Oxidative Stress Induced by Copper and Iron Complexes with 8

Article pubs.acs.org/molecularpharmaceutics

Oxidative Stress Induced by Copper and Iron Complexes with 8‑Hydroxyquinoline Derivatives Causes Paraptotic Death of HeLa Cancer Cells Amelia Barilli,† Corrado Atzeri,‡ Irene Bassanetti,‡ Filippo Ingoglia,† Valeria Dall’Asta,† Ovidio Bussolati,† Monica Maffini,‡ Claudio Mucchino,‡ and Luciano Marchiò*,‡ ‡

Dipartimento di Chimica, Università degli Studi di Parma, Viale delle Scienze 17/A, 43123 Parma, Italy Dipartimento di Scienze Biomediche, Biotecnologiche e Traslazionali, Università degli Studi di Parma, Via Volturno 39, 43125 Parma, Italy

†

S Supporting Information *

ABSTRACT: Here, we report the antiproliferative/cytotoxic properties of 8-hydroxyquinoline (8-HQ) derivatives on HeLa cells in the presence of transition metal ions (Cu2+, Fe3+, Co2+, Ni2+). Two series of ligands were tested, the arylvinylquinolinic L1−L8 and the arylethylenequinolinic L9−L16, which can all interact with metal ions by virtue of the N,O donor set of 8HQ; however, only L9−L16 are flexible enough to bind the metal in a multidentate fashion, thus exploiting the additional donor functions. L1−L16 were tested for their cytotoxicity on HeLa cancer cells, both in the absence and in the presence of copper. Among them, the symmetric L14 exhibits the highest differential activity between the ligand alone (IC50 = 23.7 μM) and its copper complex (IC50 = 1.8 μM). This latter, besides causing a significant reduction of cell viability, is associated with a considerable accumulation of the metal inside the cells. Metal accumulation is also observed when the cells are incubated with L14 complexed with other late transition metal ions (Fe3+, Co2+, Ni2+), although the biological response of HeLa cells is different. In fact, while Ni/L14 and Co/L14 exert a cytostatic effect, both Cu/L14 and Fe/L14 trigger a caspase-independent paraptotic process, which results from the induction of a severe oxidative stress and the unfolded protein response. KEYWORDS: Copper, iron, 8-hydroxyquinoline, ionophore, oxidative stress, unfolded protein response, paraptosis

■

are used.14−17 As a consequence, direct DNA damage can, therefore, be a key determinant of the cytotoxic potential mediated by copper complexes.18−22 Moreover, copper complexes are also endowed with cytotoxic potential due to their ability to either sequester the metal inappropriately or assist in accumulating it inside the cells. The administration of copper chelating agents is known to hinder angiogenesis, the process responsible for the formation of new blood vessels, which requires copper as a cofactor and is particularly important for rapidly growing tumors.23,24 Furthermore, an excess of intracellular copper usually causes severe perturbation of the cellular redox status25,26 and can cause the inhibition of proteasome, with the consequent accumulation of misfolded and polyubiquitinated proteins in the endoplasmic reticulum (ER).27,28 This leads to the onset of ER stress,29−31 which ultimately triggers an evolutionarily conserved response called the unfolded protein

INTRODUCTION Copper is an essential trace element found in the active sites of many enzymes and electron transport proteins involved in energy production or antioxidant defense. Due to its ability to shift between the Cu2+ and Cu+ redox states, a major role of copper is to assist in the catalysis of oxidoreductive reactions involving oxygen and its radicals (reactive oxygen species, ROS).1 Interestingly, the same redox properties of the metal also mediate its toxicity because uncontrolled production of ROS results in oxidative stress, to which does not follow a correct antioxidant response and which consequently damages biological macromolecules such as nucleic acids, proteins, and lipids.2−5 Under normal conditions, all processes involved in copper intake, distribution, utilization, and excretion are tightly regulated.6−11 In light of the dual role of copper as an indispensable component of the cell metabolic machinery and a potential cytotoxic agent, compounds able to perturb intracellular copper homeostasis have been investigated as potential anticancer agents.12,13 Copper complexes can directly interact and damage nucleic acids when ligands behaving as DNA intercalating agents © 2014 American Chemical Society

Received: Revised: Accepted: Published: 1151

October 8, 2013 February 26, 2014 March 4, 2014 March 5, 2014 dx.doi.org/10.1021/mp400592n | Mol. Pharmaceutics 2014, 11, 1151−1163

Molecular Pharmaceutics

Article

response (UPR), which is an attempt of the cell machinery to restore the function of the endoplasmic reticulum.32,33 When unresolved, ER stress can develop into nonapoptotic cell death, morphologically characterized by an extensive cytoplasmic vacuolization derived from ER swelling.29,30 This type of programmed cell death (PCD), paraptosis,34 is still poorly defined from a molecular point of view, but consolidated evidence indicates that it is caspase-independent and is derived from an unresolved perturbation of ER functions.30,31,35−41 The discovery of compounds able to activate a PCD alternative to apoptosis appears necessary because both the innate and acquired resistance to anticancer compounds displayed by many tumors result from defects or inhibition of the apoptotic machinery. In previous studies, we have shown how Cu2+ complexes with chelating agents of the appropriate lipophilicity were endowed with anticancer properties related to the ionophoric character of the ligands employed. All the molecules examined were able to mediate the transport of the metal across the cell membrane, thus causing an intracellular copper overload, a severe disturbance of intracellular redox homeostasis, and a massive perturbation of protein folding in the ER, ultimately followed by the activation of the paraptotic process.30,42−44 In an effort to improve the cytotoxic potential of copper complexes, we investigated two novel series of 8-HQ derivatives by introducing different moieties near the nitrogen atom of the quinolinic system. The ligands prepared are characterized by different coordinating properties as well as different conformational mobilities (Figure 1), which depend on the presence of aromatic moieties with variable coordinating ability connected by a vinylic (rigid, L1− L8) or an ethylenic (flexible, L9−L16) bridge. The cytotoxic potential of these ligands, both alone and in the presence of equimolar amount of CuCl2, was then explored on the human tumor cell line HeLa, in order to identify a correlation between the structural modifications of the ligands and the cytotoxicity of their copper complexes. The ligand that exerted the highest toxic effect when complexed with Cu2+, namely, L14, was then combined with different metal ions, so as to investigate the role of the metal in the cytotoxicity driven by the L14 complex. For these studies, the late transition metal ions Fe3+, Ni2+, and Co2+ were selected, to which L14 can provide the same N,O chelation as Cu2+. According to the perturbation of the redox status they can induce in cells, the four metal ions employed can be divided in two groups, namely, Cu2+/Fe3+ and Ni2+/Co2+ acting as strong and moderate oxidative stress inducers, respectively. In this work we wished to investigate whether the ability of the metal complexes to induce an intracellular oxidative stress has a role in their activation of caspase-independent paraptotic cell death.

