Osteochondral Defects Healing Using Extracellular Matrix Mimetic

Subscriber access provided by Kaohsiung Medical University

Article

Osteochondral Defects Healing Using Extracellular Matrix Mimetic Phosphate/ Sulfate Decorated GAGs-Agarose Gel and Quantitative Micro-CT Evaluation Kausik Kapat, Arun Prabhu Rameshbabu, Priti Prasanna Maity, Abhisek Mandal, Kamakshi Bankoti, Joy Dutta, Deb Kumar Das, Goutam Dey, Mahitosh Mandal, and Santanu Dhara ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.8b00253 • Publication Date (Web): 18 May 2018 Downloaded from http://pubs.acs.org on May 18, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Osteochondral Defects Healing Using Extracellular Matrix Mimetic Phosphate/Sulfate Decorated GAGs-Agarose Gel and Quantitative MicroCT Evaluation

Kausik Kapat†ǂ, Arun Prabhu Rameshbabu†, Priti Prasanna Maity#, Abhisek Mandal*, Kamakshi Bankoti†, Joy Dutta†, Deb Kumar Das†, Goutam Dey†, Mahitosh Mandal†, Santanu Dhara†ǂ †

Biomaterials & Tissue Engineering Laboratory, School of Medical Science & Technology,

Indian Institute of Technology Kharagpur, Kharagpur-721302 #

Centre for Healthcare Science and Technology, Indian Institute of Engineering Science and

Technology, Shibpur, India, 711103 *

Department of Chemistry, Indian Institute of Technology Kharagpur, Kharagpur-721302

ǂ

Corresponding Author: K. Kapat; Email address: [email protected]; S. Dhara;

Email address: [email protected]; Tel.: +91-3222-282306; fax: +91-3222-255303

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Tissue engineering has a major emphasis in creating tissue specific extracellular ambiance by altering chemical functionalities of scaffold materials. Heterogeneity of osteochondral tissue necessitates tailorable bone and cartilage specific extracellular environment. Carboxylate and sulphate functionalized glycosaminoglycans (GAGs) in cartilage extracellular matrix (ECM) create an acidic ambience to support chondrogenic activity, while phosphate rich environment in bone enables chelation of calcium leading to the formation of mineralized matrix along with an alkaline environment to support osteogenesis. In this study, chitosan, a naturally occurring GAGs, was functionalized with phosphate/ sulfate groups analogous to bone/cartilage ECM and incorporated in thermogelling agarose hydrogel for delivery to osteochondral defects. In vitro studies revealed significantly higher adhesion and proliferation of adipose derived mesenchymal stem cells (ADMSCs) with blended hydrogels as compared to that of native agarose. Cell differentiation and RT-PCR studies of the phosphorylated hydrogels revealed higher osteogenic potential, while sulfated hydrogels demonstrated enhanced chondrogenic activity in comparison to agarose. Recovery of osteochondral defects after delivery of the thermoresponsive agarose-based hydrogels decorated with phosphorylated derivatives showed significantly higher bone formation. On the other hand, cartilage formation was significant with chitosan sulfate decorated hydrogels. The study highlights role of chitosan derivatives in osteochondral defect healing, especially phosphorylated ones as bone promoter, while sulfated ones as cartilage enhancer which was quantitatively distinguished through Micro-CT based non-invasive imaging and analysis. Keywords: osteochondral defects, extracellular matrix (ECM), glycosaminoglycans (GAGs), chitosan sulfate, chitosan phosphate, thermoresponsive hydrogel

2 ACS Paragon Plus Environment

Page 2 of 46

Page 3 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction In recent times, osteochondral defects (OCD) are common due to higher life expectancy and increase in elderly population. Traumatic injury, repetitive micro-trauma and other agerelated factors are often responsible for damage in the osteochondral region leading to severe joint pain, functional disability and reduced quality of life. Osteochondral defects healing is usually a slow process due to inadequate supply of reparative cells and biochemical factors in avascular cartilage.1 Among the available techniques, microfracture is commonly preferred for small osteochondral defects (< 2.5 cm2),2 while autograft transplantation or mosaicplasty is recommended for relatively larger defects (< 4.0 cm2).3 Autologous chondrocyte implantation (ACI) is the ultimate choice for restoration of hyaline cartilage.4 Very often microfracture leads to mechanically weak fibrocartilage formation; autograft transplantation causes additional damage to the healthy cartilage. For harvesting and re-transplantation of chondrocytes, ACI involves double surgical interventions which cause patients discomfort.5 Apart from this, cell apoptosis, dedifferentiation and hypertrophy are commonly associated with chondrocyte expansion culture. Moreover, treatment of OCD involves high cost and United States alone spends approximately $95 billion annually for OCD treatment.6 Tissue engineering combines biomaterials, living cells and growth factors to overcome challenges associated with the existing OCD therapies.7,8 One of the major objectives of tissue engineering is to mimic extracellular ambiance to tailor cell-ECM interaction, thereby cell activity in a tissue specific manner.9 Among the various physicochemical factors determining cell fate, chemical functionality plays significant role in regulating cell adhesion and differentiation, as demonstrated with hMSCs, embryonic and neural stem cells in earlier studies.10-12 Keselowsky et al. reported beneficial role of −OH and



