Optimization of an Unnatural Base Pair toward ... - ACS Publications

Sep 23, 2009 - Optimization of an Unnatural Base Pair toward Natural-Like Replication ... 5′-TAATACGACTCACTATAGGGAGA(Y). 3′-ATTATGCTGAGTGATATCCCTC...
2 downloads 10 Views 48KB Size
Optimization of an Unnatural Base Pair toward Natural-Like Replication [J. Am. Chem. Soc. 2009, 131, 3246–3252]. Young Jun Seo, Gil Tae Hwang, Phillip Ordoukhanian, and Floyd E. Romesberg* Page 3248. In Tables 1 and 2, the Template (Context I) should be as follows: 5=-TAATACGACTCACTATAGGGAGA(Y) 3=-ATTATGCTGAGTGATATCCCTCT(X)GCTAGGTTACGGCAGGATCGC Pages 3249-3250. In Tables 3 and 4, the Template (Context II) should be as follows: 5=-TAATACGACTCACTATAGGGAGC(Y) 3=-ATTATGCTGAGTGATATCCCTCG(X)TCTAGGTTACGGCAGGATCGC Page 3252. The final sentence describing Nucleotide Synthesis in the Experimental Section should read, “In each case anomeric mixtures of nucleosides were obtained and the β anomer was purified by column chromatography and confirmed by NOE and HOMO-COSY NMR spectroscopy (Supporting Information). JA907027A 10.1021/ja907027a Published on Web 09/23/2009

14596

9

J. AM. CHEM. SOC. 2009, 131, 14596–14596

10.1021/ja907027a CCC: $40.75  2009 American Chemical Society