Overexpression of Biglycan in the Heart of Transgenic Mice: An

involved in cardiac remodeling (TGF-β, pyk2), signal transduction (RAF-1, Mcl-1, syntrophin, ... repeated leucine-rich amino acid motif.1,2 Biglycan ...
1 downloads 0 Views 382KB Size
Download PDF
Overexpression of Biglycan in the Heart of Transgenic Mice: An Antibody Microarray Study Erika Bereczki,† Szilvia Gonda,† Tama´ s Csont,‡ Eva Korpos,† Agnes Zvara,§ Pe´ ter Ferdinandy,‡ and Miklo´ s Sa´ ntha*,† Institute of Biochemistry, Biological Research Center of the Hungarian Academy of Sciences, P.O. Box 521, H-6701 Szeged, Hungary, Cardiovascular Research Group and PharmaHungary Companies, Department of Biochemistry, University of Szeged, Dom ter 9, H-6720, Szeged, Hungary, and Laboratory of Functional Genomics, Biological Research Center of the Hungarian Academy of Sciences, P.O. Box 521, H-6701 Szeged, Hungary Received October 30, 2006

Biglycan, a small leucine rich proteoglycan, is expressed in almost every tissue of the body, mainly in the extracellular matrix of connective tissues. Although there is an increasing amount of data on the biological role of biglycan protein, its function is still poorly understood. We aimed to gather more information about the biological function of biglycan protein in the cardiac tissues, and its role in signal transduction. Therefore, we generated transgenic mice overexpressing the human biglycan protein and analyzed the cardiac protein profile of transgenic offsprings using quantitative real-time (QRT)PCR and proteomics. QRT-PCR results showed that most members of extracellular matrix were downregulated whereas cadherins, TGF-β1, and TGF-β2 were upregulated. Antibody microarrayer experiment revealed that pyk2, RAF-1, Mcl-1, syntrophin, calmodulin, isoforms of NOS protein family (eNOS, nNOS, and iNOS), and synaptotagmin proteins were unambiguously upregulated in the heart of biglycan transgenic mice. In this study we show that biglycan directly or indirectly activates proteins involved in cardiac remodeling (TGF-β, pyk2), signal transduction (RAF-1, Mcl-1, syntrophin, calmodulin, nNOS p38MAPK and MAP kinases), cardioprotection (NOS family, TGF-β) and Ca++ signaling (connexin, calmodulin, synaptotagmin). On the basis of the results presented here, we conclude that biglycan is a multifunctional extracellular protein that has a pivotal role in pathological remodeling of cardiac tissue and mediates cardioprotection. Keywords: cardiac protein profile • antibody microarray • biglycan • transgenic mice

Introduction Biglycan is a member of the small leucine rich proteoglycan (SLRP) family, which is characterized by the presence of repeated leucine-rich amino acid motif.1,2 Biglycan is an extracellular molecule that consists of a core protein to which different highly sulfated glycosaminoglycan (GAG) chains are attached. Depending on the sugar content, the GAG chains are chondroitin sulfate (CS) or dermatan sulfate (DS).3 Composition of GAG chains is tissue specific: it is composed of dermatan sulfate in skin and cartilage and chodroitin sulfate in bone. In human lung fibroblast, the predominant form of biglycan has attached GAG chains containing 71% idorunate.4 Similar structure of biglycan was shown in human mitral valves, where the GAG chains contain abundant idorunate but less glucuronate.5 Mutations in the enzymes responsible for the biosyn* To whom correspondence should be addressed. Laboratory of Animal Genetics and Molecular Neurobiology, Institute of Biochemistry, Biological Research Center, Temesvari krt.62, H-6726 Szeged, Hungary. Phone, 36-62599-651; Fax, 36-62-433-506; E-mail, [email protected]. † Institute of Biochemistry. ‡ Cardiovascular Research Group and PharmaHungary Companies. § Laboratory of Functional Genomics.

854

Journal of Proteome Research 2007, 6, 854-861

Published on Web 01/18/2007

thesis of GAG chains unmasked the importance of proteoglycans in development.3 Recent results showed that proteoglycans are not merely rigid components of the extracellular matrix but play an important role in deposition of collagens, cell adhesion, activation, and inactivation of cytokines and growth factors and in matrix assembly.6 The biglycan gene (bgn) is encoded by 8 exons, and it is localized to a distal region of the X chromosome within the gene-dense region, Xq28.7,8 Biglycan has been found in almost every tissue within our body, but it is not uniformly distributed within the organs. Its expression pattern is altered in different pathological conditions. In the cardiovascular system, biglycan may play a crucial role in atherosclerosis.9,10 Biglycan expression in the heart is ubiquitous, with strong filamentous strands in the central layer of the heart leaflet.11 It has been demonstrated that different proteoglycan (PG) types are present in aortic layers in variable amounts where they participate in structural integrity of the aortic wall, as well as in several biological functions, such as lipoprotein oxidation and blood coagulation.12,13 Like other members of the SLRP family, biglycan binds to a variety of other proteins, including growth factors such as TGF10.1021/pr060571b CCC: $37.00

 2007 American Chemical Society

Cardiac Protein Profile of Biglycan Transgenic Mice

β14 and TNF-R15 and extracellular matrix proteins such as collagen type I and V, fibronectin,16-18 dystroglycan, and phospholipase A2 type II.19 These various binding activities may account for the ability of biglycan to exert diverse functions in many tissues. For example, it has been suggested that biglycan may affect cell migration by modulating interactions of cell surface receptors with its matrix ligands and influence cell growth by regulation of the availability and function of growth factors, i.e., by binding transforming growth factor-h (TGFh).6,14 These recently appreciated effects of biglycan suggest that this proteoglycan may be an important factor in the mechanisms of myocardial remodeling of the failing heart. Biglycan acts as a proinflammatory protein activating TNF-R and macrophage inflammatory protein-2 (MIP-2), via p38, ERK, and NF-κB in macrophages.20 It was recently shown that TNF R also changes the expression of biglycan in lung fibroblast and gives rise to a remodeling of the connective tissue.21 Abnormal mechanical stress in the prelesional arteries leads to increased biglycan expression via TGF-β regulation. Factors associated to atherosclerotic plaques have also been shown to cause an increase in biglycan expression.22 It was also shown that the expression of biglycan is downregulated by the inflammatory mediator nitric oxide (NO).23 NO is an important cardioprotective molecule via its vasodilatator, antioxidant, antiplatelet, and antineutrophil actions, and it is essential for normal heart function.24 NO is produced in vivo by a group of three NO synthases (NOSs): neuronal (nNOS), inducible (iNOS), and endothelial (eNOS) isoforms. All three NOS isoforms are found in the human heart. Unlike constitutively expressed NOS isoforms (nNOS and eNOS), iNOS is regulated primarily at the transcriptional level. Normally there is little, if any, detectable iNOS expression in any cell type. However, in response to inflammatory cytokines or endotoxins, there is a robust upregulation of iNOS mRNA and protein in virtually every nucleated cell type.25 Induction of iNOS expression is mediated through cytokine-inducible transcription factors, such as IFN regulatory factor-1 and NF-κB, which can directly bind to specific sequence elements within the iNOS promoter.26,27,28 Although there is an increasing amount of data on the biological role of biglycan protein, its function is still not clear. On the basis of available earlier results, we hypothetised that biglycan might have a role in pathological remodeling of cardiac tissues and cardioprotection. Furthermore, our aim was to reveal the role of biglycan protein in different biochemical pathways, such as signal transduction and Ca++ signaling. To answer this question, we generated transgenic mice overexpressing the human biglycan protein and protein profile, and immunohistochemistry and western analysis of cardiac tissues of transgenic offsprings were investigated. We demonstrate here that biglycan has a pivotal role in cardiac remodeling and mediates cardioprotection.

