-dimethylol propionic acid (DMPA),

methyldiethanolamine

(MDEA),

N,N-Dimethylformamide

(DMF),

polytetra-methylene-ether-glycol (PTMG, Mw 2000) and dexamethasone (Dex) were purchased from Shanghai Aladdin Co. Ltd., China. Triethylamine (TEA) and acetic acid (HAC) were purchased from the Chengdu Kelong Co. Ltd., China.


Page 5 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.1.2 Synthesis of charged PU microspheres. Oppositely charged PU microspheres were prepared by using the self-emulsification method.33 First, 26.67 g of IPDI was mixed with PTMG-2000 in a 250 mL three-neck flask under nitrogen atmosphere with thorough stirring, and the reaction was maintained at 80 °C for 3 h to obtain the pre-polymer. Then, the mixture was cooled to 50 °C, and a certain amount of MDEA (12.5, 15.0 and 17.5 mol%, respectively) as the cationic chain-extender or DMPA (12.5, 15.0 and 17.5 mol%, respectively) as the anionic chain-extender was added to the mixture under stirring for 2 h, respectively (in which DMPA was dissolved in 8 mL DMF). After that, HAC or TEA was added to the reactor and mixed thoroughly for 5 min to neutralize the amine groups or the carboxyl groups, respectively. Distilled water was added with vigorous stirring for 2 h to obtain cationic or anionic PU microspheres (PU-A or PU-B) emulsion. Herein, the molar ratio NCO/OH was 3, and the solid content of the dispersions was 30 w/v%. The suspension was washed centrifugally (5000 rpm for 8 min) 3 times by deionized water to remove impurities. After being freeze-dried, microspheres were stored at room temperature for further use. 2.1.3 Preparation of HA-loaded cationic PU microspheres and Dex-loaded anionic PU microspheres. HA powder was prepared as previously reported.21 The SEM images and the size distribution curve of HA was shown in Figure S1 and S2. HA-loaded cationic PU microspheres (PU-A/HA) were prepared according to the almost same procedure as PU-A synthesis described above, but just adding 15 wt%



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

HA to the chain-extended cationic PU solution. In particular, 17.5 mol% of DMPA was selected here. In addition, Dex-loaded anionic PU microspheres (PU-B/Dex) were also prepared as the same procedure as PU-B synthesis described above, except for the addition of 8 wt% Dex (4.8% w/v, dissolved in DMF) to the chain-extended anionic PU solution, here we also selected 17.5 mol% of MDEA. 2.1.4 Self-assembly gels of oppositely charged PU microspheres. Lyophilized microspheres were dispersed in deionized water with 30 w/v% solid content. Gels made up of oppositely charged PU microspheres were prepared by mixing the equal weight percent of PU-A and PU-B microspheres with the same volume. The injectability of these gels was assessed by extruding them through a syringe and the photos were also taken after equilibration for about 1 min. 2.2 Characterization of microspheres and self-assembled gels 2.2.1 IR analysis. PU microspheres prepared with different concentration of chain-extender were characterized by IR in order to analyze the composition changes in the molecule chains. The FTIR spectra were obtained over a wavenumber range of 4000–400cm-1 using an infrared spectrometer (Nicolet 6700, Thermo Scientific, USA) at room temperature. 2.2.2 SEM observation. These microspheres were observed by scanning electron microscopy (JSM-6500LV, JEOL, Japan). 2.2.3 Charge of microspheres. The zeta potential of PU-A and PU-B were measured using the zeta dynamic light scattering system (ZS90, Malvern Instruments Ltd., UK)


Page 6 of 34

Page 7 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by dispersing particles in ultrapure water (pH=7.0). 2.2.4 Size of microspheres. Laser particle analyzer (Bettersize2000E, Bettersize instruments Ltd., China) was used to measure the particle size by dispersing PU-A or PU-B in deionized water. 2.2.5 DSC analysis. Differential scanning calorimetry (DSC, STA449F3, NETZSCH, Germany) was used to analyze the thermal behaviors of PU microspheres. All samples were run at 10 °C/min through a heating cycle from 25 °C to 550 °C. 2.2.6 CLSM observation. Confocal laser scanning microscope (CLSM, LSM700, Carl Zeiss, Oberkochen, Germany) was used to observe the structure of colloidal gels in solution. PU-A microspheres were dyed with Fluorescein isothiocyanate (green) and PU-B microspheres were dyed using rhodamine B (red). 2.2.7 Immersing experiment. The experiments were repeated three times with plasma substitute (Hydroxyethyl starch 130/0.4 and sodium chloride, Fresenius Kabi, China) and blood from healthy donors. Gels (PU microspheres with 17.5 mol% chain-extender) were injected to tubes filled with plasma, plasma substitute, red blood cells and whole blood with anticoagulants, respectively. The measurements were conducted under 37 °C using a thermostat-controlled water bath. Immersion experiments were terminated after 24 h and the samples were cleaned for rheological test. 2.2.8 Dex entrapment efficiency in PU-B. The concentration of Dex was determined using UV spectrophotometer (WFZ UV-2100, Unico (Shanghai) Instrument Co. Ltd.,