Figure 1. Molecular structures of the L1−L16 ligands.

and 400 cm−1 on a Perkin-Elmer Nexus FTIR with KBr windows. Elemental analysis (C, H, and N) was performed on a Carlo Erba EA 1108 automated analyzer. All final compounds showed purity ≥95% by 1H NMR and elemental analysis. See the Supporting Information for spectral characterization of the final compounds. Synthesis. Details on the synthesis and characterization of L1−L16 and of their copper complexes are given in the Supporting Information. General Procedure for the Synthesis of Vinylic Derivatives L1−L8. Step 1: In acetic anhydride (10 mL), the appropriate aldehyde was mixed with an equimolar quantity of 2-methyl-8hydroxyquinoline or 5,7-dichloro-2-methyl-8-hydroxyquinoline, and the mixture was heated (90−130 °C) for 72 h under an inert atmosphere with magnetic stirring. The reaction was monitored using TLC. After cooling to room temperature, water (50 mL) was added, and the whole mixture was stirred for two hours, after which it was neutralized with NaOH (10% in water). The crude product was extracted with dichloromethane (2 × 30 mL),

■

EXPERIMENTAL SECTION All reagents were commercially available, except for 2methoxybenzaldehyde, which was prepared as reported elsewhere.45 The ligand syntheses were performed through a slight modification of the procedure reported in the literature.46 Catalytic hydrogenation was achieved through the use of a Parr hydrogenation apparatus. The 1H NMR spectra were recorded on 300 and 400 MHz Bruker Avance spectrometers using standard pulse sequences. Spectra were acquired at room temperature using CDCl3, CD2Cl2, acetone-d6 and methanold4 as solvents. Chemical shifts were reported in parts per million (ppm) and referenced to residual solvent protons. ESI-MS spectra were recorded on a single quadrupole instrument (SQ detector, Waters). Infrared spectra were recorded between 4000 1152

dx.doi.org/10.1021/mp400592n | Mol. Pharmaceutics 2014, 11, 1151−1163


Article

washed with water (3 × 30 mL) and brine (2 × 30 mL), dried with anhydrous Na2SO4, and filtered, and the solvent was removed under reduced pressure. In some cases, the product was recrystallized to increase the purity of the intermediate compound. Step 2: To obtain the deacetylated product, the crude intermediate (1 equivalent) was dissolved in methanol and mixed with a solution of sodium methoxide (3 equivalents) in methanol (20 mL). The mixture was stirred for two hours, after which it was neutralized with HCl (6 N in water). Methanol was evaporated under reduced pressure, and dichloromethane (30 mL) was added. The mixture was washed with water (3 × 30 mL), dried with anhydrous Na2SO4, filtered, and vacuum-dried. Products were successively purified through recrystallization or silica column chromatography. General Procedure for the Synthesis of Ethylenic Derivatives L9−L14. The appropriate derivative (L1−L8) was dissolved in EtOH (200 mL) and then placed in the Parr hydrogenating vessel, and 10% weight of Pd/C (5% Pd) was added. The vessel was inserted into the apparatus and, after two H2(g) cycles were performed to rinse it, it was vigorously stirred at room temperature under hydrogen for 2−72 h. The reaction mixture was then filtered, and the filtrate was evaporated under reduced pressure. Products were purified through silica column chromatography. General Procedure for the Synthesis of Ethylenic Derivatives L15 and L16. The appropriate derivative (L7 or L8) was dissolved in EtOH, and hydrate hydrazine was added at 70 °C. The mixture was heated under reflux at 80 °C for 20 h, after which the solvent was evaporated under reduced pressure. The product was extracted with dichloromethane (2 × 30 mL) and washed with water (2 × 20 mL). The organic layers were combined, dried with anhydrous Na2SO4, filtered, and vacuumdried. Cell Cultures and Experimental Treatments. Serum and DMEM for cell growth were obtained from Lonza (Basel, Switzerland) and Euroclone (Milan, Italy), respectively. Unless otherwise indicated, Sigma Aldrich (Milan, Italy) was the source of all other chemicals. The HeLa cell line, derived from human cervical adenocarcinoma, was obtained from ATCC. Cells were routinely grown in Dulbecco’s modified Eagle’s medium (DMEM) (4.5 g/L glucose, pH 7.4) supplemented with 10% fetal bovine serum (FBS), 4 mM glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin and maintained at 37 °C in a humidified atmosphere of 5% CO2 in air. Treatments required by the experimental design were performed by supplementing complete growth medium with the proper amount of inorganic salts (CoCl2·6H2O, NiCl2·6H2O, CuCl2·2H2O and FeCl3·6H2O), ligands, or metal complexes (obtained by mixing ligands and inorganic salts 1:1 vol/vol in culture medium) from 30 mM stock solutions in DMSO. Inorganic salt solutions were freshly prepared before every experiment. FeCl3·6H2O may cause the precipitation of iron hydroxide complexes at physiological pH. However, this occurrence is prevented by the presence of FBS in the growth medium as well as by the coadministration of the chelating ligands L1−L16. In all cases, the growth media used for the treatments were clear solutions. Cell Viability Assay. HeLa cells were seeded in complete growth medium in 96-well plates at a density of 5 × 103 cells/ well. After 24 h, the growth medium was replaced by fresh medium containing the indicated compounds. Cell viability was tested after 48 h of incubation by replacing culture medium with a solution of the fluorescent dye resazurin in serum-free medium

(1:10) as previously described.42 Cell viability was calculated according to the following equation: viability = [(Vt − B)/(Vu − B)] × 100, where Vt and Vu are the fluorescence values obtained in treated and untreated cells, respectively, and B is the background value. Dose−response curves were fitted with nonlinear regression analysis, and IC50 values were calculated with GraphPad Prism 5.0. Cell Content of Metals. To measure the cellular metal content, 1 × 106 HeLa cells were seeded in 10 cm dishes. After 24 h, the growth medium was renewed, and the monolayers were treated as required by the experimental design. After 6 h, three culture plates per condition were used for analytical metal determination as previously described.42 Briefly, cells were washed twice with ice-cold PBS, collected in 1.5 mL of trypsin solution, then diluted to 5 mL with concentrated HNO3, mineralized by a microwave procedure, and analyzed for metal content using ICP-AES (inductively coupled plasma atomic emission spectroscopy). One culture plate per condition was used for protein quantification by a modified Lowry method.47 Cellular metal contents are expressed as nmol/mg of protein. Cell Counts. Cells were seeded on 2 cm2 wells of disposable 24-well cell culture plates at a density of 3 × 104 cells/well. The growth medium was renewed after 24 h and replaced with the incubation medium as required by the experimental design. Cell number was determined after further 48 h incubation with a Cell Counter ZM (Coulter Electronics Ltd., Luton, U.K.) after culture trypsinization. LDH Release. HeLa cells were seeded on 24-well plates (3 × 104 cells/well), and the experimental treatments were started 24 h later. The release of LDH from dead cells into the medium (experimental LDH release) was assessed after 48 h with a CytoTox 96 nonradioactive cytotoxicity assay (Promega, Milano, Italy) by measuring the absorbance at 490 nm. After subtraction of background values, LDH release under each experimental condition was expressed as percent of data obtained from control, untreated cells (% of control). Cell Cycle Analysis. The percentage of cells in the G0/G1, S, and G2/M phases of the cell cycle under the experimental conditions was measured in HeLa cells with the Muse Cell Cycle Kit (Millipore S.p.a., Vimodrone, Milano, Italy) according to the manufacturer’s instructions. Briefly, cells were seeded on 6-well plates at a density of 8 × 104 cells/well and treated as required by the experimental design. After 18 h, adherent cells were detached by trypsinization of the monolayer and collected by centrifugation together with floating cells. The cell pellets were resuspended in 70% ethanol, maintained at −20 °C for at least 3 h, then washed twice with PBS, and resuspended in 200 μL of the propidium iodide (PI) solution provided by the kit. PI fluorescence intensity was measured after 30 min with the Muse Cell Analyzer (Millipore S.p.a.), and the analysis was performed with the internal software of the apparatus. Western Blot Analysis. Cells grown to subconfluence on 10 cm diameter dishes were treated as required by the experimental plan. At the end of the treatment, both adherent and floating cells were collected, rinsed twice in PBS, and lysed. Unless otherwise specified, the lysis buffer was DTT-free and contained 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM βglycerophosphate, 1 mM Na3VO4, 1 mM NaF, 2 mM imidazole, and a cocktail of protease inhibitors (Complete, Mini, EDTAfree, Roche). Lysates were then sonicated for 5 s and centrifuged at 12000g for 10 min at 4 °C. After protein quantification of the supernatant with the Bio-Rad protein assay, 30 μg of protein was 1153



Article

Table 1. Primers Employed for qRT-PCR Analysis RPL15 CHOP IRE1 BIP GCLM HMOX1 FOS cyclin D1 CDKN1A/p21

forward primer

reverse primer

5′ GCAGCCATCAGGTAAGCCAAG 3′ 5′ CTTCTCTGGCTTGGCTGACT 3′ 5′ AAAACTTTGGGGAACGAATG 3′ 5′ GCCGTCCTATGTCGCCTTC 3′ 5′ GTGATGCCACCAGATTTGACT 3′ 5′ CAGTGCCACCAAGTTCAAGC 3′ 5′ GGGCAAGGTGGAACAGTTATC 3′ 5′ CCCTCGGTGTCCTACTTCAA 3′ 5′ CCTGTCACTGTCTTGTACCCT 3′