−NH2 over −COOH and −CH3 functionalized surfaces towards osteogenesis.13 Curran et al. reported maintenance of hMSCs phenotype on glass silane-modified surfaces with –CH3 functionalities, osteogenesis was stimulated by –NH2 and –SH functionalities, whereas chondrogenic differentiation was promoted by –OH and –COOH functionalities.14 Liu et al. demonstrated osteogenic differentiation of ADMSCs on allylamine rich plasma polymerized surface.15 Glennon-Alty et al. reported chondrogenic differentiation of hMSCs preferably on amine-rich polyacrylate surfaces without supplementation of TGF-β.16 GAGs are emerging class of bio-macromolecules which remain projected from cell surface as well as embedded in ECM matrix, modulate cell behavior and morphology through different functional groups.17 Carboxylic and sulphate groups represent major functionalities of GAGs in native cartilage,18 while phosphate groups play major role in formation of mineralized ECM of bone owing to Ca2+ chelation ability.19,20 An acidic environment is created in articular cartilage due to presence of sulfated GAGs (chondroitin sulfate, keratosulfate, heparan sulfate, dermatan sulphate) and carboxyl groups in hyaluronic acid.21 These super-hydrophilic GAGs are able to withstand complex load by retaining substantial amount of water, while acidic ambience is necessary for chondrogenic activity.22-25 Similarly, bone ECM is enriched with inorganic calcium phosphate apatites.26 Non-collagenous phosphoproteins such as osteocalcin, osteopontin, osteonectin, bone sialoproteins etc. together with bone apatites create a phosphate–like an environment in bone.27 Such composite matrix is responsible for tensile and compressive properties of bone as well as maintaining alkaline environment for osteogenic activity.28-30 Number of studies demonstrated advantageous effects of sulfated GAGs,31 hyaluronic acid

32,33

and other derivatives of chitosan (CH)

34

for the restoration of bone and cartilage

defects. Sulfated and phosphorylated derivatives of CH were also explored in the past for restoration of osteochondral defects. Sulfated chitosan (CS) has more structural similarity to 4 ACS Paragon Plus Environment

Page 4 of 46

Page 5 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


chondroitin sulfate and keratosulfate, while phosphorylated chitosan (CP) shows functional mimicry to non-collagenous phosphoproteins owing to their ability to chelate calcium ions and biomineralize in the presence of simulated body fluid (SBF).35 Zhang et al. reported osteogenic properties of CS.36 Cao et al. demonstrated healing of critical bone defects using BMP-2 loaded CS nanoparticles, which also accelerated neo-vascularization.37 The study demonstrated synergistic role of CS as a bone-promoter in combination with bone morphogenic protein-2 (BMP-2). Tang et al. reported osteogenic stimulatory activity of CS and CP.38 In addition, osteoinductive property of CP was also reported by Zhu et al.,39 while Datta et al. described enhanced bone formation using CP nanofibrous scaffolds.40 Wang et al. reported osteoinductive properties of CP

41

and CS

42

based bone cement reinforced with

calcium phosphate. Polymeric hydrogels have been widely explored for osteochondral tissue engineering owing to their structural and functional mimicry to the native tissues.43-45 Benoit et al. demonstrated an increase in osteopontin (bone specific extracellular marker) production in phosphate-functionalized hydrogels while increase of collagen II (chondrogenic marker) production in acid-functionalized hydrogels.46 From the above discussion, it is evident that amino-polysaccharides could be functionalized into biomimetic ECM analogue for OCD healing. In this study, CH was functionally modified with sulfate and phosphate groups. CS and CP were incorporated in thermogelling agarose (AG) hydrogel matrix to create sulfate/ phosphate like environment. After physicochemical characterization of the hydrogels, osteogenic and chondrogenic ability of the hydrogels were evaluated through in vitro as well as in vivo studies and effects were compared with AG hydrogel as a control.



Materials Chitosan (710 kDa; degree of deacetylation > 90%) was purchased from Marine Chemicals (India) and SeaKem® LE agarose was purchased from Lonza (USA). All analytical grade reagents and solvents for synthesis were purchased from Merck. Cell culture chemicals including Dulbecco modified eagle medium (DMEM), fetal bovine serum (FBS), antibiotic/antimycotic solution, 0.25% trypsin–EDTA, collagenase I, TGF-β3 and 1% insulintransferrin-selenium (1X ITS) were purchased from Gibco (USA); LIVE/DEAD® Viability/Cytotoxicity Kit, rhodamine-phalloidin and DAPI were purchased from Invitrogen (USA); DNA Quantitation Kit (DNAQF), ascorbate-2-phosphate, β-glycerol-phosphate, dexamethasone, sodium pyruvate and L-proline were purchased from Sigma (USA). Sourcing of primary rabbit anti-collagen I and II specific antibodies were carried out from Abcam (USA) and alexa flour 488® goat anti-rabbit secondary antibody from Life Technologies (USA). RNASure Mini Kit and cDNA synthesis kit were purchased from Genetix Biotech (USA) and Thermo Fisher Scientific (USA), respectively. Methods Synthesis and characterization of CP and CS CP was synthesized according to Moedritzer et al.47 Briefly, CH (1 part) was dissolved in 1% v/v acetic acid to achieve final solution concentration of 2% w/v. Aqueous phosphorous acid (H3PO3, 1 part) was slowly mixed with CH solution under stirring and temperature was raised to 70 °C. Formaldehyde (HCHO, 1 part) was added to it and refluxed for 14 h. After cooling, white-colored CS was precipitated in ethanol and purified by reprecipitation. CS was synthesized according to Zhang et al.36 Briefly, 4% w/v CH solution was prepared in 2:3 mixture of formic acid (HCOOH) − formamide (FA) at 4 °C and added to 18 6 ACS Paragon Plus Environment