Materials and Methods Reagents. Materials. Complete Freud’s adjuvant (CFA) and incomplete Freud’s adjuvant (IFA), biglycan protein, Panorama AB Microarray Cell Signaling Kit was supplied by Sigma-Aldrich. DNase I and Revert Aid H Minus were purchased from Fermentas. Absolute QPCR mix was obtained from ABgene. ECL Advance Western blotting blocking agent and detection reagent was ordered from Amersham. Ten-well, pre-cast, 1-mm-thick 10% polyacrylamide gels were supplied by Cambrex. Monoclonal antibodies against iNOS, eNOS, and rabbit polyclonal

research articles antibody against nNOS proteins were obtained from Chemicon. Rabbit antibodies against Pyk2, synapotagmin, β actin proteins, collagenase type II, DAPI, and Tween 20 were purchased from Sigma-Aldrich. Fluorescein conjugated (Cy2, Cy3, Cy5) secondary antibodies were supplied by Jackson Immunoresearch Laboratories. Generation of Biglycan Transgenic Mice. A GeneStorm Expression-Ready clone expressing the human biglycan cDNA was purchased from Invitrogen (Accession: J04599, Clone ID: RG000791). A 3440 bp fragment including the entire transcription unit was separated from the vector backbone by double digestion with Sal1 and BssHII enzymes. The purified DNA was microinjected at 2 ng/µL into the fertilized oocytes of C57/ B6XCBA F1 female mice using the standard pronucleus microinjection technique.29 Microinjected eggs were reimplantated into the oviduct of pseudopregnant Swiss female mice. Transgenic founders were identified by PCR analysis using the following primers: forward primer: 5′-GGA CTC TGT CAC ACC CAC CT-3′ and reverse primer 5′-AGC TCG GAG ATG TCG TTG TT-3′. All animal experiments were performed in accordance with institutional guidelines. Antibody Production and Western Blotting. Two white male rabbits were immunized with biglycan, using complete Freud’s adjuvant (CFA) followed by incomplete Freud’s adjuvant (IFA) (Sigma) as carriers, according to the manufacturer’s protocol. Briefly, the animals were immunized subcutaneously on day 1 with 0.5 mg of purified biglycan protein (Sigma) emulsified in CFA (1 mL: 1 mL). Boosting was performed using 0.5 mg of immunogen in IFA by subcutaneous injections on days 14, 28, and 42. Antibody titer was tested after the second boosting using western blot analysis. Total protein from heart and aorta samples were separated on 10% SDS-PAGE precast gels (Cambrex), and transferred electrophoretically to Hybond P (Amersham) nitrocellulose membrane. For biglycan detection, samples were incubated with chondroitinase ABC, 0.5U/mL at 37 °C for 1 h. The membrane was blocked for 1 h with 2% (w/v) ECL Advance Blocking Agent (Amersham) in PBST (1% PBS, 0.1%Tween 20 v/v) at room temperature. After a brief wash with PBST, the nitrocellulose membrane was probed for 2 h at 4 °C with different antibodies, specifically: rabbit anti-biglycan (1:3000), monoclonal anti-iNOS (1:2000 Chemicon), monoclonal antieNOS (1:2000 Chemicon), rabbit anti-nNOS (1:2000, Chemicon), rabbit anti-pyk2 (1:3000 Sigma), rabbit anti-synaptotagmin (1:3000 Sigma). All incubations were performed on an orbital shaker. A brief wash with PBST, was followed by 1 h incubation in the corresponding secondary antibody. ECL Advance Western Blotting Detection Reagent (Amersham) was used for detection according to the manufacturer’s instructions. Autoradiography spots were quantified by computer-assisted image analysis using NIH Image 1.63 software. RNA Extraction and Reverse Transcription. Total RNA was extracted from heart using Trizol reagent (Invitrogen), in accordance with the manufacturer’s protocol. RNA was treated with DNaseI (Fermentas) in MgCl2 10× reaction buffer (Fermentas) for 30 min. DNaseI was then heat-inactivated at 65 °C for 15 min in the presence of 25 mM EDTA. First strand cDNA was synthesized by reverse transcription (5 µg RNA/20 µL reaction volume) using MuLV reverse transcriptase and oligodT primer of Revertaid H-Minus Kit (Fermentas). After an initial denaturation step of 1 min at 95 °C, synthesis of the second strand consisted of, 1 h extension at 42 °C and a final extension step of 5 min at 72 °C. Journal of Proteome Research • Vol. 6, No. 2, 2007 855

research articles Quantitative Real-Time PCR. Quantitative real-time PCR (QRT-PCR) was performed on a RotorGene 3000 instrument (Corbett Research, Sydney, Australia) with gene-specific primers and SybrGreen dye according to an earlier described protocol.30 Briefly, the cDNA was diluted 1:5, and 2 µL of this mix was used as a template in the QRT-PCR. Primers were designed by using the ArrayExpress software (Applied Biosystems). Reactions were performed in a total volume of 20 µL containing 10 µL of Absolute QPCR mix (ABgene) and 5 mM of each primer. The amplification was carried out with the following cycling parameters: 15 min heat activation at 95 °C, followed by 45 cycles comprising denaturation at 95 °C for 25 s, annealing at 60 °C for 25 s and extension at 72 °C for 20 s. Fluorescent signals were collected after each extension step at 72 °C. Curves were analyzed by the RotorGene software using dynamic tube and slope correction methods ignoring data from cycles close to baseline Relative expression ratios were normalized to the geometric mean of two endogenous housekeeping genes, GAPDH and β-actin. Expression ratios were calculated with the Pfaffl method.31 All the PCRs were performed four times in separate runs (n ) 4). Results are expressed as the arithmetical mean for each gene. Antibody Array Studies. Panorama AB Microarray Cell Signaling Kit (Sigma, CSAA1) was used to perform antibody array studies, according to the manufacturer’s instructions. Briefly, proteins were extracted from freshly removed heart of transgenic and control mice, 1 mL (1 mg/mL) of each extract was then labeled with Cy3 and Cy5, respectively. The unlabeled dye was removed from the labeled samples using SigmaSpin column. The labeled sample was diluted in 5 mL of incubation buffer and incubated on the array for 45 min then it was washed 4 times for 5 min with PBST. Incubation and the washing procedures were done at room temperature in dark on a shaker at 30 rpm. The antibody array was scanned using ScanArray LITE Microarray Analysis System (GSI Lumonics, Billerica, MA). Fluorescent intensities were normalized to that of the reference proteins and summed fluorescence intensities. Normalization by dye swapping was also done. Immunohistochemistry. Immunohistochemical analyses were performed on acetone-fixed cryosections (10 µm) using different primary antisera. To improve antibody penetration into the tissues, sections were treated with 0.5 mg/mL collagenase type II (Sigma) in a buffer containing 0.25 M NaCl 50 mM Tris-HCl pH 7.4 and 1 mM EDTA at 37 °C for 30 min. To reduce nonspecific binding, sections were incubated in 10% normal donkey serum in TBS for 1 h. Negative control experiments were always performed, by replacing the primary antibodies with normal donkey serum. To visualize the nucleus, DAPI staining (Sigma) was used. Subsequently, fluorescein conjugated (Cy2, Cy3, Cy5) secondary antibody (Jackson Immunoresearch Laboratories) produced in donkey was used. Cryosections of corresponding cardiac regions of age matched wild-type mice were used as controls. Statistical Analyses. Results were analyzed using OriginPro 7 software. Data were expressed as mean ( standard deviation. The statistical significance of differences between the groups was determined using one-way ANOVA test. Values of p < 0.05 were considered significant. In all experiments n ) 3.