5′ AGCGGACCCTCAGAAGAAAGC 3′ 5′ TCCCTTGGTCTTCCTCCTCT 3′ 5′ CGTCTCCTCCAGAAAAAGATG 3′ 5′ TTTGTTTGCCCACCTCCAAT 3′ 5′ TTCACAATGACCGAATACCG 3′ 5′ GTTGAGCAGGAACGCAGTCTT 3′ 5′ CCGCTTGGAGTGTATCAGTCA 3′ 5′ AGGAAGCGGTCCAGGTAGTT 3′ 5′ GCGTTTGGAGTGGTAGAAATCT 3′

mixed with Laemmli buffer 4×, heated at 95 °C for 5 min, and loaded on a gel for SDS−PAGE. Resolved proteins were then transferred to polyvinylidene difluoride membranes (Millipore S.p.a.). After 2 h of incubation at room temperature in 10% blocking solution (Roche Diagnostics S.p.A., Milano, Italy), the blots were exposed overnight at 4 °C to anti-caspase-3 (fulllength and cleaved, rabbit polyclonal 1:1000, Cell Signaling), anti-PARP1 (full-length and cleaved, mouse monoclonal 1:500, Santa Cruz Biotechnology), or antiubiquitin (mouse monoclonal 1:1000, Santa Cruz Biotechnology) primary antibodies, diluted in 5% bovine serum albumin solution in TBS with 0.1% Tween. The blots were then washed and exposed to HRP-conjugated anti-mouse or anti-rabbit antibodies (ExactaCruz, Santa Cruz Biotechnology), diluted 1:10000 in blocking solution for 1 h at room temperature. For loading standardization, membranes were exposed to polyclonal rabbit anti-GAPDH (1:4000, Cell Signaling). Immunoreactivity was visualized with the Immobilon Western Chemiluminescent HRP Substrate (Millipore S.p.A.). qRT-Polymerase Chain Reaction. 1 μg of total RNA, extracted with GenElute Mammalian Total RNA Miniprep Kit (Sigma, Milano, Italy), was reverse-transcribed, and 40 ng of cDNA was amplified as described previously.48 The sequences of the forward and reverse primers employed are listed in Table 1. The expression of the gene of interest under each experimental condition was normalized to that of the housekeeping gene RPL15 (Ribosomal Protein Like 15) and shown relative to its expression level in control, untreated cells (=1). ROS Generation. ROS generation was measured with a fluorometric assay based on the use of 5-(and-6)-chloromethyl20,70-dichlorodihydrofluorescein diacetate, acetyl ester (CMH2DCF-DA, Molecular Probes, Invitrogen, San Giuliano Milanese, Milano, Italy). After the experimental treatments, cells, seeded onto 24-well plates (3 × 104 cells/well), were incubated for 2 h in FBS-free growth medium in the presence of the probe (5 μM). Cells were then washed twice with PBS, and fluorescence in each well was measured with EnSpire Multimode Plate Reader (Perkin-Elmer). Data are expressed relatively to values obtained under control conditions (% of control) after subtraction of blank value, which correspond to fluorescence read in the absence of cells. Statistical Analysis. The statistical significance of differences among groups was addressed employing Student’s t test for unpaired data (GraphPad Prism 5.0). Differences were considered significant when p < 0.05.

linic compounds L1−L8, and the third step reduces them to arylethylenequinolinic species L9−L16. Scheme 1. Synthesis of 8-Hydroxyquinoline Derivatives L1− L16

The first reaction is a condensation in acetic anhydride46,49 between the nucleophilic carbanion, derived from the 2-methyl8-hydroxyquinoline, and an appropriate aldehyde. This step results in both the protection of the hydroxyl group of 8hydroxyquinoline with an acyl group and the formation of the vinyl bridge between the 8-hydroxyquinoline and the aromatic aldehyde. The yields of this step are modest, ranging from 25% for compound L2 (Ar = pyridine, X = H) to 61% for compound L6 (Ar = 8-HQ, X = H). The second step is deacetylation of the intermediate in a basic environment with NaOCH3 to provide the quinolin-8-olate anion, which is subsequently neutralized to obtain the arylvinylquinolinic products L1−L8. The yields of this step are high and range from 70% for product L5 (Ar = quinoline,

■

RESULTS Synthesis of Hydroxyquinoline Derivatives. The synthetic route of the hydroxyquinoline derivatives (Scheme 1) comprises three steps: the first two result in the arylvinylquino1154



Article

X = H) to 98% for product L7 (Ar = phenol, X = H). The final yields of both steps vary from 17% for compound L2 (Ar = pyridine, X = H) to 48% for compound L6 (Ar = 8-HQ, X = H). The double bond hydrogenation of the vinyl bridge of L1−L6 was performed using catalytic hydrogenation with H2 (g) and Pd/C (10% in weight) in ethanol. Different H2 pressures and reaction times were used, ranging from 0.8 atm/1 h to 2.5 atm/72 h, because of different reactivity of the compounds toward hydrogenation. This procedure yielded compounds L9−L14. Compounds L7 and L8, which were resilient to Pd/C hydrogenation, were reduced with hydrazine hydrate, yielding L15 and L16. Molecular Structures of Hydroxyquinoline Derivatives and Cu Complexes. The presence of a vinyl bridge in L1−L8 implies that six cis−trans isomers can exist based on the disposition of the two aromatic moieties with respect to the double bond. The molecular structures of L1−L6 were investigated by means of DFT calculations, and the relative energies of the six isomers are reported in the Supporting Information (Figures S1−S6). The four trans species are approximately 30 kJ/mol more stable than the cis isomers, likely due to the disruption of the π conjugation in the latter isomers, as substantiated by the 1H NMR experiments. In fact, the coupling constant (J) between the protons of a vinyl group largely depends on the hydrogen disposition with respect to the double bond. In the present case, according to the 1H NMR spectra reported in Figure 2 and Figures S7−S22 in the Supporting Information, the J value is approximately 17 Hz for L1−L6, in agreement with the trans geometry.

Figure 3. Molecular structures of L5,50 L6,51 L9, and L12 with thermal ellipsoids depicted at the 30% probability level. L6 is depicted in ball and stick format with its original numbering scheme.

with respect to the metal center. On the other hand, in the structures of unsubstituted 8-hydroxyquinoline derivatives with Cu2+,42,52,53 the metal adopts regular square planar geometry due to the absence of bulky groups such as the vinyl-aromatic or the ethylene-aromatic moieties found in L1−L16. The crystal packing of [Cu(L1)2] and [Cu(L4)2] is dictated by the presence of a large number of aromatic systems that form an extensive array of π−π interactions (Supporting Information, Figures S41 and S42). A different scenario occurs in L9−L16 because the ethylenic bridge confers higher conformational mobility to these molecules, and they may, in principle, be able to adopt a conformation that is suitable for tri- or tetradentate binding of a metal center. Inspection of the X-ray molecular structures of L9 (Figure 3) reveals that L9 would be able to accommodate a metal in an N,O,O tridentate chelation. In fact, this structure is stabilized by an N(1)···H−O(2) intramolecular hydrogen bond, and with minimal rotation around the ethylenic bridge, the metal can be easily coordinated in tridentate mode by L9. Additionally, the capacity of this class of ligands to bind a single metal center with all of their available donor groups was investigated via DFT calculations. The geometries of the optimized structures of Cu2+ complexes with L9−L12 (Supporting Information Figure S43) show that these ligands may act as polydentate chelators of a

Figure 2. 1H NMR spectrum of L1 (CD3OD). The six possible isomers are grouped into trans and cis isomers. The signal assignment is made on the basis of the COSY spectrum reported in the Supporting Information.