Page 6 of 46

Page 7 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ml sulfonating complex prepared by dropwise addition of chlorosulfonic acid (HClSO3) to dimethyl formamide (DMF) in 1:5 volume ratio under continuous stirring, maintained at 0–4 °C with inert atmosphere. After 2h reaction at 45 °C, the solution was neutralized with 20% aqueous NaOH and precipitated in acetone. The precipitate was re-dissolved in water, purified through dialysis for 48 h. The obtained polymers were lyophilized and subjected to Fourier transform infrared spectroscopic analysis (Nicolet 6700 FTIR Spectrometer, Thermo Scientific, USA) to identify different functional groups within 4000–400 cm−1. Polymers were dissolved in D2OCH3COOH and

13

C NMR (Ascend™-Bruker 600 NMR Spectrometer, Bruker, Switzerland)

was performed at 150.98 MHz frequency, 0.45 s acquisition time and 2 s relaxation delay. S/N and P/N ratio were obtained by energy dispersive X-ray spectroscopic (EDX) technique using scanning electron microscope (EVO 60, Carl Zeiss SMT, Germany). The viscosity average molecular weight (Mv) of sulfate and phosphate functionalized derivatives and native chitosan was estimated based on the Mark–Houwink equation. Mark–Houwink constants, K and a, were considered to be 8.2 x 10-4 and 0.72, respectively for CH in 0.3 M AcOH - 0.2 M NaOAc solvent system 48, 1.75 x 10-5 and 0.93, respectively, for CS in 0.1 M NaCl solvent system 49, whereas 1.81 x 10-5 and 0.98, respectively, for CP in 0.1 M AcOH–0.2 M NaCl 50. Hydrogel preparation and characterization CP, CS and AG solutions (2% w/v) were prepared in distilled water. AGCP and AGCS hydrogels were prepared by mixing an equal volume of AG solution with CP and CS solutions, respectively at 45 °C followed by gelation at room temperature (Figure 1).



Figure 1. Scheme for the preparation of AG, AGCP and AGCS hydrogel and lyophilized scaffolds for cell culture studies

Rheological studies The preformed hydrogels were placed on the lower plate of Bohlin CVO rheometer (Malvern Instruments, UK) for rheological assessment. The amplitude and frequency sweeps were performed at 25 ± 0.1 °C with a parallel plate geometry (20 mm spindle), maintaining gap of 1500 µm. Storage modulus (G′), loss modulus (G″), complex modulus (G*) and complex viscosity (η) values were acquired through frequency sweep at constant strain (γ) of 5% and shear rates from 0.1 to 10 s−1. Yield point of the gels was obtained from amplitude sweep at strain (γ) from 0.01 to 25%. Strain recovery study of each of preformed hydrogels (n=5) was performed at 1 Hz frequency using three repetitive strain cycles: 1% (150 s) − 100% (150 s), where duration is mentioned in parentheses. Hydrogel morphology and chemical composition The preformed hydrogels were frozen at − 20 °C for overnight and lyophilized to obtain dried scaffolds. Thin sections of dried samples were subjected to gold coating using plasma sputtering coater and observed under FE-SEM (Zeiss, Germany) for morphological analysis. EDX analysis and elemental mapping were also performed to determine elemental profile as well as the distribution of selected atoms.


Page 8 of 46

Page 9 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Porosity and pore size distribution The lyophilized samples were scanned (1000 scan slices/sample) using a by MicroComputed Tomography (Micro-CT, GE Phoenix v|tome|x, Germany) at operating voltage 90 kV, current 40 mA with a voxel size (resolution) of 3.8 microns. The porosity of each sample was measured by using VGStudio Max software (Volume Graphics Germany) by adjusting thresholds through the threshold histogram offered by the software. Further, pore size was analyzed from FE-SEM images using ImageJ (version 1.48h3; National Institutes of Health) software. The Gaussian distribution and average pore size were determined by using OriginPro 2015 (OriginLab) software. Functional groups FTIR were recorded for all dried samples by Nicolet 6700 FTIR spectrophotometer (Thermo Scientific, USA) in specular reflectance mode over a range of 4000–400 cm−1. Different functional groups were identified after necessary background corrections. Nano-topography and stiffness Topography and nanoscale roughness of the dried hydrogel samples were measured by using an atomic force microscope (Nanoscope V multimode 8 SPM, Bruker, USA) fitted with a silicon nitride cantilever (spring constant 0.4 N/m, tip radius 2 nm, half angle 18°) in intermittent contact mode at a scanning rate of 1 Hz. Before analysis, thin film was cast by pouring the hydrogel solutions on coverslips, immediately transferred to –20 °C and lyophilized for 12 h. After drying, the samples were kept in a desiccator. The surface roughness of the samples was reported as the root mean square (Rq) and average roughness (Ra). Stiffness and Young’s modulus of the samples were determined by fitting the stressstrain curves with Hertzian (Spherical) Model.