Results Generation of Biglycan Transgenic Mice. The transgenic construct contained the human biglycan cDNA fused to a CMV promoter. The cDNA encoded the entire biglycan protein 856

Journal of Proteome Research • Vol. 6, No. 2, 2007

Bereczki et al.

Figure 1. Expression of biglycan in the aorta and heart of transgenic and control mice; (A) mRNA expression analyzed by QRT-PCR (n ) 3) and (B) protein expression analyzed by western blots.

including the signal peptide, the propeptide, and the mature protein. A V5 epitope and a 6× His Tag sequence were also fused to the 3′ end of cDNA. Newborns were genotyped using PCR as described in Materials and Methods. Transgene expression from different tissues (liver, brain, heart, and muscle) of transgenic mice was tested using Taqman probe based QRTPCR (data not shown). Transgenic line 1052, expressing the highest level of human biglycan mRNA was selected for further study. Expression of human biglycan at mRNA level in the aorta and heart of transgenic and age-matched control mice was assessed by QRT-PCR (Figure 1A). Primers were designed to the exon-intron border in order to avoid amplification of contaminant genomic DNA. Transgene expression was normalized to the endogenous expression of β-actin. Robust overexpression of the biglycan gene was found in the aorta (10.1 fold) (f value ) 233.02; p value ) 0.00011) and heart (3.8 fold) (f value ) 44.7; p value ) 0.0026) of transgenic mice comparing to controls (Figure 1A). Overexpression of the transgene observed at mRNA level was further tested at protein level using western blot experiments. After separation and blotting proteins extracted from cardiac and aortic tissues, rabbit anti-biglycan polyclonal antibody, produced in our laboratory was applied. The antibody recognized the human biglycan core protein migrated at 45 kDa (Figure 1B). This result was in accordance with the overexpression measured at mRNA level and confirmed biglycan overexpression at translational level as well. Proteomics of Cardiac Tissues of Biglycan Transgenic Mice. Quantitative Real-Time PCR. First, we were interested in whether changes occurred or not in the gene expression level of other extracellular matrix proteins, such as decorin, synde-

research articles

Cardiac Protein Profile of Biglycan Transgenic Mice Table 1. Primer Sequences Used for QRT-PCR Experiment gene

acc. no

forward primer

reverse primer

Dystroglycan (Dag1) Fibrillin1 (Fbn1) Fibrillin2 (Fbn2) Decorin (Dcn) Syndecan1 (Sdc1) Syndecan2 (Sdc2) Collagen type IV R 5 chain (col4a5) Transforming growth factor β 1 (TGFβ1) Transforming growth factor β 2 (TGFβ2) Bone morphogenetic protein 4 (Bmp4)

NM_010017 NM_007993 NM_010181 NM_007833 NM_011519 NM_008304 NM_007736 NM_011577 NM_009367 NM_007554

CGAGGAACCGTGAATGAACTC ACGCCGATGGGCTATCTTC TTGACCCCTCAACAACCA TCCAGGTCGTCTACCTTCACAA TGTCGCTCATGCGTACAACA AGAAGTTCTAGCAGCCGTCATTG CCTGGCTCCTGTTTGGAAGA AAACGGAAGCGCATCGAA GCTAGGTTTGAGCTCCCACAGTGT TGCCGTCGCCATTCACTA

TAGTGTTAAAGGCAAAATGCAGAGA CGGAACAGTCCATCAGATGGA GGAAGACGCCATCCTCGTT TCCAGGTCGTCTACCTTCACAA TTACGGGCCGCCAAAA CAGGATGAGGAAAATGGCAAA CCTCGCCCATGACATTCG GGGACTGGCGAGCCTTAGTT GCTCACCCGCCACATGAC GGCCACAATCCAATCATTCC

Table 2. List of Antibodies from PanoramaTM Ab Microarray that Present Induced Protein Expression in Biglycan Transgenic Heart spot

antibody name

Sigma acc. no.

area

fold overexpression

3.4Dab 4.1Cab 4.2Cab 5.1Cab 5.2Bab 5.4Bab 5.1Dab 5.2Dab 5.3Dab 6.1Bcd 7.2Acd 7.1Dab 7.2Dcd 7.3Cab 7.4Cab 8.1Dab 8.3Dcd 6.3Cab

Calmodulin Connexin 32 Connexin 43; Clone:CXN-6 RTubulin; Clone:B-5-1-2 Pan Cadherin; Clone:CH-19 Chondroitin Sulfate Clone:CS-56 i-NOS nNOS eNOS Glutamine Syntethase CAM Kinase IV (Ay-18) MAP Kinase (Erk1+Erk2) MAP Kinase activated phosphothreonine Clone:ERK PT115 p38 MAPK Mcl-1 Pyk2 RAF1 Synaptotagmin

C0931 C3470 C8093 T5168 C1821 C8035 N7782 N7155 N2643 G2781 C2851 M5670 M7802 M0800 M8434 P3902 R5773 S2177

Ca associated protein cytoskeleton cytoskeleton cytoskeleton cytoskeleton ECM signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction signal transduction neurobiology