This structural assignment is also supported by the X-ray structures of L550 and L651 and by the structures of [Cu(L1)2] and [Cu(L4)2] reported in Figures 3 and 4, respectively. In particular, the experimentally derived structures of L5 and of L1 in [Cu(L1)2] correspond to the most stable of the six isomers investigated by DFT calculations. The experimental geometry of L4 in [Cu(L4)2] and that of L6 are the second most stable, with an energy very close to most stable isomer (see Figures S1−S6 in the Supporting Information). From this structural information, it can be assumed that L1− L8 are only capable of chelating on a metal center by means of the N,O moiety of the 8-hydroxyquinoline fragment. In the molecular structures of [Cu(L1)2] and [Cu(L4)2], the metal adopts a geometry that is intermediate between square planar and tetrahedral, with the coordination environment achieved by two bidentate N,O ligands that are arranged in a trans geometry 1155



Article

Figure 4. Molecular structures of [Cu(L1)2] and [Cu(L4)2] with thermal ellipsoids depicted at the 30% probability level. Symmetry code = −x; y; 1/2 − z. The molecular structure of [Cu(L14)] is depicted in ball and stick format with its original numbering scheme.54

single metal center. Water molecules were added to complete the coordination of the metal, which is trigonal bipyramidal in all cases. The previously reported molecular structure of the [Cu(L14)] complex demonstrated that L14 acts as a tetradentate ligand, forming a neutral species.54 The mixing of equimolar quantities of the ligands and CuCl2· 2H2O in methanol results in instantaneous formation of a dark green or dark brown precipitate, insoluble in most common laboratory solvents over a wide range of polarity. Crystals suitable for X-ray analysis were obtained for only [Cu(L1)2] and [Cu(L4)2] by the stratification of methanolic solutions of ligands over CuCl2·2H2O dissolved in an agar gel matrix. The insolubility of the copper complexes in water hindered their direct use in biological studies, which were performed by mixing CuCl2·2H2O and L1−L16 in the cell growth medium. Nevertheless, some information concerning the possible speciation in solution of the copper complexes was investigated by means of ESI-MS spectrometry. According to the spectra reported in Figures S23−S37 in the Supporting Information it is evident that, when mixing equimolar amounts of CuCl2 and the ligands, complexes of CuL and CuL2 stoichiometry may form, whose relative abundance is loosely associated with the molecular structure and coordination properties of the ligands. Moreover, the speciation of the Cu/L systems in biological media is expected to be heavily influenced by the presence of many potential copper chelators such as amino acids and proteins. The issue of Cu/L speciation in biological media was not here investigated. Viability of HeLa Cells: The Role of the Ligand. The effects of L1−L16 on cell viability have been investigated in HeLa cells, a tumor cell line derived from human cervical adenocarcinoma. As shown in Figure 5, all ligands tested are cytotoxic, with IC50 values ranging from 2.6 (L4) to 23.7 (L14) μM. The simultaneous addition of an equimolar amount of

Figure 5. Dose−response curves for ligands and copper complexes in HeLa cells. Cell viability was assessed using the resazurin method on HeLa cells incubated for 48 h with different concentrations of ligands or copper complexes. Data are the means ± SEM of three independent experiments, each performed in triplicate. Error bars are visible when larger than the points. 1156



Article

copper significantly enhances the cytotoxic potential of several, but not all, compounds. While no significant change can be observed for the IC50 values of L4, L5, L8, L9, L11, L12, and L15, a marked decrease in those of the remaining ligands is observed in the presence of the metal (Table 2). No apparent dependence Table 2. IC50 (μM) Values for L1−L16 and Their Copper Complexes on HeLa Cells IC50 L1 L2 L3b L4 L5 L6c L7 L8 L9 L10 L11 L12 L13 L14 L15 L16

LX

Cu/LXa

9.6 8.7 nd 2.6 6.4 − 11.9 3.2 7.2 14.0 10.2 12.6 14.9 23.7 5.0 7.5

4.3 2.7 nd 2.1 4.4 − 3.7 2.0 4.9 5.3 6.0 7.9 2.9 1.8 2.6 2.7

a

The cytotoxic activity is measured for mixtures of CuCl2 and 8hydroxyquinoline derivatives at a 1:1 molar ratio. bThe ligand L3 is insoluble in the cell growth medium. cTreatment with either ligand alone or ligand and copper does not lead to any appreciable decrease in cell viability.

of the cytotoxicity of the ligands on their chemical structure nor any significant difference between compounds bearing single or double bonds can be observed. However, the maximal differential effect between the ligand and the corresponding copper complex is exhibited by the symmetric ligand L14. This is the least toxic ligand of the sixteen compounds screened, but its IC50 value drops to 1.8 μM when it is combined with CuCl2, thus becoming the most cytotoxic compound among those tested. The ability of L14 to provide copper with tetradentate coordination, thus forming a neutral complex, may be a key factor promoting both stability of the complex and transport across the cell membrane. Viability of HeLa Cells: The Role of the Metal. The role of the metal in the cytotoxicity of L14 complexes has been investigated by addressing the effects of the ligand combined with inorganic salts of metal ions other than copper, namely, FeCl3·6H2O, CoCl2·6H2O, and NiCl2·6H2O, at a 1:1 molar ratio. As shown in Figure 6A, a significant, rapid increase in the intracellular metal content occurs upon incubation with Ni/L14, Co/L14, and Fe/L14, although to a lesser degree than after incubation with Cu/L14. After 6 h in the presence of L14 metal complexes (hereafter indicated as M/L14), indeed, the concentration of each metal inside the cells is considerably increased with respect to both the control conditions and cells incubated in the presence of the inorganic salts alone, confirming the ionophoric properties of the L14 ligand. With respect to the effects of the different complexes on HeLa cell viability, the dose−response curves obtained upon incubation with increasing concentrations of M/L14 show that treatment with Co/L14 or Ni/L14 lowers cell viability to an extent comparable to that of the ligand alone. In contrast,

Figure 6. Effects of metal complexes on HeLa cell viability. (A) HeLa cells were left untreated (control) or treated for 6 h with 11.3 μM Co/ L14, CoCl2·6H2O, Ni/L14, or NiCl2·6H2O, 1.8 μM Cu/L14 or CuCl2· 6H2O, or 4.2 μM Fe/L14 or FeCl3·6H2O. Metal content was assessed by ICP-AES as described in the Experimental Section. The bars are the means ± SEM of three independent determinations. *p < 0.05, **p < 0.01 vs the corresponding metal alone (M). (B) HeLa cells were incubated for 48 h with increasing concentrations of L14 or different metal complexes of L14 (M/L14). Cell viability was then assessed with the resazurin method. Data are the means ± SEM of three independent experiments, each performed in triplicate. Error bars are visible when larger than the points. (C) After treatment of the cells for 48 h with 11.3 μM L14, Co/L14, or Ni/L14, 1.8 μM Cu/L14, or 4.2 μM Fe/L14, LDH release was measured in the incubation medium as described in the Experimental Section. Data, expressed as percent of control, are the means ± SEM of four independent experiments each performed in triplicate. **p < 0.01 vs control. (D) Cell number was assessed at the beginning (control, t0) and the end (48 h) of incubation with 11.3 μM L14, Co/L14, or Ni/L14, 1.8 μM Cu/L14, or 4.2 μM Fe/L14. Data are the means ± SEM of three independent experiments, each performed in triplicate. **p < 0.01, ***p < 0.001 vs control at 48 h. 1157