Swelling properties Swelling studies of the dried hydrogel samples (n = 3) were carried out by conventional gravimetric techniques under identical conditions. After measuring initial weight (Wd), the samples were submerged in PBS (pH 7.4) at 37 °C and weights in swelling condition (Ws) were measured after different time intervals until an equilibrium state is reached. Swelling ratio was calculated according to the formula: % Swelling = [(Ws – Wd)/ Wd] × 100 Biodegradation kinetics In vitro biodegradation profiles of preformed hydrogels were determined by enzymatic degradation. After measuring initial weights (Wd), the dried samples (n = 3) were submerged in 10 µg/ml lysozyme (Sigma) solution in 0.1 M PBS consisting of 0.05% NaN3 and incubated at 37 °C. The solution was replaced in every 3 days for 30 days study. Every day, samples were removed from the solution, air-dried and weight (Wf) was recorded. Percentage weight loss of the samples due to degradation was estimated according to the formula: % Weight loss = [(Wf – Wd)/ Wd] × 100 In vitro stem cell response Isolation of adipose derived mesenchymal stem cells (ADMSCs) Isolation of ADMSCs was carried out from human adipose tissue and cultured as per the protocol reported elsewhere.51 Necessary human ethical clearance was obtained from Indian Institute of Technology Kharagpur (No. IIT/SRIC/AR/2012 dt. 28.12.2012) and stem cell clearance was obtained from Institutional Committee for Stem Cell Research and Therapy (IC-SCRT) at Indian Institute of Engineering Science and Technology (IIEST) (No. ICSCRT/Decisions/3115 dt. 28.05.2015). Briefly, adipose tissues were collected from the donors and thoroughly washed with PBS containing 1% antibiotic-antimycotic solution, 10 ACS Paragon Plus Environment

Page 10 of 46

Page 11 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


chopped into small pieces and transferred to 15 ml falcon tube. Tissues were digested with collagenase solution (1 mg/ml) at 37 °C for 45-60 min. After digestion, collagenase was neutralized by adding DMEM low glucose containing 10% fetal bovine serum (FBS) and centrifuged at 800×g for pelletization. The obtained pellets were re-suspended in 1 ml RBC lysis buffer (160 mM NH4Cl in Tris buffer), incubated at 37 °C for 20 min followed by centrifugation at 400×g. The obtained pellets were re-suspended in complete DMEM low glucose and transferred to T-75 cell culture flasks (Nunc, USA) for culture and expansion. After 70% confluency, the cells were trypsinized with 0.25% trypsin–EDTA and used for further studies (upto five passages). Cell morphology, cytocompatibility and proliferation studies For cell morphology, proliferation and cytocompatibility studies, 5 × 104 cells were seeded per sample (diameter 15 mm × height 3 mm) in each well of 24-well plate, while 1 × 106 cells were seeded per sample (diameter 22 mm × height 3 mm) placed in each well of 12well plate for differentiation study. Medium change was done in every 72 h. Assessment of cell viability of ADMSCs seeded on different hydrogels was performed using LIVE/DEAD® Viability/Cytotoxicity Kit according to the manufacturer’s protocol. The rate of cell proliferation was evaluated on various days (1d and 7d) of culture by estimating total DNA contents using DNA Quantitation Kit as per manufacturer’s protocol. Cell adhesion and morphology was observed by rhodamine-phalloidin/DAPI staining according to the manufacturer’s protocol. Differentiation studies For osteogenic differentiation of ADMSCs, different hydrogels were seeded with 1 × 106 cells and cultured in presence of complete DMEM low glucose for 1 d, followed by osteogenic supplementation with DMEM low glucose containing 10% FBS, 1% 11 ACS Paragon Plus Environment


antibiotic/antimycotic solution, 10 mM β-glycerol-phosphate, 50 µM ascorbate-2-phosphate and 0.1 µM dexamethasone for another 21 d. Another set of cell seeded samples were supplemented with chondrogenic medium consisting of DMEM low glucose with 1% antibiotic/antimycotic solution, 50 µM ascorbate-2-phosphate, 100 nM dexamethasone, 1 mM sodium pyruvate, 50 µM L-proline, 10 ng/ml TGF-β3 and 1% 1X ITS for another 21 d. Media change was performed after every 72 h. Immunocytochemistry After 21 days of culture with osteogenic and chondrogenic supplementation, collagen I and collagen II secretion in ECM was detected by immunocytochemistry. Before staining, samples containing cells were fixed with 4% paraformaldehyde for 30 min, permeabilized with 0.1% Triton X-100 in PBS for 10 min and incubated with PBS containing 1% BSA for 60 min to block nonspecific staining. For immunostaining, samples were incubated with primary rabbit anti-collagen I and II specific antibodies (1:100) for overnight at 4 °C followed by washing with PBS and incubation with alexa flour 488® goat anti-rabbit secondary antibody solution (1:300) for 120 min at 4 °C under dark conditions. After washing with PBS, counter staining with DAPI was performed to visualize cell nucleus. After washing with PBS, fluorescent images were captured at λex/em of 488/519 nm for Alexa flour 488®, 350/470 nm for DAPI using AxioVision Zeiss fluorescence microscope. Reverse Transcriptase-PCR (RT-PCR) analysis After 21 days cell culture under lineage specific (osteogenic/chondrogenic) supplementation, total RNA was extracted from the cultured samples (n = 5) using RNASure Mini Kit following manufacturer's protocol and quantified using NanoVue Plus Spectrophotometer (GE Health Care, USA). Synthesis of cDNA was carried out from isolated total RNA using cDNA synthesis kit inside a thermal cycler (Eppendorf Mastercycler, USA).