1.77 1.8 1.8 1.95 2.02 2.09 1.67 2.2 2.14 1.82 1.65 2.11 1.86 1.81 1.83 1.99 1.87 1.83

can, dystroglycan, and of genes involved in regulation of biglycan (i.e. TGFβ). This was tested in cardiac tissues of transgenic and wild-type control mice using QRT-PCR. Primers used for this study are listed in Table 1. Gene expression profile showed a downregulation for most of the proteoglycans, such as decorin, syndecan 1, and syndecan 2. The highest downregulation was observed for decorin (5.09 fold) (f value ) 791.6; p value ) 0.0001), dystroglycan (2.97 fold) (f value ) 2484.5; p value ) 0.00002) and syndecan 2 (2.65 fold) (f value ) 1536.5; p value ) 0.00004), whereas a moderate downregulation was obtained for syndecan 1 (1.29 fold) (f value ) 621.9; p value ) 0.00014) (Figure 2). In parallel, elevated gene expression level of TGF-β1 (3.35 fold) (f value ) 148.9; p value ) 0.0011), TGFβ2 (2.49 fold) (f value ) 216; p value ) 0.00068) and fibrillin 2 (2.88 fold) (f value ) 115.5; p value ) 0.0017) was detected (Figure 2). No significant change was observed for fibrillin 1 and BMP 4 mRNA. Antibody Arrayer. To identify proteins with altered expression in the heart of biglycan transgenic mice Panorama Ab Microarray Cell Signaling Kit (Sigma, CSAA1) was used. This array contained 224 antibodies to cellular proteins involved in apoptosis, cell cycle, cellular stress, and signal transduction. Other groups of antibodies were against structural proteins (nuclear, cytoskeletal, and neuron specific). The experiment was normalized by dye swapping as well. Results obtained by antibody arrayer study are summarized in Table 2. Elevated level of all three types of NOS proteins was detected in the heart of bg+/+ transgenic mice. These increases were 2.2 fold for nNOS, 2.14 fold for eNOS, and 1.67 fold in the case of iNOS. We found a remarkable increase in the level of cytoskeletal proteins, such as connexin 32 (1.8 fold) and 43 (1.8 fold), pan cadherin (2.02 fold), R-tubulin (1.95 fold), and chondroitin sulfate (2.09 fold). Among proteins exerting a role in neuro-

biological processes, elevated levels of synaptotagmin (1.83 fold), syntrophin1 (1.81 fold), and glutamine syntethase (1.82 fold) were detected. Calmodulin was moderately induced (1.77 fold) compared to control samples. Among signal transduction proteins present on the array, we found marked elevation for MAPK (Erk1+Erk2) (2.11 fold), MAPK P-1 (1.8 fold), Mcl-1 (1.83 fold), p38 MAPK (1.81 fold), Pyk 2 (1.99 fold), RAF-1 (1.87 fold), and MAPK activated phospothreonine (1.86 fold), and moderate increase for Ca++ dependent calmodulin kinase, CAMK IV (1.65 fold) (Table 2). Western Blot Experiments. Most of the results obtained by microarrayer study were confirmed by western blot experiments (Figure 3A and B). In the first experiment, expression levels of iNOS, eNOS, and nNOS from control and transgenic mice heart were compared. An approximately 2-fold overexpression was detected for eNOS, 1.9 fold for iNOS, and 1.7 fold for nNOS in transgenic cardiac tissues, compared to control samples and normalized to endogenous β-actin expressions (Figure 3C). We found elevated protein level of synaptotagmin (2.05 fold) and pyk 2 (2 fold) (Figure 3B and C). Western blot results confirmed our previous findings obtained by microarray analysis. Immunohistochemistry. Immunohistochemical assays were performed to localize biglycan protein in transgenic and wildtype control cardiac tissues (Figure 4). Biglycan staining showed ubiquitous immunoreactivity in frozen cardiac tissue sections in both control and transgenic mice. There was no difference in localization of biglycan protein in control versus bg+/+ transgenic tissues. However, a more pronounced immunoreactivity of endothelial cells and stronger staining of filamentous strands were detected in transgenic cardiac samples compared to wild-type controls (Figure 4). Myocardial tissue and endothelial cells showed increased immunoreactivity for Journal of Proteome Research • Vol. 6, No. 2, 2007 857

research articles

Bereczki et al.

Figure 2. Gene expression changes in Bg+/+ transgenic heart compared to wild-type controls, analyzed by QRT-PCR and normalized to HPRT (hypoxanthine phosphoribosyltransferase) housekeeping gene (n ) 3).

Figure 3. Western analysis of (A) iNOS, eNOS, and nNOS in wildtype control and transgenic heart samples and (B) pyk2 and synaptotagmin normalized to endogeneous mouse β-actin level. (C) Quantitative measure of protein levels obtained by western analysis (n ) 3).

eNOS and iNOS in biglycan transgenic heart sections. We detected abundant staining of eNOS close to the caveolin rich plasma membrane domain in transgenic endothelium (Figure 4). iNOS was localized to the cytoplasm throughout the myocardium; whereas its distribution did not vary, the intensity was markedly increased in transgenic heart sections (Figure 4). Synaptotagmin and Pyk 2 showed a diffuse staining throughout the cytoplasm, nevertheless both of them showed increased immunoreactivity in the biglycan transgenic heart sections, with an accumulation of pyk2 in the intercellular junctions.

Discussion Biglycan is a major glycoprotein of the extracellular matrix with multiple functions.3 It consists of a core protein to which different highly sulfated glycosaminoglycan (GAG) chains, composed of chondroitin sulfate (CS) or dermatan sulfate (DS) are covalently bound.32,33 Although there is an increasing amount of data on the biological role of biglycan protein, its 858

Journal of Proteome Research • Vol. 6, No. 2, 2007

Figure 4. Immunostaining of wild-type control and bg+/+ transgenic myocardial tissue cryosections. (A) Sections were probed with iNos primary monoclonal antibody (A-F), eNos primary monoclonal antibody, both visualized by Cy3 labeled donkey antimouse secondary antibody (G-L), and rabbit polyclonal biglycan antibody (A-L) visualized by Cy2 labeled donkey anti-rabbit secondary antibody. Arrowheads indicate enhanced biglycan staining of filamentous strands (D, J) and iNOS (E) and eNOS (K) immunreactivity throghout the cytoplasma. Sections from biglycan transgenic mice (D-F, J-L) show enhanced biglycan and NOS immunoreactivity when compared to wild-type control sections (A-C, G-I). (B) Sections were probed with Pyk2 rabbit polyclonal antibody (A-B) and Synaptotagmin rabbit polyclonal antibody (C-D) and were visualized by Cy2 labeled donkey antirabbit secondary antibody. Nucleus was stained with DAPI. Arrowheads indicate enhanced staining for synaptotagmin throughout the cytoplasm (D) and for pyk 2 immunoreactivity close to intercellular junctions (B).

function is still poorly understood. Biglycan shares high homology with a closely related proteoglycan, decorin, originating most probably from gene duplication during evolution.34 Extracellular Matrix Proteins. Due to the close structural and functional integrity of extracellular matrix proteins, gene expression changes of some other proteoglycans were investigated. Obviously, it is difficult to judge whether induction or suppression of proteins presented here are the direct effect of biglycan overexpression or the consequence of TGF-β upregulation. Moreover, it is known that TGF-β has the ability to increase its own expression by autoregulation and cross regulation of other