Article

treatment with the most effective Cu/L14 or Fe/L14 causes more evident cell loss and completely abolishes cell viability when the metals are employed at the highest concentration, with IC50 values corresponding to 1.8 μM and 4.2 μM for the copper and iron complexes, respectively (Figure 6B). Interestingly, a massive leak of LDH in the culture medium occurs upon incubation of HeLa cells for 48 h with Cu/L14 or Fe/L14 at their IC50 values, but not with 11.3 μM L14, Co/L14, or Ni/L14 (Figure 6C). Since LDH is a stable cytosolic enzyme released upon cell lysis, its accumulation in the culture medium is universally considered a marker of cell death.55 We can thus conclude that the treatment with copper and iron L14 complexes is cytotoxic, while the reduction of cell viability observed in the other experimental conditions is rather referable to antiproliferative effects of the compounds tested within the range of concentrations employed. Consistent with these results, the data in Figure 6D indicate that although treatment with 11.3 μM L14, Co/L14, or Ni/L14 significantly reduces the cell number with respect to untreated cultures, only incubation with Cu/L14 or Fe/L14 at their IC50 values lowers the cell number below that initially seeded (t0). Altogether, these results indicate that incubation with L14, both alone and combined with metals, causes obvious damage to the cell population. However, while L14, Co/L14, and Ni/L14 likely exert an antiproliferative rather than a cytotoxic effect, the simultaneous addition of highly redox-active metals to ligandsupplemented medium induces cell death. Antiproliferative Effect of M/L14 Complexes. To verify the antiproliferative effect of M/L14 complexes hypothesized on the basis of the cell viability experiments, we next explored the effects of the complexes on cell cycle progression by flow cytometry. As shown in Figure 7A, a significant decrease of the population in G0/G1 and a concomitant increase of cells in S and G2/M are observed upon treatment with L14, Co/L14, Ni/L14, Cu/L14, and Fe/L14, indicating that these molecules cause cell cycle arrest in the G2/M phase. Consistently, the expression of cyclin D1, whose activity is required for the G1/S cell cycle transition,56 appears to be reduced in the presence of L14 and its metal complexes, although without reaching a statistical significance. Under the same conditions, the expression of the inhibitor of cell cycle progression CDKN1A/p21 mRNA, coding for cyclin-dependent kinase inhibitor 1A,57 appears accordingly induced (Figure 7B). Altogether these results sustain the hypothesis that the ligand exerts an at least modest antiproliferative effect, which is conserved upon addition of any of the metals employed. Characterization of the Cytotoxic Activity of RedoxActive Metal Ions. The incubation of HeLa cells with L14 in the presence of Cu2+ or Fe3+ causes significant cell loss, which is clearly demonstrated by the representative microscopic field shown in Figure 8A. In the same figure, magnification allows a better appreciation of the morphological features of dying cells in Cu/L14 and Fe/L14 treated populations. Extensive vacuolization of the cytoplasm becomes evident upon treatment with either Cu/L14 or Fe/L14 (Figure 8A, middle and lower panels), but not with L14 alone (Figure 8A, upper panel). These morphological traits are typical of paraptosis, a type of nonapoptotic cell death that is a consequence of endoplasmic reticulum stress (ER stress) and unfolded protein response (UPR) in the presence of caspase inhibition.30 In agreement with the morphology, the results of Western blot analysis confirmed that no cleavage of caspase-3 occurs upon treatment of HeLa cells with either Cu/L14 or Fe/L14 (Figure 8B) or, as expected,

Figure 7. Antiproliferative effect of M/L14 complexes. HeLa cells were treated for 24 h with 11.3 μM L14, Co/L14, or Ni/L14, 1.8 μM Cu/ L14, or 4.2 μM Fe/L14. (A) Cell cycle progression was analyzed through flow cytometry (see Experimental Section), and the percentage of the cell population in each phase was calculated. The bars represent the means ± SD of four independent experiments. *p < 0.05, **p < 0.01 vs control. (B) The expression of cyclin D1 and CDKN1A/p21 mRNA was analyzed by RT-qPCR under the same experimental conditions. The data are normalized to RPL15 mRNA and reported as the means ± SEM of three separate experiments, each performed in duplicate. *p < 0.05 vs control.

with L14, Co/L14, or Ni/L14, whereas cleavage of caspase-3 is readily detected in cells treated with the known proapoptotic drug cisplatin (CisPt), employed as a positive control.58 Consistent with these results, the caspase-3 substrate poly(ADP-ribose) polymerase-1 (PARP-1) is only marginally cleaved upon treatment with Cu/L14 and Fe/L14, whereas it is completely processed in cisplatin-treated cells. To determine whether the mechanism of action of Cu/L14 and Fe/L14 involves the induction of ER stress and UPR, the expression of genes related to these cell processes was evaluated under our experimental conditions. As shown in Figure 9A, a significant upregulation of the expression of ER stress induced IRE1,59 as well as a marked increase of UPR-related BIP mRNA,60 can be observed upon treatment with Cu/L14 and Fe/ L14, but not in cells incubated with other M/L14. The expression of CHOP, which is activated by endoplasmic reticulum stress and promotes apoptosis when UPR is unresolved,61 also appears to be induced by copper and iron complexes. Taken together, the analysis of these transcripts indicates that the treatment with Cu/L14 and Fe/L14, but not L14, Co/L14, and Ni/L14, causes the induction of UPR. This effect is consistent with the increase of ubiquitinylated proteins detectable only upon incubation with copper and iron L14 complexes (Figure 9B) and with the protective effects exerted by the preincubation with the inhibitor of protein synthesis 1158



Article

Figure 9. Molecular characterization of Cu/L14 and Fe/L14 dependent cytotoxicity. HeLa cells were incubated for 18 h in the absence (control) or in the presence of 11.3 μM L14, Co/L14, or Ni/L14, 1.8 μM Cu/ L14, or 4.2 μM Fe/L14. (A, B) The expression of the indicated gene involved in ER stress/UPR (panel A) and metal/oxidative stress (panel B) was analyzed by RT-qPCR. Data are normalized to RPL15 mRNA and reported as the means ± SEM of three separate experiments, each performed in duplicate. *p < 0.05, **p < 0.01 vs control. (C) Ubiquitinylated proteins (Ub-proteins) were detected by immunoblot analysis. Molecular weights (kDa) are indicated, and GAPDH has been used as loading control. A typical experiment, repeated three times with comparable results, is shown. (D) The production of ROS was evaluated by measuring fluorescence in CM-H2DCFDA-loaded cells (see Experimental Section). Data are means ± SEM of three independent determinations, each performed in duplicate. **p < 0.01, ***p < 0.001 vs control.

Figure 8. Paraptotic features of Cu/L14 and Fe/L14 dependent cell death. (A) HeLa cells were either untreated or treated for 48 h with 11.3 μM L14, 1.8 μM Cu/L14, or 4.2 μM Fe/L14. Phase contrast images of representative microscopic fields were taken at the end of the incubation. Upper and middle panels: 200×. Lower panel: 400×. (B) The cleavage of caspase-3 and PARP-1 proteins was evaluated in HeLa cells, either untreated or treated for 18 h with 11.3 μM L14, Co/L14, or Ni/L14, 1.8 μM Cu/L14, 4.2 μM Fe/L14, or 20 μM cisplatin (CisPt). The expression of GAPDH protein was employed as an internal loading control. Representative Western blots are shown. The experiments were repeated twice with comparable results.

cycloheximide (CHX) under the same conditions (Figure S44 in the Supporting Information). As expected, treatment with Cu/L14 and Fe/L14 but not Co/ L14 or Ni/L14 causes the induction of expression of transcripts endowed with antioxidant and metal response elements in their promoters, specifically GCLM (coding for the first rate limiting enzyme of glutathione synthesis),62 HMOX1 (encoding Heme Oxygenase, which catalyzes the first and rate-limiting step in the oxidative degradation of heme),63 and FOS (a member of the transcription factor complex AP-1),64 (Figure 9A). The upregulation of these mRNA is consistent with the induction of a significant oxidative stress by the treatment with copper and iron L14 complexes, which is further confirmed by the increased production of ROS under these experimental conditions (Figure 9C). Moreover, since the pretreatment with either antioxidant Nacetylcysteine (NAC) or Trolox (TRX) reduces the cytotoxicity of both Cu/L14 and Fe/L14 (Figure S44 in the Supporting

Information), we can conclude that the cytotoxic potential of these compounds is associated with their ability to alter the intracellular redox homeostasis.