Page 12 of 46

Page 13 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Gene specific primers were used to measure expression levels of osteogenic genes, such as collagen type 1 (COL I), osteocalcin (OCN) and osteopontin (OPN) as well as chondrogenic genes, such as aggrecan (ACAN), collagen type 2 (COL II) and SOX-9. The detail primer sequences and amplicon sizes are listed in table 1. PCR products were run through an EtBrtreated agarose gel (1%) using 1X TBE buffer and images of different marker specific bands of amplified DNA were captured using UV gel doc (Bio-Rad, USA). Band intensities were calculated by using ImageJ 1.48h3 (National Institutes of Health) software. Glyceraldehyde3-phosphate dehydrogenase (GAPDH), the housekeeping gene, was used to normalize the relative expression levels of the genes. Table 1. Primers designed for RT-PCR study Genes

Primer Sequences Forward 5'-3'

Reverse 5'-3'

Amplicon Size (bp)

Housekeeping GAPDH CCATGGAGAAGGCTGGGG

CAAAGTTGTCATGGATGACC

195

Osteogenic

Chondrogenic

COL I

CAACCTCAAGAAGGCCCT

TTACAGGAAGCAGACAGGGC

250

OPN

CCAGAGTGCTGAAACCCA

TTAATTGACCTCAGAAGATGCACT

250

OCN

ATGAGAGCCCTCACACTCCTC

GCCGTAGAAGCGCCGATAGGC

294

ACAN

TGCATTCCACGAAGCTAACCTT

GACGCCTCGCCTTCTTGAA

84

COL II

GGCAATAGCAGGTTCACGTACA

CGATAACAGTCTTGCCCCACTT

600

SOX 9

AGCGAACGCACATCAAGAC

GCTGTAGTGTGGGAGGTTGAA

110

Chick Chorioallantoic Membrane (CAM) Assay The potential of the hydrogels to induce vascularization was assessed through CAM assay in an ex vivo model. Briefly, fertilized white Leghorn chicken eggs were incubated in egg incubator maintained at 37 °C and 65% relative humidity. On the fourth day, CAM was exposed by partial removal of egg shell from the side of the air cell. Sterile hydrogels disks (5 mm, n=3) were placed on the top of the membrane and after that the egg shell was appropriately sealed. On the third day of scaffold implantation, the sealing was removed carefully and optical images were captured for further analysis. Three independent observers 13 ACS Paragon Plus Environment


counted the approaching blood vessels towards the scaffolds and the average values were reported. Animal study Male New Zealand white rabbits (n=3) of 12 months with an average weight of 2.5–3 kg were used to examine healing of the osteochondral defects in presence of different hydrogels (AG, AGCP, AGCS). All surgical procedures were approved by the Institutional Animal Ethical Committee of Indian Institute of Technology Kharagpur (No. IE-4/SDSMST/2.15 dt. 17.05.15). The acclimatized rabbits were anesthetized by ketamine hydrochloride injection and articular joints of the femoral condyles were opened and dislocated by parapatellar incision in the right leg of each rabbit. Three circular defects of 6 mm diameter x 6 mm depth were created by SS drill bit at the patellar grooves of the distal femur. Phosphate and sulfate gels (AGCP and AGCS) were immediately prepared under sterile conditions and maintained at 45 °C before they were injected to the defect site through an injection syringe. Similarly, agarose gels (AG) were prepared and injected into the defects as control for this study. The cut areas were closed by suturing the muscles with 3–0 absorbable catgut sutures and skin with 4–0 nonabsorbable vicryl sutures. After 12 weeks of implantation, rabbits were euthanized by an overdose of pentobarbital injection and bones samples were retrieved, microscopically evaluated for overall healing under stereo zoom microscope and fixed in 4% paraformaldehyde for further studies. Micro-CT evaluation The fixed bone specimens were subjected to 3D scanning (1000 scan slices/sample) of the region of interest (ROI) under Micro-CT (GE Phoenix v|tome|x, Germany) using X-ray beam (source voltage 75 kV, current 85 µA) and resolution (voxel size) of 24.2 µm. Qualitative and quantitative bone formation were analyzed from 3D Micro-CT images by