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

China) at the wavelength of 237 nm. First, Dex was dissolved in ethanol to determine the stadard curve. Then, 10 mg Dex-carrying PU-B microspheres were dissolved in 10 mL ethanol to analyze the Dex content according to the determined standard curve. The loading efficiency (%) was determined based on the ratio of the amount of encapsulated Dex to the initial amount. All measurements were conducted in triplicate. 2.2.9 In vitro drug release. PU-B/Dex and PU-A/HA+PU-B/Dex (1 mg) were respectively placed in 3 mL vial containing 2 mL of phosphate-buffered saline (PBS, pH=7.4) at 37 °C for up to 32 days.24, 34 The PBS solution was collected and replaced with fresh PBS at predetermined time interval. The cumulative releasing amount of Dex was determined by UV spectrophotometer at 242 nm based on the Dex standard curve. The Dex standard curve was established accroding to previous report.32 Each release experiment was performed in triplicate. 2.2.10 Rheological characterization. The rheological behaviors of self-assembled gels were characterized by rheometer (DHR-2, TA Instruments Ltd., USA). All measurements were performed using a Flat steel plate geometry (30 mm in diameter) with a gap distance of 1000 µm was used in this experiment at 25 °C. First, the oscillatory time sweep test was used to determine the viscoelastic properties of gels (5 min, 1 Pa stress, 1 Hz frequency). Then, the viscosity of self-assembly gels was evaluated with increasing rate of shear force by stepped flow test (10-200 1/s, 1 Hz frequency). Next, the recoverability of self-assembly gels after network destruction


Page 8 of 34

Page 9 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was assessed according to previous reports.15, 35 The storage modulus (G’) and loss modulus (G’’) of self-assembly gels were measured by oscillatory time sweep experiments (5 min, 1% strain, 1 Hz frequency) before severe destruction of the gel network (1 min, 1000% strain, 1 Hz frequency), after that the former oscillatory time sweep mode was restored (3 min, 1% strain, 1 Hz frequency). 2.3 In vitro cell behaviors 2.3.1 Cell isolation and culture. All animal experiments were conducted in accordance with the standards of the Animal Research Committee of the West China School of Stomatology, Sichuan University. Bone marrow stromal cells (BMSCs) were isolated from 4-week-old male Sprague-Dawley rats as follows. After procedural euthanasia, the femurs of these rats were detached aseptically and soft tissues were cleaned. BMSCs were harvested from the metaphysis of both ends and subsequently cultured in alpha-modified Eagle’s medium (α-MEM, Gibco, Gaithersburg, MD, USA), which was supplemented with 10% fetal bovine serum (FBS, Gibco). The cells were incubated in a humidified atmosphere of 95% air and 5% CO2 at 37 °C. After 48 h, the unattached cells were rinsed away, and fresh culture medium was added. After changing the culture medium every 2-3 days, the cells were trypsinized using 0.25% trypsin (Sigma-Aldrich Co. LLC., USA) and subcultured when reaching 80-90% confluence. 2.3.2 SEM observation. The cells were seeded onto the four groups (Group a-d, PU-A+PU-B; PU-A/HA+PU-B; PU-A+PU-B/Dex; PU-A/HA+PU-B/Dex) with a cell



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

density of 2×105 cells/well and observed by SEM (Hitachi S-3400 NII, Japan). After 4 h of culture, the samples were washed by much PBS to remove the unattached cells and fixed with 2.5% glutaraldehyde (Sigma-Aldrich) for 2 h. The fixed cells were then dried using an EMS 850 critical point dryer (Electron Microscopy Science Co., Hillsboro, OR, USA) and sputter-coated with a palladium layer using a JFC-1600 ion sputtering apparatus (Electronics Co., Ltd, Saitama, Japan) for SEM examination. 2.3.3 Cell proliferation. Cell viability on the four groups (Group a-d, PU-A+PU-B; PU-A/HA+PU-B; PU-A+PU-B/Dex; PU-A/HA+PU-B/Dex) was determined using a 3(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay (MTT, M-2128, Sigma-Aldrich) after culturing for 1, 3, 5 and 7 day(s). After disinfection by ultraviolet light, samples were installed into 24-well culture plate and BMSCs were inoculated on them. The MTT solution (10 mg/ml) was applied and co-incubated with cells for 4 h. The optical density was measured applying an Anthos 2010 spectrophotometer (Biochrom, Cambridge, UK) and the excitation wavelength was set at 490 nm. A total of 5 samples for each group were detected at each time point, and the final data were presented as mean value ± standard deviation. 2.3.4 CLSM observation of cell morphology. Cell morphology on the four groups after 4h seeding was investigated under a confocal laser scanning microscope (CLSM, LSM700, Carl Zeiss, Oberkochen, Germany). After cleaned by PBS three times, the cells were fixed in 4% paraformaldehyde for 30 min and permeabilized with 0.2% Triton X-100 (Sigma-Aldrich) for 15 min. Then, these BMSCs were incubated with