■

DISCUSSION Over the past decade, the concept of programmed cell death (PCD) has been broadened to more than ten types of cell death mechanisms that have been thoroughly characterized from both a morphological and a molecular point of view.65,66 Apoptosis, thus far the best characterized type of PCD, is believed to be the major obstacle to cancer growth through the elimination of damaged cells. For this reason, pro-apoptotic drugs have been extensively employed in anticancer therapies. However, tumor cells have developed a vast array of strategies to limit or 1159



Article

complexes are critical to more efficient cell membrane crossing and intracellular complex accumulation. Given the importance of the redox features of the metal for the cytotoxic activity of copper complexes,2,44 we next sought to investigate the effects of L14 on cell viability when combined with metals able to induce different degrees of oxidative stress.72 The first group of ions included Fe3+ and Cu2+ because they are strong oxidative stress inducers, while Co2+ and Ni2+ were chosen as examples of moderately redox active agents. L14 was expected to bind all these late transition metals to nearly the same extent since the N2O2 donor set is able to confer good to high stability to metal complexes here investigated. To confirm the proper binding and the consequent intracellular accumulation of the metals by L14, we determined the intracellular content of each metal in HeLa cells after 6 h of incubation with inorganic salts alone or in the presence of L14 (M/L14). The results confirmed that the addition of L14 increases the cellular concentration of the metal of 2.1-fold for Co2+, 2.1-fold for Ni2+, 13.7-fold for Cu2+, and 1.8-fold for Fe3+ when compared to treatment with inorganic salts (see Figure 6A), thus demonstrating the nonselective ionophoric properties of L14 with these late transition metal ions. In addition to the L14-driven accumulation of all the metals into the cells, the complexes studied have different effects on cell viability. All the M/L14 employed cause a significant decrease in cell number compared to untreated controls. However, only Cu/ L14 and Fe/L14 exert cytotoxic activity, as indicated by the increased release of LDH and the reduction of the cell number beyond the original seeding upon incubation with these complexes. In contrast, no LDH release was detected upon incubation with cobalt and nickel L14 complexes, indicating that Co/L14 and Ni/L14 exert an antiproliferative effect on HeLa cells (see Figures 6B−D). Interestingly, the effects of these compounds on cell proliferation are comparable to those of L14 alone, suggesting that the antiproliferative activity observed may be due to the ligand itself. This scenario is further corroborated by the results of the cell cycle analysis, which indicated that both L14 and all its metal complexes cause cell cycle arrest in the G2/ M phase, consistent with the modest decrease of cyclin D1 expression and the concomitant induction of CDKN1A/p21 mRNA (see Figure 7), as already described for other metal complexes.73,74 Altogether, these findings indicate that treatment with L14 affects cell proliferation, both when the ligand is employed alone and when it is combined with late transition metals, whereas only its association with highly redox-active metals ultimately leads to cell death. The inefficacy of Co/L14 and Ni/L14 can also be attributed to the poor ionophoric properties of L14 with these two metals, resulting in a noncritical accumulation of the metals in the cells (see Figure 6). The cellular and molecular processes mediating the cytotoxic effects of Cu/L14 and Fe/L14 have been addressed at different levels. Interestingly, the cytotoxic behavior of the two compounds on HeLa cells appears to be based on the same mechanism. From a morphological point of view, both compounds induce the appearance of a massive vacuolization of the cell cytoplasm (see Figure 8A), as has already shown upon treatment with other compounds.30,31,39 At the molecular level, the cell death program triggered by Cu/L14 and Fe/L14 is associated with the induction of genes known to be involved in the UPR, namely, IRE1, BIP, and CHOP (see Figure 9). CHOP in particular is both a transcriptional factor induced to alleviate ER stress and one of the most important mediators of ER stressinduced apoptosis.75 However, the concomitant appearance of

circumvent apoptosis, and these strategies favor tumor growth and endow cancer cells with resistance to classical chemotherapy.67 Therefore, many efforts have been made in recent years to design protocols able to overcome apoptotic resistance, and inducers of PCD mechanisms other than apoptosis are now emerging as alternative therapeutic strategies to proapoptotic agents.65 In this context, metal-based compounds have shown promising results in both preclinical and clinical studies.68 We and others have shown the cytotoxic potential of copperchelating molecules, which primarily act through inhibition of proteasome activity and by triggering ER stress30,69,70 as well as the induction of a nonapoptotic PCD, called paraptosis or typeIII cell death.31,43 This type of PCD, characterized by massive vacuolization of the cytoplasm due to both ER and mitochondria swelling,34,35 is associated with the activation of the unfolded protein response (UPR) following severe and unresolved ER stress and does not require caspase activation.42,71 We have recently demonstrated that different classes of ligands, one with the 8-HQ framework and the other composed of pyrazole derivatives, with moderate to good affinity for Cu2+, are able to induce paraptosis in HeLa and prostate carcinoma PC3 cells. These ligands act as copper ionophores and mediate the efficient membrane transport and consequent accumulation of the metal within cells. In the same studies, we demonstrated that the fundamental condition to be satisfied for efficient transport of the metal through the cell membrane is the appropriate lipophilicity of the ligand.42 Therefore, to investigate other determinants of Cu/ligand-mediated cytotoxicity, we chemically and structurally modified 8-hydroxyquinoline (8HQ), a planar, N,O-donating ligand with a high affinity for Cu2+. Additional peripheral donor groups were attached to the 8-HQ scaffold to increase its metal-binding ability while only marginally affecting its lipophilicity. Consistently, the lipophilicity of these derivatives falls in a relatively narrow range. In this study, two series of 8-HQ derivatives are described, namely, an arylvinylquinolinic (L1−L8) and an arylethylenequinolinic (L9−L16) series, and their cytotoxic activities were characterized. Among the newly synthesized molecules, L14 exhibited the lowest cytotoxic potential when employed alone (IC50 = 23.7 μM) and the highest cytotoxicity when complexed with copper (IC50 = 1.8 μM). As expected, given their molecular structures, all the tested compounds are able to interact with copper through the N,O donor set typical of 8-HQ, but only the L9−L16 ligands are endowed with the appropriate conformational mobility that enables them to bind copper in a multidentate fashion (see Figure S43 in the Supporting Information). L14 is the only one that can provide the metal with tetradentate coordination and form a neutral complex by virtue of its acidic hydroxyl groups, thus favoring membrane crossing and the consequent accumulation of the metal in the cell. It should be stressed, however, that the ideal structural modifications of 8-HQ required to generate the symmetric L14 do not improve the cytotoxic potential of the copper complex, although they markedly attenuate the effects of the ligand on cell viability. In fact, the IC50 of 8-HQ on HeLa cells was reported to be 13.5 μM, considerably smaller than that of L14 (23.7 μM). We speculate that the divergent behavior of these two ligands may be due to their different dimensions and the more flexible nature of L14, factors that may inhibit L14 from crossing the cell membrane. On the other hand, when considering copper complexes, 8-HQ and L14 form [Cu(8HQ)2] and [Cu(L14)], respectively, which share similar molecular structures. Moreover, the neutral properties of these 1160