Page 14 of 46

Page 15 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


VGStudio MAX (Volume Graphics, Germany) software. Bone and cartilage area percentages from 2D slices were analyzed by MATLAB (MathWorks, USA) software. Statistical analysis For statistical investigation and interpretation of significant differences amongst control and implant groups, one-way ANOVA was performed using GraphPad Prism software (La Jolla, CA, USA) and the values were represented as mean (µ) ± standard deviation (σ). Results The obtained phosphate and sulphate functionalized derivatives of CH were slightly yellowish in color and soluble in deionized water at room temperature. Characterization of synthesized polymers The corresponding FTIR spectra for CH, CS and CP are shown in Figure 2(I). Chitosan exhibited characteristics peaks at 3460 cm-1 corresponding to OH and NH2 stretching, 1647 and 1599 cm-1 corresponding to C=O stretching in amide groups, 1384 cm-1 corresponding to –OH bending. After sulfonation reaction, new bands appeared at 1247, 1070, 1000, 806 and 586 cm−1 indicate successful incorporation of sulphate group in chitosan.52 The signals found at 1261–1266, 1226–1228 cm−1 was originating from asymmetric stretching and 1070 cm−1 from symmetric stretching of –SO2. Peak at 806 cm−1 was attributed to the C-O-S stretching and 580 cm−1 due to –SO2 deformation.36 A band close to 1000 cm−1 has been noted in all spectra of chitosan sulfate reported by different authors, is assigned to a sulfate group independent of substitution occurred at carbon or nitrogen. After phosphorylation, peaks appeared at 3400-3100 cm-1 was mainly due to –OH/–NH2 stretching. Sharp peaks at 1644 and 1547 cm-1 were due to antisymmetric and symmetric deformation of secondary amide groups. In addition, a new shoulder peak at 1260 cm-1 was due to 15 ACS Paragon Plus Environment


Page 16 of 46

asymmetric stretching of P=O and sharp peak at 904 cm-1 originated from P–OH stretching.53, 54 Chemical identities of the modified chitosan after sulfonation and phosphorylation were confirmed by

13

C NMR and the corresponding spectra are shown in Figure 2(II).

Chemical shifts at δ 22.87 (CH3), δ 56.62 (C2), δ 67.31 (C6), δ 73.26 (C3), δ 73.85 (C5), δ 75.00 (C4), δ 100.69 (anomeric C1) and δ 174.98 (C=O) were typical for chitosan disulfate bearing N-acetyl group and fairly match to the literature data.55,

56

On the other hand,

chemical shifts at δ 55.80 (C2), δ 59.89 (C6), δ 70.06 (C3), δ 74.77(C5), δ 76.30 (C4), δ 95.13 and δ 97.62 (anomeric C1) also closely match to the reported values of phosphorylated chitosan.57 Peaks at δ 174.91 and δ 21.98 ppm corresponds to the carbonyl and methyl groups, respectively and signifies residual acetyl groups of chitosan on amine functionality. In the spectrum, all the peaks were well distinct and attributed to all the six carbon atoms of pyranose ring. Absence of any other additional peaks corresponding to aldehydic and ketonic groups ruled out the possibilities of any decomposition of the pyranose ring or presence of any residual formaldehyde or acids.


Page 17 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (I) FTIR and (II) 13C NMR (150 MHz, D2O-AcOH, 20 mg/ml) spectra of (a) CP (b) CS (c) CH

EDX analysis revealed successful incorporation of phosphate and sulfate group into the CH molecule. CP was synthesized with a degree of substitution of 0.4 and phosphorous content of approximately 6.67% (by atom). On the other hand, CS had a degree of substitution of 0.72 with sulphur contents of 13.25% (by atom). The viscosity average



molecular weight (Mv) of sulfate and phosphate functionalized derivatives of chitosan was estimated to be 3.1 x 105 Da and 2.2 x 105 Da, respectively, based on the Mark–Houwink equation. On the other hand, native chitosan exhibited the value of 7.1 x 105 Da. Characterization of hydrogel Rheological studies Initially, linear viscoelastic region (LVR) for the preformed hydrogels were determined by applying strain over 0.01 − 100%, although the plot became erratic beyond LVR (0.01-10%) due to the breakdown of hydrogel network. Hydrogel strength was measured in terms of G' and G". Plots in Figure 3(I) illustrate the variation of G' and G" with frequency sweep. Notably, G' and G" were almost independent of frequency exhibiting characteristics of a typical gel structure. Also, G' values were always greater than G" at any given frequency (Table 2), indicating the elastic behavior of the hydrogels, similar to solids. While G* along with G' and G" were plotted against frequency sweep measurement, it was noted that the preformed gel also showed solid-like behaviour under dynamic condition as evidenced by increase in G*, similar to G’ response upto 10 Hz (Figure S1, Supplementary data). Plots in Figure 3(II) show changes in G' and G" with applied shear stress (σ) at 1 Hz frequency. Usually, G' values were found to be higher than G", but gradually decreased with the increase of σ values after a very short steady state. Yield stress (σy) represents the shear stress with a critical value where G" supersedes G' and hydrogel exhibits flowability.