Cardiac Protein Profile of Biglycan Transgenic Mice

family members.35 It is also known that biglycan can act as sequester of TGF-β arresting it from its signaling receptors. Upregulation of collagen type I and III by TGF-β was reported earlier.36 We investigated type IV collagen, a major component of the basement membrane that has been demonstrated to appear in the infarct zone after experimental myocardial infarction.37 Upregulation of collagen type IV was detected, supporting our hypothesis upon the putative role of biglycan/TGF-β in pathological remodelling. Marked downregulation of decorin were also in accordance with previous findings of others.38 However, downregulation of dystroglycan and syndecan 1 and 2 were unexpected, and we cannot give a clear explanation of these results. It was shown earlier that TGF-β treatment increases syndecan-1 expression in mesenchymal cells, whereas it causes no change in syndecan expression in endothelial cells, keratinocytes, and mammary epithelial cells.33 Fibrillins regulate TGF-β activation and signaling39 and mutation of fibrillin genes leads to increased production of TGF-β.40 We speculate that overproduction of fibrillin 2 might be a part of a compensatory mechanism to restrain the excess of human biglycan and /or endogenous TGF-β. The calcium-dependent cell adhesion molecule Pan cadherin, which plays an important role in the growth and development of cells maintaining the architecture and tissue integrity, was found to be upregulated. Connexin 32 and connexin 43 are important constituents of gap junction channels, which may interact with cadherins via catenin and other cytoskeletal proteins41 were also upregulated in our study. Induction of extracellular matrix and cytoskeletal proteins as well as detection of increased level of chondroitin sulfate strongly indicate that biglycan contributes to the reorganization of extracellular matrix and pathological remodeling of cardiac tissues. Cell Signaling Pathways. Using QRT-PCR and antibody arrayer, we detected elevated gene expression level of TGFβ1 and TGFβ2 and elevated protein level of Pyk2, RAF-1, and mcl1. These proteins are key molecules of different signaling pathways playing a crucial role in cell survival and apoptotic cell death. Biglycan binds to TGF-β with a fairly high affinity.14 TGF-β was identified as a positive regulator of biglycan expression;42,43,44 it promotes the synthesis of biglycan in both dense and sparse endothelial cells.45 Meanwhile, biglycan is thought to form a negative feed back loop regulating TGF-β activity.6 It was recently shown that induction of myocardial biglycan may shift this equilibrium of interaction and enhance TGF-β activity in the myocardial tissue.46 Heterodimerisation with TGF-β may affect both the availability (in the local concentration) and the activity of TGF-β. TGF-β is an important mediator of fibroblast proliferation and of synthesis of extracellular matrix components, particularly collagen and fibronectin.47 There are several data that point out the importance of TGF-β in myocardial remodeling and fibrosis in heart failure.48 Beside TGF-β, upregulation of pyk2 protein was also detected using protein profiling of cardiac tissues of biglycan transgenic mice. Pyk2, also known as related adhesion focal tyrosine kinase (RAFTK), plays a crucial role in cardiac remodeling and in activation of the apoptotic pathway in cardiomyocytes through Src kinasep38 downstream signaling.49 Although phosphorylation of kinases involved in apoptotic signaling was not investigated during this study, p38 as well as other MAPK members of apoptotic pathway were shown to be upregulated in the antibody microarray study. It has been previously reported that

research articles biglycan mRNA level is increased in the myocardial zone affected by infarction, suggesting a pivotal role of biglycan during healing of the infarcted area and indicating its involvement in cardiac remodeling.50 RAF-1 is a protein kinase, a member of mitogen activated/ extracellular regulated protein kinases that activates Mek1 and Erk2 via G protein Ras. According to recent studies, RAF1 may act as a positive regulator of the membrane-bound enzyme adenylate cyclase 6, resulting in increased synthesis of the intracellular second messenger, cAMP.51 Mcl-1 is a member of Bcl-2 protein family and has an important role in regulatory mechanism that control cell survival and cell death. High level of mcl-1 promotes cell survival whereas its downregulation initiates apoptosis. Mcl-1 might also play a role in embryogenesis and cell differentiation.52 The role of biglycan protein in cell proliferation is poorly understood. Its action might depend on the cell type and tissueenvironment. In the aorta and renal vasculature, biglycan enhances vascular smooth muscle cell proliferation and migration,53 stimulates growth and differentiation of monocytic lineage cells and brain microglial cells,54,23 but inhibits growth and induces G1-arrest in pancreatic cancer cells.55 Extracellular-Intracellular Signaling. The dystrophin glycoprotein complex (DGC) is a large multicomponent protein complex, which has a signaling role in mediating interactions between extracellular matrix, membrane and cytoskeleton.56 On the surface of skeletal and cardiac muscle cells, biglycan binds via its chondroitin sulfate side chains to the COOH- terminal third of dystroglycan R-subunit. The transmembrane subunit of dystroglycan protein, β- dystroglycan, binds dystrophin, an elongated cytoskeletal protein, and caveolin-3, which is able to oligomerize to form caveolae in the membrane. Dystrophin binds syntrophin, which in turn binds calmodulin and nNOS. Caveolin-3 also binds directly nNOS.56 Some of these signaling proteins such as syntrophin, calmodulin and nNOS showed elevated levels in the present study indicating that biglycan might has a role in transmembrane signaling. Cardioprotection. Using proteomics, we detected elevated levels of all three types of NOS in the heart of biglycan transgenic mice. These data were also confirmed by western blot analysis and immunohistochemistry. Nitric oxide is an important signaling molecule playing a crucial role in a variety of biological processes like neurotransmission, cardioprotection and immune defense. NO has cardioprotective effect via its vasodilatator, antioxidant, antiplatelet, and antineutrophil actions and it is essential for normal heart function,24 albeit overproduction of NO may become toxic for the cells. Excess of local NO might inhibit biglycan expression as this negative regulation was demonstrated earlier by Schaefer et al.23 It was reported earlier that TGF-β has a cardioprotective activity against myocardial ischemia-reperfusion injury57 and transmits platelet-mediated cardioprotection during hypoxiareoxigenation.58 On the basis of our results, we can postulate that biglycan mediates cardioprotection via induction of NOS proteins and TGF-β. Ca++ Signaling. Sears et al. showed earlier that NOS can modulate L-type calcium current and inotropy.59 It is also known that nNOS associated to sarcoplasmic reticulum may modulate Ca++ signaling in ventricular myocytes.60 It is not directly proven that these modulations are performed through calmodulin kinase. However it was shown earlier that all three types of NOS are regulated, albeit in different ways, by Ca++ Journal of Proteome Research • Vol. 6, No. 2, 2007 859