■

cytoplasmic vacuolization and the lack of caspase-3 involvement in Cu/L14 and Fe/L14 driven cytotoxicity (see Figure 8), along with the massive accumulation of ubiquitinated proteins (see Figure 9B), sustain the hypothesis that a perturbation of ER homeostasis occurs under these conditions, which, unresolved, ultimately activates the UPR and causes paraptotic cell death. According to this hypothesis, the protection exerted by cycloheximide, a known inhibitor of protein synthesis,76 on Cu/L14 and Fe/L14 treated cells is likely referable to the ability of the molecule to relieve cells from the accumulation of unfolded proteins (see Figure S44A in the Supporting Information). Whether the induction of paraptosis and caspase-3 inhibition by copper and iron complexes is due to the general occurrence of oxidative stress or to a direct interaction of the metal ions with the catalytic cysteine in the active sites of the protease deserves further investigations. In support of the latter hypothesis, data in the literature indicate that iron, copper, and zinc are able to inhibit caspase-3 in cell-free systems when employed at the proper concentration.43,77,78 Therefore, despite the lack of evidence for a direct interaction with the enzyme, it is possible that copper may interfere with protease activity to some extent. On the other hand, it is also evident that high intracellular levels of copper and iron induce a considerable oxidative stress, possibly causing the oxidation of the catalytic cysteines of caspases, as has been demonstrated for many proteases.5,79−82 Consistent with this assumption, treatment of HeLa cells with Cu/L14 and Fe/L14 but not with Co/L14 and Ni/L14 induces the expression of genes that are typical markers of a severe alteration of the intracellular oxidative status (see Figure 9A) and increases the intracellular levels of ROS (Figure 9C), thus suggesting that the different effects of M/L14 on cell viability may be related to the ability of the corresponding metal to alter cell redox homeostasis. In support of this hypothesis, the addition of either antioxidant N-acetylcysteine (NAC) or Trolox (TRX) reduces the cytotoxicity of both Cu/L14 and Fe/L14 (Figure S44B in the Supporting Information). However, since NAC is not only a ROS scavenger but also a potential metal chelator,83 the protective effect of this molecule could be ascribed to both metal or ROS scavenging abilities. On the contrary, cell protection exerted by the vitamin E analogue Trolox is solely ascribable to a ROS scavenging effect, since, according to its molecular structure, it should not interact with metal ions. The results obtained with these compounds confirm that the cell death process here described is referable, at least in part, to the induction of an intracellular oxidative stress. In conclusion, we have presented the anticancer activity of 8HQ derivatives modified to increase the cytotoxic activity without affecting the chemical features that allow their transport across the cell membrane. The results obtained indicate that the most interesting ligand, L14, causes per se a reduction of cell viability, which is less evident than that observed upon treatment with 8-HQ and is not further modified in the presence of nickel and cobalt. In contrast, the addition of copper or iron causes massive nonapoptotic cell death, likely due to the induction of both oxidative and ER stress, which ultimately activate the paraptotic process. These findings confirm the efficacy of metal complexes as promising anticancer agents for the treatment of tumors with an apoptosis-resistant phenotype. Moreover, they also contribute to knowledge of the molecular and cellular mechanisms involved in their cytotoxicity, showing that redoxactive compounds have a key role in the onset of paraptotic cell death.

Article

ASSOCIATED CONTENT

S Supporting Information *

Relative energies of the cis−trans isomers of L1−L6. 1H and COSY NMR spectra of L1−L16. ESI-MS spectra. Single crystal X-ray structures of L5, L9, L12, [Cu(L1)2], and [Cu(L4)2] (CCDC 950002−950006). DFT optimized geometries of [Cu(L9)(H2O)2], [Cu(L10)(H2O)2]+, [Cu(L11)(H2O)2]+, and [Cu(L12)(H2O)2]+. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: 0039 0521 905419. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS University of Parma is acknowledged for financial support. The authors gratefully acknowledge the Consorzio Interuniversitario di Ricerca in Chimica dei Metalli nei Sistemi Biologici (CIRCMSB) for helpful discussions. A.B. is supported by a research scholarship from the University of Parma Medical School.

■

REFERENCES

(1) Linder, M. C.; HazeghAzam, M. Copper biochemistry and molecular biology. Am. J. Clin. Nutr. 1996, 63, S797−S811. (2) Linder, M. C. The relationship of copper to DNA damage and damage prevention in humans. Mutat. Res., Fundam. Mol. Mech. Mutagen. 2012, 733, 83−91. (3) Auten, R. L.; Davis, J. M. Oxygen Toxicity and Reactive Oxygen Species: The Devil Is in the Details. Pediatr. Res. 2009, 66, 121−127. (4) Maltepe, E.; Saugstad, O. D. Oxygen in Health and Disease: Regulation of Oxygen Homeostasis-Clinical Implications. Pediatr. Res. 2009, 65, 261−268. (5) Adler, V.; Yin, Z. M.; Tew, K. D.; Ronai, Z. Role of redox potential and reactive oxygen species in stress signaling. Oncogene 1999, 18, 6104−6111. (6) Festa, R. A.; Thiele, D. J. Copper: An essential metal in biology. Curr. Biol. 2011, 21, R877−R883. (7) Haas, K. L.; Putterman, A. B.; White, D. R.; Thiele, D. J.; Franz, K. J. Model Peptides Provide New Insights into the Role of Histidine Residues as Potential Ligands in Human Cellular Copper Acquisition via Ctr1. J. Am. Chem. Soc. 2011, 133, 4427−4437. (8) Banci, L.; Bertini, I.; Cantini, F.; Ciofi-Baffoni, S. Cellular copper distribution: a mechanistic systems biology approach. Cell. Mol. Life Sci. 2010, 67, 2563−2589. (9) De Feo, C. J.; Aller, S. G.; Siluvai, G. S.; Blackburn, N. J.; Unger, V. M. Three-dimensional structure of the human copper transporter hCTR1. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 4237−4242. (10) Kim, B. E.; Nevitt, T.; Thiele, D. J. Mechanisms for copper acquisition, distribution and regulation. Nat. Chem. Biol. 2008, 4, 176− 185. (11) Rosenzweig, A. C.; O’Halloran, T. V. Structure and chemistry of the copper chaperone proteins. Curr. Opin. Chem. Biol. 2000, 4, 140− 147. (12) Marzano, C.; Pellei, M.; Tisato, F.; Santini, C. Copper Complexes as Anticancer Agents. Anti-Cancer Agents Med. Chem. 2009, 9, 185−211. (13) Tardito, S.; Marchiò, L. Copper Compounds in Anticancer Strategies. Curr. Med. Chem. 2009, 16, 1325−1348. (14) Dhar, S.; Nethaji, M.; Chakravarty, A. R. DNA cleavage on photoexposure at the d-d band in ternary copper(II) complexes using red-light laser. Inorg. Chem. 2006, 45, 11043−11050. (15) Dhar, S.; Senapati, D.; Das, P. K.; Chattopadhyay, P.; Nethaji, M.; Chakravarty, A. R. Ternary copper complexes for photocleavage of DNA 1161