Page 18 of 46

Page 19 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Rheological assessment of preformed hydrogels (a) AG (b) AG-CP (c) AG-CS by (I) frequency sweep and (II) amplitude sweep

Different yield stress (σy) values obtained for hydrogels are listed in Table 2. AG exhibited the highest yield stress (147.63 Pa) as compared to the other hydrogels in this study, signifying the highest gel strength. The values were significantly reduced below 20% to that of AG when 50% polymer was replaced with either CP or CS at a similar concentration is attributed to significant reduction in gel strength. This was mainly due to the reduction of chain length of the functionalized CH molecules. Table 2. Rheological properties of the preformed hydrogels Samples

AG AGCP AGCS

Amplitude sweep (at 1 Hz) σy (Pa) 147.63 31.94 24.21


Frequency sweep (at 1% strain) G'/G" 31.9 13.2 12.5


AG, AGCP and AGCS hydrogels were subjected to strain reversibility measurements applying sequential strain (100% strain) and relaxation (1% strain). This measurement shows two distinct lower and upper regions of complex modulus. Figure 4 shows that application of high oscillatory force (100%) causes disruption of AG hydrogel network and subsequent decrease of complex modulus from ~ 2.3 kPa to ~ 0.01 Pa. When strain is reduced to 1%, the hydrogel regains its initial network structure instantaneously along with increase in complex modulus values. This indicates self-healing properties of AG hydrogel from strain-induced damage. AGCP and AGCS hydrogels also exhibited similar properties but deformation and recovery occurred in much shorter range due to low complex modulus as compared to that of AG.

Figure 4. Complex modulus of step−strain measurements (strain reversibility plot) of preformed hydrogels (a) AG (b) AGCP (c) AGCS

Hydrogel morphology and chemical composition Initially, the preformed hydrogels had translucent appearance under hydrated conditions. After lyophilization, the hydrogels were subsequently transformed into white porous scaffolds. FE-SEM analysis of the lyophilized scaffolds revealed the presence of


Page 20 of 46

Page 21 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


interconnected porous network with distributed pores throughout the scaffolds, as shown in Figure 5. Chemical compositions of AG, AGCP and AGCS scaffolds were analyzed through by EDX analysis. Percentages of P and S were measured to be 2.09 and 0.82% (by atom) in AGCP and AGCS scaffolds, respectively. EDX mapping of AGCP and AGCS hydrogels revealed uniform elemental distribution of phosphorous and sulfur, respectively, throughout the scaffold surface (Figure S2, Supplementary data).

Figure 5. SEM morphology of the lyophilized scaffolds (a) AG (b) AGCP and (c) AGCS

Porosity and pore size distribution Micro-CT images of the porous lyophilized samples are shown in Figure 6(I). The total porosity of the samples (AG, AGCP and AGCS) was determined by Micro-CT and the values were found to be 92 ± 1 %, 83.3 ± 1.4 % and 95.6 ± 1.5 %, respectively. Pore size distributions of the samples were estimated by ImageJ analysis of 2D image frames obtained through FESEM analysis and found in the range of 35.8–324.0 µm, 25.3–293.6 µm and 25.4– 362.1 µm for AG, AGCP and AGCS scaffolds, respectively, as shown in Figure 6(II). The average pore size of AG scaffolds was estimated to be 124.1 ± 62.4 µm (d50 =106.1 ± 22.4 µm). With the decrease in porosity, average pore diameter in AGCP was subsequently reduced to 69.6 ± 36.6 µm (d50 = 48.7 ±12.6 µm). On the other hand, when CS was introduced into AG matrix (sample: AGCS) an increase in average pore size (117.6 ± 79.5 µm) (d50 =85.3 ± 15.5 µm) was observed due to the increase in total porosity.



Figure 6. (I) Micro-CT Images (black color represents background or voids, white color represents polymers strut) and (II) pore size distribution of lyophilized hydrogel scaffolds (a) AG (b) AGCP and (c) AGCS

Functional groups FTIR study revealed characteristic peaks of PO43- (1260 and 904 cm-1) and SO3(1247, 1070, 1000, 806, 586 cm−1) originating from CP and CS in AGCP and AGCS hydrogel, respectively apart from NH2 peaks (1647 and 1547 cm-1 for 2° amide) of CH backbone, −OH and −NH2 peaks at 3400-3100 cm-1 (Figure S3, Supplementary data). The bands at 1360 and 2927 cm-1 indicate C–H bending of the pyranose ring. Nano-topography and stiffness To compare surface properties, surface roughness, Young's modulus (E0) and stiffness values of thin hydrogel samples were measured by AFM in tapping mode. The results were listed in Table 3. Representative AFM micrographs of different hydrogels were shown in Figure 7a-c. Initially, RMS roughness (Rq) value of AG was found to be 7.6 ± 0.8 nm. There was an insignificant change in roughness values after mixing of AG with CP (Rq = 8.1 ± 1.5 nm) or CS (Rq = 6.2 ± 1.3 nm) in 1:1 ratio. However, AGCP was having higher roughness than AGCS.