research articles dependent calmodulin kinase.61 The binding of calmodulin is required for the activity of all NOS isoforms. The two constitutive types of NOS (nNOS and eNOS) share higher sequence homology in their calmodulin binding domain, whereas in the case of the inducible NOS, there is little similarity.62,63 Our current study revealed an elevated level of Ca++ associated calmodulin in the heart of bg+/+ transgenic mice, underlying a close interaction between these proteins and supporting the hypothesis that NOS proteins modulate Ca++ signaling through calmodulin kinase. Recent studies demonstrate that connexin hemichannels (connexons) determine and regulate cytoplasmic Ca++ level. They are sensitive to cytoplasmic Ca++ concentration changes triggering channel opening and Ca++ influx or efflux. Connexins have two Ca++ dependent calmodulin-binding sites.64 Calmodulin might be important in the oligomerization of connexons and their subsequent insertion into the plasma membrane.65 Here, we also show that another protein involved in Ca++ sensing, synaptotagmin (syt), is also upregulated in the heart of biglycan transgenic mice. Syt is a transmembrane protein containing tandem calcium-binding C2 domains (C2A and C2B) and plays an important role in synaptic transmission.66 Upon calcium-stimulation, the plasma membrane associated target membrane proteins (t-SNAREs), syntaxin and SNAP-25, together with the synaptic vesicle membrane protein (v-SNARE), synaptobrevin, assemble into a four helix bundle that can bridge membranes and mediate membrane fusion.67 Yoshihara proposed a three- stage model for calcium-dependent synaptic vesicle fusion mediated by synaptotagmin I and provided strong evidence that it is the fast calcium sensor for synchronous neurotransmitter release.66

Conclusion In conclusion, our present study revealed that overexpression of biglycan protein in the heart leads to multiple and profound alterations in the protein profile of cardiac tissues. Our findings show that biglycan plays fundamental role in pathological remodeling of cardiac tissue, it mediates cardioprotection, and it is involved in signal transduction and Ca++ signaling. Studies investigating further protein interactions and functional consequences of these multiple biochemical changes are in progress.

Acknowledgment. We thank Ja´nos Zsigmond Kelemen for helping in microarray data analysis and Rui Miguel Mamede Branca for reading the manuscript. This work was supported by grants from OMFB-00899/04 Bio-00120/2003 KPI and GVOP3.3.1-2004-04-0095-3.0. References (1) Fisher, L. W.; Termine, J. D.; Young, M. F. Deduced protein sequence of bone small proteoglycan I (biglycan) shows homology with proteoglycan II (decorin) and several nonconnective tissue proteins in a variety of species. J. Biol. Chem. 1989, 264 (8), 4571-4576. (2) Ameye, L.; Young, M. F. Mice deficient in small leucine-rich proteoglycans: novel in vivo models for osteoporosis, osteoarthritis, Ehlers-Danlos syndrome, muscular dystrophy, and corneal diseases. Glycobiology 2002, 12 (9), 107R-116R. (3) Iozzo, R. V. Matrix proteoglycans: From Molecular Design to Cellular Function. Annu. Rev. Biochem. 1998, 67 (1), 609-652. (4) Tufvesson, E.; Malmstrom, J.; Marko-Varga, G.; WestergrenThorsson, G. Biglycan isoforms with differences in polysaccharide substitution and core protein in human lung fibroblasts. Eur. J. Biochem. 2002, 269 (15), 3688-3696. (5) Grande-Allen, K. J.; Calabro, A.; Gupta, V.; Wight, T. N.; Hascall, V. C.; Vesely, I. Glycosaminoglycans and proteoglycans in normal mitral valve leaflets and chordae: association with regions of tensile and compressive loading. Glycobiology 2004, 14 (7), 621-633.

860

Journal of Proteome Research • Vol. 6, No. 2, 2007

Bereczki et al. (6) Ruoslahti, E.; Yamaguchi, Y. Proteoglycans as modulators of growth factor activities. Cell 1991, 64 (5), 867-869. (7) McBride, O. W.; Fisher, L. W.; Young, M. F. Localization of PGI (biglycan, BGN) and PGII (decorin, DCN, PG-40) genes on human chromosomes Xq13-qter and 12q, respectively. Genomics 1990, 6 (2), 219-225. (8) Traupe, H.; Van den Ouweland, A. M. W.; Van Oost, B. A.; Vogel, W.; Vetter, U.; Warren, S. T.; Rocchi, M.; Darlison, M. G. and others. Fine mapping of the human biglycan (BGN) gene within the Xq28 region employing a hybrid cell panel. Genomics 1992, 13 (2), 481-483. (9) Fedarko, N. S.; Termine, J. D.; Young, M. F.; Robey, P. G. Temporal regulation of hyaluronan and proteoglycan metabolism by human bone-cells invitro. J. Biol. Chem. 1990, 265 (21), 12200-12209. (10) Klezovitch, O.; Scanu, A. M. Domains of Apolipoprotein E Involved in the Binding to the Protein Core of Biglycan of the Vascular Extracellular Matrix: Potential Relationship between Retention and Anti-Atherogenic Properties of this Apolipoprotein. Trends Cardiovasc. Med. 2001, 11 (7), 263-268. (11) Latif, N.; Sarathchandra, P.; Taylor, P. M.; Antoniw, J.; Yacoub, M. H. Localization and pattern of expression of extracellular matrix components in human heart valves. J. Heart Valve Dis. 2005, 14 (2), 542-548. (12) Wight, T. N.; Kinsella, M. G.; Qwarnstrom, E. E. The role of proteoglycans in cell adhesion, migration and proliferation. Curr. Op. Cell Biol. 1992, 4 (5), 793-801. (13) Camejo, G.; Hurt-Camejo, E.; Wiklund, O.; Bondjers, G. Association of apo B lipoproteins with arterial proteoglycans: Pathological significance and molecular basis. Atherosclerosis 1998, 139 (2), 205-222. (14) Hildebrand, A.; Romaris, M.; Rasmussen, L. M.; Heinegard, D.; Twardzik, D. R.; Border, W. A.; Rouslahti, E. Interaction of the small interstitial proteoglycans biglycan, decorin and fibromodulin with transforming growth factor beta. Biochem. J. 1994, 302 (2), 527-534. (15) Tufvesson, E.; Westergren-Thorsson, G. Tumour necrosis factoralpha interacts with biglycan and decorin. Febs Lett. 2002, 530 (1-3), 124-128. (16) Bidanset, D. J.; Guidry, C.; Rosenberg, L. C.; Choi, H. U.; Timpl, R.; Hook, M. Binding of the proteoglycan decorin to collagen type- VI. J. Biol. Chem. 1992, 267 (8), 5250-5256. (17) Schonherr, E.; Witschprehm, P.; Harrach, B.; Robenek, H.; Rauterberg, J.; Kresse, H. Interaction of biglycan with type-I collagen. J. Biol. Chem. 1995, 270 (6), 2776-2783. (18) Wiberg, C.; Klatt, A. R.; Wagener, R.; Paulsson, M.; Bateman, J. F.; Heinegard D.; Morgelin, M. Complexes of matrilin-1 and biglycan or decorin connect collagen VI microfibrils to both collagen II and aggrecan. J. Biol. Chem. 2003, 278 (39), 3769837704. (19) Bowe, M. A.; Mendis, D. B.; Fallon J. R. The small leucine-rich repeat proteoglycan biglycan binds to alpha-dystroglycan and is upregulated in dystrophic muscle. J. Cell Biol. 2000, 148 (4), 801-810. (20) Schaefer, L.; Babelova, A.; Kiss, E.; Hausser, H. J.; Baliova, M.; Krzyzankova, M.; Marsche, G., Young, M. F. and others. The matrix component biglycan is proinflammatory and signals through Toll-like receptors 4 and 2 in macrophages. J. Clin. Invest. 2005, 115 (8), 2223-2233. (21) Tufvesson, E.; Westergren-Thorsson, G. Alteration of proteoglycan synthesis in human lung fibroblasts induced by interleukin-1 beta and tumor necrosis factor-alpha. J. Cell. Biochem. 2000, 77 (2), 298-309. (22) Chang, M. Y.; Tsoi, C.; Wight, T. N.; Chait, A. Lysophosphatidylcholine Regulates Synthesis of Biglycan and the Proteoglycan Form of Macrophage Colony Stimulating Factor. Arterioscler. Thromb. Vasc. Biol. 2003, 23 (5), 809-815. (23) Schaefer, L.; Beck, K. F.; Raslik, I.; Walpen, S.; Mihalik, D.; Micegova, M.; Macakova, K.; Schonherr, E. and others. Biglycan, a Nitric Oxide-regulated Gene, Affects Adhesion, Growth, and Survival of Mesangial Cells. J. Biol. Chem. 2003, 278 (28), 2622726237. (24) Ferdinandy, P.; Schulz, R. Nitric oxide, superoxide, and peroxynitrite in myocardial ischaemia-reperfusion injury and preconditioning. Br. J. Pharmacol. 2003, 138 (4), 532-543. (25) Nathan, C. Inducible nitric oxide synthase: What difference does it make? J. Clin. Invest. 1997, 100 (10), 2417-2423. (26) Kamijo, R.; Harada, H.; Matsujama, T.; Bosland, M.; Gerecitano, J.; Shapiro, D.; Le, J.; Koh, S. I. and others. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 1994, 263 (5153), 1612-1615.