Page 10 of 34

Page 11 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


FITC-conjugated phalloidin for 20 min to stain them. Image J software (NIH, USA) was used to calculate the cell attachment area and quantize results. 2.3.5 Cell fluorescent staining. Cytoskeleton and alkaline phosphatase (ALP) expression on the four groups were investigated under a CLSM. Following incubation with the samples for 8h, the cells were processed with PBS, paraformaldehyde, and Triton X-100 (Sigma-Aldrich) same with the above. Subsequently, the cells were incubated with rhodamine-conjugated phalloidin, Alexa Fluor 488-conjugated anti-ALP antibody, and DAPI (Millipore, Billerica, MA, USA) for 20 min to stain them respectively. And after incubation with the samples for another 2 h to let cells adhere, the specimens were observed by CLSM. 2.3.6 Alkaline phosphatase detection. Cell early osteogenic differentiation on the four groups was evaluated by alkaline phosphatase (ALP) activity. After the samples were incubated for 1, 2, and 4 day(s), the cells were fixed by 4% paraformaldehyde (Sigma-Aldrich) and processed with an ALP kit (Beyotime, Shanghai, China). Then the cells were incubated with p-nitrophenyl phosphate (pNPP, Sigma-Aldrich) for 30 min, and the evaluation of ALP activity was measured through optical density by setting the spectrophotometer at 420 nm. 2.3.7 Quantitative real-time polymerase chain reaction. Various osteogenic factors expression, including runt-related transcription factor 2 (Runx2), osteocalcin (OCN), osteopontin (OPN), and collagen type I (COL I), was examined by quantitative real-time polymerase chain reaction analysis (qRT-PCR). After incubation with the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

four groups for 3, 7, 14 days respectively, the cells were detached by 0.25% trypsin-1 mm EDTA (Gibco BRL, Gaithersburg, MD, USA). Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed to cDNA applying a first-strand cDNA synthesis kit (Takara, Shiga, Japan). The mRNA expression of these osteogenic factors was detected by a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). GAPDH was set as the control of internal RNA. And based on the 2-∆∆Ct method,36 the relative expression level of the osteogenic factors was obtained. The primer sequences used in this study were listed as follows: Col-1 ID: 29393 rCol-1F

GCTGGCAAGAATGGCGAC

rCol-1R

AAGCCACGATGACCCTTTATG

161bp OCN ID: 25295 rOCNF

GGAGGGCAGTAAGGTGGTGA

rOCNR

ACGGTGGTGCCATAGATGC

183bp OPN ID: 25353 rOPNF

AACAGTATCCCGATGCCACA

rOPNR

TGGCTGGTCTTCCCGTTG

139bp


Page 12 of 34

Page 13 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Runx-2 ID: 367218 rRunx-2F

CAGGCGTATTTCAGATGATGACA

rRunx-2R

TAAGTGAAGGTGGCTGGATAGTG

192bp 2.4 In vivo experiments 2.4.1 Implantation. Twelve male SD rats, 3-month-old with a weight of approximately 250 g were used in the animal experiment, which was approved by the Ethics Committee of West China Hospital at Sichuan University in compliance with all regulatory guidelines. A defect was created on both femurs from metaphysis to marrow cavity for each rat. The marrow cavity was filled with PU-A+PU-B, PU-A/HA+PU-B, PU-A+PU-B/Dex and PU-A/HA+PU-B/Dex gels, respectively, then the musculature and skin incision were closed with nylon sutures. The operation process of the surgery was shown in Figure S3. Each rat was given an intramuscular injection of penicillin per day during the first 3 days post-operation. Animals were sacrificed at 8 weeks after surgery for histological analysis. 2.4.2 Histological Observation. The harvested samples were fixed in 4% buffered paraformaldehyde, decalcified, dehydrated through gradient ethanol, cleaned in xylene, and embedded with paraffin wax, sectioned at 5 µm, and stained with Masson’s staining and Hematoxylin/eosin (HE) staining, then observed under optical microscopy. 2.5 Statistical Analysis.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Quantitative data are presented as the means ± standard deviation (SD). A one-way ANOVA and SNK test were used to determine the level of significance. p

Oppositely Charged Polyurethane Microspheres ... - ACS Publications

Recommend Documents