Page 22 of 46

Page 23 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. (a)-(c) AFM micrographs and (a')-(c') force versus indentation displacement curves obtained after analysing lyophilized AG, AGCP and AGCS scaffolds, respectively

Figure 7a'-c' represents conventional force versus indentation displacement curves obtained for AG, AGCP and AGCS, respectively. From these images, it was also noticed that AFM tip experienced relatively low adhesion force on AG surface, therefore less stickiness in comparison to that of AGCP and AGCS surface. The curves were fitted in the linear region by modified Hertz model to obtain Young's modulus (E0) values. Although mixing of CP with AG did not significantly affect mechanical properties of the hydrogel, incorporation of CS into AG matrix produced a significant difference in Young's modulus values. In case of AG, E0 was found to be 198.3 ± 18.2 MPa, while AGCP and AGCS exhibited values of 147.6 ± 33.7 and 135.6 ± 22.1 MPa, respectively. The stiffness of AG, AGCS and AGCP hydrogels were found to be 614.0 ± 33.1, 566.6± 87.6 and 483.6 ± 41.6 pN/nm, respectively.



Page 24 of 46

Table 3. Roughness and mechanical properties of AG, AGCP and AGCS hydrogel Samples AG AG-CP AG-CS

Roughness (AFM) Rq (nm) Ra (nm) 7.6 ± 0.8 5.7 ± 0.7 8.1 ± 1.5 6.1 ± 1.5 6.2 ± 1.3 4.3 ± 0.7

Young’s modulus (MPa) 198.3 ± 18.2 147.6 ± 33.7 135.6 ± 22.1

Stiffness (pN/nm) 614.0 ± 33.1 566.6± 27.6 483.6 ± 41.6

Rq : Root Mean Square (RMS); Ra: average roughness

Swelling kinetics Porous 3D polymeric networks of hydrogel allow a large volume of water absorption through highly interconnected pores facilitating nutrients transport, gaseous exchange and cell adhesion and migration in a 3D environment. Therefore, swellability of the polymeric scaffolds is an important feature which was measured through immersion in PBS and weighed at different time intervals as shown in Figure 8a. Swelling of AG scaffolds happened slowly, but all scaffolds reached to the equilibrium state after 15 min at room temperature (25 ± 2 °C). AGCS scaffolds underwent faster swelling with % swelling of 3000, which was ~1.25 times higher as compared to AGCP (% swelling 2400) and almost double than that of AG scaffolds (% swelling 1600). Biodegradation kinetics In vitro degradation of hydrogel scaffolds was evaluated by incubating with lysozyme solution in physiological conditions. Changes in weight (on dry basis) were measured once in a weekly basis for 4 weeks. From Figure 8b, AG hydrogels exhibited insignificant degradation (3.66% ± 0.29%) as compared to AGCP hydrogels (17.37% ± 0.92%). However, AGCS hydrogels degraded up to the maximum extent (30.49% ± 1.75%) among all the scaffolds used for this study.


Page 25 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. (a) Swelling and (b) degradation studies of lyophilized scaffolds (a) AG (b) AGCP and (c) AGCS

In vitro stem cell response Cytocompatibility, morphology and cell proliferation Assessment of cell viability on various hydrogels was performed by live/dead assay. It is evident from Figure 9(I) that seeded ADMSCs were mostly alive after 5 days of culture as indicated by the green color of the cells after staining. The absence of red color in all images indicates nil or minimum cell death occurred on these scaffolds. Also, cells were uniformly distributed throughout the hydrogels. Further, cell morphology was analyzed by rhodamine-phalloidin/DAPI am staining. As shown in Figure 9(II), most of the adhered cells were elongated while possessing typical morphology of the stem cells. However, AGCP and AGCS hydrogels exhibited higher cell density along with more cell-cell contact as compared to AG. Analysis of total DNA content at different time points provides an approximation of the change in the total cell population. Here, total DNA contents increased for all hydrogels cultured with ADMSCs which indicates continuous cell growth from day 1 to day 7. After normalization with a total weight of hydrogels, there was an increase of total DNA contents more than 2-folds in case of AGCP and AGCS hydrogels, while AG exhibited an increase of



about 1.7-folds. The results indicate that cell population in AGCP and AGCS hydrogels was almost doubled after 7 d of ADMSCs culture.

Figure 9. Assessment of in vitro cytotoxicity and cell morphology through (I) live-dead (green color – live, red color – dead cells) and (II) rhodamine-phalloidin/DAPI staining (red color – cytoskeleton, blue color – nucleus) on 5d; (III) cell proliferation through DNA quantification on 1d and 7d using ADMSCs seeded (a) AG (b) AGCP (c) AGCS hydrogels

Osteogenic differentiation and gene expression analysis Osteogenic potential of AGCP and AGCS hydrogels with respect to AG hydrogel was evaluated after 21 days of osteogenic culture using ADMSCs. Expression of osteogenic related genes (COL I, OPN and OCN) on individual scaffolds was evaluated through RTPCR study. RT-PCR profile and relative expressions of genes assessed from different band intensities are shown in Figure 10a and Figure 10b, respectively.


Page 26 of 46

Page 27 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 10. Differentiation of ADMSCs after 21 days of culture on AG, AGCP and AGCS under osteogenic supplementation (a) RT-PCR profile (b) relative band intensities and (c) immunostaining of secreted collagen I in the extracellular matrix (green and blue color represent extracellular collagen and cell nucleus, respectively); Error bar represents standard deviation (n=3)

During osteogenic differentiation studies, COL I and OPN gene expressions were significantly higher (p

Osteochondral Defects Healing Using Extracellular Matrix Mimetic

Recommend Documents