research articles

Cardiac Protein Profile of Biglycan Transgenic Mice (27) Xie, Q. W.; Cho, H.; Kashiwabara, Y.; Baum, M.; Weidner, J. R.; Elliston, K.; Mumford, R.; Nathan, C. Carboxyl terminus of inducible nitric oxide synthase. Contribution to NADPH binding and enzymatic activity. J. Biol. Chem. 1994, 269 (45), 2850028505. (28) Blatter, L. A.; Taha, Z.; Mesaros, S.; Shacklock, P. S.; Wier, W. G.; Malinski, T. Simultaneous Measurements of Ca2+ and Nitric Oxide in Bradykinin-Stimulated Vascular Endothelial Cells. Circ. Res. 1995, 76 (5), 922-924. (29) Hogan, B.; Beddington, R.; Constantini, F.; Lacy, E. Manipulating the Mouse Embryo, 2nd ed.; Cold Spring Harbour Laboratory: Cold Spring Harbour, NY, 1996. (30) Puskas, L. G.; Bereczki, E.; Santha, M.; Vigh, L.; Csanadi, G.; Spener, F.; Ferdinandy, P.; Onody, A. and others. Cholesterol and cholesterol plus DHA diet-induced gene expression and fatty acid changes in mouse eye and brain. Biochimie 2005, 87 (2), 239239. (31) Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucl. Acids Res. 2001, 29 (9), e45. (32) Bernfield, M.; Kokenyesi, R.; Kato, M.; Hinkes, M. T.; Spring, J.; Gallo, R. L.; Lose, E. J. Biology of the syndecans- A family of transmembrane heparin sulfate proteoglycans. Annu. Rev. Cell Biol. 1992, 8, 365-393. (33) Bernfield, M.; Gotte, M.; Park, P. W.; Reizes, O.; Fitzgerald, M. L.; Lincecum, J.; Zako, M. Functions of cell surface heparan sulfate proteoglycans. Annu. Rev. Biochem. 1999, 68, 729-777. (34) Fisher, L. W.; Heegaard, A. M.; Vetter, U.; Vogel, W.; Just, W.; Termine, J. D.; Young, M. F. Human biglycan gene. Putative promoter, intron-exon junctions, and chromosomal localization J. Biol. Chem. 1991, 266 (22), 14371-14377. (35) Bascom, C. C.; Wolfshohl, J. R.; Coffey, R. J., Jr; Madisen, L.; Webb, N. R.; Purchio, A. R.; Derynck, R.; Moses, H. L. Complex regulation of transforming growth factor beta 1, beta 2, and beta 3 mRNA expression in mouse fibroblasts and keratinocytes by transforming growth factors beta 1 and beta 2. Mol. Cell. Biol. 1989, 9 (12), 5508-15. (36) Eghbali, M.; Tomek, R.; Sukhatme, V. P.; Woods, C. Bhambi, B. Differential effects of transforming growth factor-beta 1 and phorbol myristate acetate on cardiac fibroblasts. Regulation of fibrillar collagen mRNAs and expression of early transcription factors. Circ. Res. 1991, 69 (2), 483-90. (37) Murakami, M.; Kusachi, S.; Nakahama, M.; Naito, I.; Murakami, T.; Doi, M.; Kondo, J.; Higashi, T.; Ninomiya, Y.; Tsuji, T. Expression of the alpha 1 and alpha 2 chains of type IV collagen in the infarct zone of rat myocardial infarction. J. Mol. Cell Cardiol. 1998, 30 (6), 1191-202. (38) Kahari, V. M.; Larjava, H.; Uitto, J. Differential regulation of extracellular matrix proteoglycan (PG) gene expression. Transforming growth factor-beta 1 up-regulates biglycan (PGI), and versican (large fibroblast PG) but down-regulates decorin (PGII) mRNA levels in human fibroblasts in culture. J. Biol. Chem. 1991, 266 (16), 10608-15. (39) Ng, C. M.; Cheng, A.; Myers, L. A.; Martinez-Murillo, F.; Jie, C.; Bedja, D.; Gabrielson, K. L.; Hausladen, J. M.; Mecham, R. P.; Judge, D. P.; Dietz, H. C. TGF-beta-dependent pathogenesis of mitral valve prolapse in a mouse model of Marfan syndrome. J. Clin. Invest. 2004, 114 (11), 1586-92. (40) Neptune, E. R.; Frischmeyer, P. A.; Arking, D. E.; Myers, L.; Bunton, T. E.; Gayraud, B.; Ramirez, F.; Sakai, L. Y.; Dietz, H. C. Dysregulation of TGF-beta activation contributes to pathogenesis in Marfan syndrome. Nat. Genet. 2003, 33 (3) 407-11. (41) Evans, W. H.; De Vuyst, E.; Leybaert, L. The gap junction cellular internet: connexin hemichannels enter the signalling limelight. Biochem. J. 2006, 397, 1-14. (42) Breuer, B.; Schmidt, G.; Kresse, H. Non-uniform influence of transforming growth factor-beta on the biosynthesis of different forms of small chondroitin sulphate/dermatan sulphate proteoglycan. Biochem. J. 1990, 269 (2), 551-554. (43) Scho¨nherr, E.; Jarvelainen, H. T.; Kinsella, M. G.; Sandell, L. J.; Wight, T. N. Platelet-derived growth factor and transforming growth factor-beta 1 differentially affect the synthesis of biglycan and decorin by monkey arterial smooth muscle cells. Arterioscler. Thromb. 1993, 13 (7), 1026-1036. (44) Ungefroren, H.; Krull, N. B. Transcriptional Regulation of the Human Biglycan Gene. J. Biol. Chem. 1996, 271 (26), 1578715795. (45) Kaji, T.; Yamada, A.; Miyajima, S.; Yamamoto, C.; Fujiwara, Y.; Wight, T. N.; Kinsella, M. G. Cell Density-dependent Regulation of Proteoglycan Synthesis by Transforming Growth Factor-beta 1 in Cultured Bovine Aortic Endothelial Cells. J. Biol. Chem. 2000, 275 (2), 1463-1470.

(46) Ahmed, M. S.; Oie, E.; Vinge, L. E.; Yndestad, A.; Andersen, G. O.; Andersson, Y.; Attramadal, T.; Attramadal, H. Induction of myocardial biglycan in heart failure in rats-an extracellular matrix component targeted by AT1 receptor antagonism. Cardiovasc. Res. 2003, 60 (3), 557-568. (47) de Andrade, C. R.; Cotrin, P.; Graner, E.; Almeida, O. P.; Sauk, J. J.; Coletta, R. D. Transforming growth factor -beta1 autocrine stimulation regulates fibroblast proliferation in hereditary gingival fibromatosis. J. Periodontol. 2001, 1726-1733. (48) Lijnen, P. J.; Petrov, V. V.; Fagard, R. H. Induction of Cardiac Fibrosis by Transforming Growth Factor-[beta]1. Mol. Gen. Metabol. 2000, 71 (1-2), 418-435. (49) Melendez, J.; Turner, C.; Avraham, H.; Steinberg, S. F.; Schaefer, E., Sussman, M. A. Cardiomyocyte Apoptosis Triggered by RAFTK/pyk2 via Src Kinase Is Antagonized by Paxillin. J. Biol. Chem. 2004, 279 (51), 53516-53523. (50) Yamamoto, K.; Kusachi, S.; Ninomiya, Y.; Murakami, M.; Doi, M.; Takeda, K.; Shinji, T.; Higashi, T. and others. Increase in the Expression of Biglycan mRNA Expression Co-localized Closely with that of Type I Collagen mRNA in the Infarct Zone After Experimentally-Induced Myocardial Infarction in Rats. J. Mol. Cell. Card. 1998, 30 (9), 1749-1756. (51) Beazely, M. A.; Watts, V. J. Regulatory properties of adenylate cyclases type 5 and 6: A progress report. Eur. J. Pharmacol. 2006, 535 (1-3), 1-12. (52) Michels, J.; Johnson, P. W. M.; Packham, G. Mcl-1. Internat. J. Biochem. Cell Biol. 2005, 37 (2), 267-271. (53) Shimizu-Hirota, R.; Sasamura, H.; Kuroda, M.; Kobayashi, E.; Hayashi, M.; Saruta, T. Extracellular Matrix Glycoprotein Biglycan Enhances Vascular Smooth Muscle Cell Proliferation and Migration. Circ. Res. 2004, 94 (8), 1067-1074. (54) Kikuchi, A.; Tomoyasu, H.; Kido, I.; Takahashi, K.; Tanaka, A.; Nonaka, I.; Iwakami, N.; Kamo, I. Haemopoietic biglycan produced by brain cells stimulates growth of microglial cells. J. Neuroimmunol. 2000, 106 (1-2), 78-86. (55) Weber, C. K.; Sommer, G.; Michl, P.; Fensterer, H.; Weimer, M.; Gansauge, F.; Leder, G.; Adler, G.; Gress, T. M., et al. Biglycan is overexpressed in pancreatic cancer and induces G1-arrest in pancreatic cancer cell lines. Gastroenterology 2001, 121 (2), 657667. (56) Lapidos, K. A.; Kakkar, R.; McNally, E. M. The dystrophin glycoprotein complex - Signaling strength and integrity for the sarcolemma. Circ. Res. 2004, 94 (8), 1023-1031. (57) Lefer, A. M.; Tsao, P.; Aoki, N.; Palladino, M. A., Jr. Mediation of cardioprotection by transforming growth factor-beta. Science 1990, 249 (4964), 61-64. (58) Yang, B. C.; Zander, D. S.; Mehta, J. L. Hypoxia-reoxygenationinduced apoptosis in cultured adult rat myocytes and the protective effect of platelets and transforming growth factor-beta(1). J. Pharmacol. Exp. Ther. 1999, 291 (2), 733-738. (59) Sears, C.; Ashley, E.; Casadei, B. Nitric oxide control of cardiac function: is neuronal nitric oxide synthase a key component? Phil. Trans. R. Soc. Lond. B 2004, 359 (1446), 1021-1044. (60) Danson, E. J.; Choate, J. K.; Paterson, D. J. Cardiac nitric oxide: Emerging role for nNOS in regulating physiological function. Pharmacol. Therap. 2005, 106 (1), 57-74. (61) Stuehr, D. J.; Cho, H. J.; Kwon, N. S.; Weise, M. F.; Nathan, C. F. Purification and Characterization of the Cytokine-Induced Macrophage Nitric Oxide Synthase: An FAD- and FMN-Containing Flavoprotein. PNAS 1991, 88 (17), 7773-7777. (62) Hu, J.; Van Eldik, L. J. Calmodulin and Signal Transduction; Van Eldik, L., Watterson, D. M., Eds.; Academic Press: New York, 1998; pp 288-334. (63) Gribovskaja, I.; Brownlow, K. C.; Dennis, S. J.; Rosko, A. J.; Marletta, M. A.; Stevens-Truss, R. Calcium-Binding Sites of Calmodulin and Electron Transfer by Inducible Nitric Oxide Synthase. Biochemistry 2005, 44 (20), 7593-7601. (64) Torok, K.; Stauffer, K.; Evans, W. H. Connexin 32 of gap junctions contains two cytoplasmic calmodulin-binding domains. Biochem. J. 1997, 326, 479-483. (65) Ahmad, S.; Martin, P. E. M.; Evans, W. H. Assembly of gap junction channels - Mechanism, effects of calmodulin antagonists and identification of connexin oligomerization determinants. Eur. J. Biochem. 2001, 268 (16), 4544-4552. (66) Yoshihara, M.; Adolfsen, B.; Littleton, J. T. Is synaptotagmin the calcium sensor? Curr. Opin. Neurobiol. 2003, 13 (3), 315-323. (67) Weber, T.; Zemelman, B. V.; McNew, J. A.; Westermann, B.; Gmachl, M.; Parlati, F.; Sollner, T. H.; Rothman, J. E. SNARE dependent membrane fusion. Mol. Biol. Cell 1998, 9, 331A-331A.

PR060571B Journal of Proteome Research • Vol. 6, No. 2, 2007 861