Article

by red light: Direct evidence for sulfur-to-copper charge transfer and DD band involvement. J. Am. Chem. Soc. 2003, 125, 12118−12124. (16) Scarpellini, M.; Neves, A.; Horner, R.; Bortoluzzi, A. J.; Szpoganics, B.; Zucco, C.; Silva, R. A. N.; Drago, V.; Mangrich, A. S.; Ortiz, W. A.; Passos, W. A. C.; de Oliveira, M. C. B.; Terenzi, H. Phosphate diester hydrolysis and DNA damage promoted by new cisaqua/hydroxy copper(II) complexes containing tridentate imidazolerich ligands. Inorg. Chem. 2003, 42, 8353−8365. (17) Chen, C. H.; Sigman, D. S. Nuclease activity of 1,10phenanthroline-copper: sequence-specific targeting. Proc. Natl. Acad. Sci. U.S.A. 1986, 83, 7147−7151. (18) Berthet, N.; Martel-Frachet, V.; Michel, F.; Philouze, C.; Hamman, S.; Ronot, X.; Thomas, F. Nuclease and anti-proliferative activities of copper(II) complexes of N3O tripodal ligands involving a sterically hindered phenolate. Dalton Trans. 2013, 42, 8468−8483. (19) Buchtik, R.; Travnicek, Z.; Vanco, J.; Herchel, R.; Dvorak, Z. Synthesis, characterization, DNA interaction and cleavage, and in vitro cytotoxicity of copper(II) mixed-ligand complexes with 2-phenyl-3hydroxy-4(1H)-quinolinone. Dalton Trans. 2011, 40, 9404−9412. (20) Roy, S.; Maheswari, P. U.; Lutz, M.; Spek, A. L.; den Dulk, H.; Barends, S.; van Wezel, G. P.; Hartl, F.; Reedijk, J. DNA cleavage and antitumour activity of platinum(II) and copper(II) compounds derived from 4-methyl-2-N-(2-pyridylmethyl)aminophenol: spectroscopic, electrochemical and biological investigation. Dalton Trans. 2009, 10846−10860. (21) Tsang, S. Y.; Tam, S. C.; Bremner, I.; Burkitt, M. J. Copper-1,10phenanthroline induces internucleosomal DNA fragmentation in HepG2 cells, resulting from direct oxidation by the hydroxyl radical. Biochem. J. 1996, 317, 13−16. (22) Bravo-Gomez, M. E.; Garcia-Ramos, J. C.; Gracia-Mora, I.; RuizAzuara, L. Anti proliferative activity and QSAR study of copper(II) mixed chelate [Cu(N-N)(acetylacetonato)]NO3 and [Cu(N-N)(glycinato)]NO3 complexes, (Casiopeinas). J. Inorg. Biochem. 2009, 103, 299−309. (23) Pan, Q.; Kleer, C. G.; van Golen, K. L.; Irani, J.; Bottema, K. M.; Bias, C.; De Carvalho, M.; Mesri, E. A.; Robins, D. M.; Dick, R. D.; Brewer, G. J.; Merajver, S. D. Copper deficiency induced by tetrathiomolybdate suppresses tumor growth and angiogenesis. Cancer Res. 2002, 62, 4854−4859. (24) Yu, Y.; Wong, J.; Lovejoy, D. B.; Kalinowski, D. S.; Richardson, D. R. Chelators at the cancer coalface: Desferrioxamine to triapine and beyond. Clin. Cancer Res. 2006, 12, 6876−6883. (25) Bortolotto, T.; Silva, P. P.; Neves, A.; Pereira-Maia, E. C.; Terenzi, H. Photoinduced DNA Cleavage Promoted by Two Copper(II) Complexes of Tetracyclines and 1,10-Phenanthroline. Inorg. Chem. 2011, 50, 10519−10521. (26) Liu, P.; Brown, S.; Goktug, T.; Channathodiyil, P.; Kannappan, V.; Hugnot, J. P.; Guichet, P. O.; Bian, X.; Armesilla, A. L.; Darling, J. L.; Wang, W. Cytotoxic effect of disulfiram/copper on human glioblastoma cell lines and ALDH-positive cancer-stem-like cells. Br. J. Cancer 2012, 107, 1488−1497. (27) Zuo, J.; Bi, C. F.; Fan, Y. H.; Buac, D.; Nardon, C.; Daniel, K. G.; Dou, Q. P. Cellular and computational studies of proteasome inhibition and apoptosis induction in human cancer cells by amino acid Schiff basecopper complexes. J. Inorg. Biochem. 2013, 118, 83−93. (28) Zhang, Z.; Bi, C. F.; Schmitt, S. M.; Fan, Y. H.; Dong, L. L.; Zuo, J.; Dou, Q. P. 1,10-Phenanthroline promotes copper complexes into tumor cells and induces apoptosis by inhibiting the proteasome activity. J. Biol. Inorg. Chem. 2012, 17, 1257−1267. (29) Tardito, S.; Bussolati, O.; Gaccioli, F.; Gatti, R.; Guizzardi, S.; Uggeri, J.; Marchiò, L.; Lanfranchi, M.; Franchi-Gazzola, R. Nonapoptotic programmed cell death induced by a copper(II) complex in human fibrosarcoma cells. Histochem. Cell Biol. 2006, 126, 473−482. (30) Tardito, S.; Isella, C.; aMedico, E.; Marchiò, L.; Bevilacqua, E.; Hatzoglou, M.; Bussolati, O.; Franchi-Gazzola, R. The Thioxotriazole Copper(II) Complex A0 Induces Endoplasmic Reticulum Stress and Paraptotic Death in Human Cancer Cells. J. Biol. Chem. 2009, 284, 24306−24319.

(31) Gandin, V.; Pellei, M.; Tisato, F.; Porchia, M.; Santini, C.; Marzano, C. A novel copper complex induces paraptosis in colon cancer cells via the activation of ER stress signalling. J. Cell. Mol. Med. 2012, 16, 142−151. (32) Walter, P.; Ron, D. The Unfolded Protein Response: From Stress Pathway to Homeostatic Regulation. Science 2011, 334, 1081−1086. (33) Hetz, C. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat. Rev. Mol. Cell Biol. 2012, 13, 89−102. (34) Sperandio, S.; de Belle, I.; Bredesen, D. E. An alternative, nonapoptotic form of programmed cell death. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 14376−14381. (35) Bury, M.; Girault, A.; Megalizzi, V.; Spiegl-Kreinecker, S.; Mathieu, V.; Berger, W.; Evidente, A.; Kornienko, A.; Gailly, P.; Vandier, C.; Kiss, R. Ophiobolin A induces paraptosis-like cell death in human glioblastoma cells by decreasing BKCa channel activity. Cell Death Dis. 2013, 4, e561. (36) Zhang, J. S.; Li, D. M.; Ma, Y.; He, N.; Gu, Q.; Wang, F. S.; Jiang, S. Q.; Chen, B. Q.; Liu, J. R. gamma-Tocotrienol Induces Paraptosis-Like Cell Death in Human Colon Carcinoma SW620 Cells. PLoS One 2013, 8, e57779. (37) Wang, C. Y.; Chen, T. S. Intratumoral injection of taxol in vivo suppresses A549 tumor showing cytoplasmic vacuolization. J. Cell. Biochem. 2012, 113, 1397−1406. (38) Yoon, M. J.; Kim, E. H.; Kwon, T. K.; Park, S. A.; Choi, K. S. Simultaneous mitochondrial Ca2+ overload and proteasomal inhibition are responsible for the induction of paraptosis in malignant breast cancer cells. Cancer Lett. 2012, 324, 197−209. (39) Wasik, A. M.; Almestrand, S.; Wang, X.; Hultenby, K.; Dackland, A. L.; Andersson, P.; Kimby, E.; Christensson, B.; Sander, B. WIN55,212−2 induces cytoplasmic vacuolation in apoptosis-resistant MCL cells. Cell Death Dis. 2011, 2, e225. (40) Yoon, M. J.; Kim, E. H.; Lim, J. H.; Kwo, T. K.; Choi, K. S. Superoxide anion and proteasomal dysfunction contribute to curcumininduced paraptosis of malignant breast cancer cells. Free Radical Biol. Med. 2010, 48, 713−726. (41) Marzano, C.; Gandin, V.; Pellei, M.; Colavito, D.; Papini, G.; Lobbia, G. G.; Del Giudice, E.; Porchia, M.; Tisato, F.; Santini, C. In vitro antitumor activity of the water soluble copper(I) complexes bearing the tris(hydroxymethyl)phosphine ligand. J. Med. Chem. 2008, 51, 798−808. (42) Tardito, S.; Barilli, A.; Bassanetti, I.; Tegoni, M.; Bussolati, O.; Franchi-Gazzola, R.; Mucchino, C.; Marchiò, L. Copper-Dependent Cytotoxicity of 8-Hydroxyquinoline Derivatives Correlates with Their Hydrophobicity and Does Not Require Caspase Activation. J. Med. Chem. 2012, 55, 10448−10459. (43) Tardito, S.; Bassanetti, I.; Bignardi, C.; Elviri, L.; Tegoni, M.; Mucchino, C.; Bussolati, O.; Franchi-Gazzola, R.; Marchiò, L. Copper Binding Agents Acting as Copper lonophores Lead to Caspase Inhibition and Paraptotic Cell Death in Human Cancer Cells. J. Am. Chem. Soc. 2011, 133, 6235−6242. (44) Tardito, S.; Bussolati, O.; Maffini, M.; Tegoni, M.; Giannetto, M.; Dall’Asta, V.; Franchi-Gazzola, R.; Lanfranchi, M.; Pellinghelli, M. A.; Mucchino, C.; Mori, G.; Marchiò, L. Thioamido coordination in a thioxo-1,2,4-triazole copper(II) complex enhances nonapoptotic programmed cell death associated with copper accumulation and oxidative stress in human cancer cells. J. Med. Chem. 2007, 50, 1916− 1924. (45) Jyothish, K.; Wang, Q.; Zhang, W. Highly Active Multidentate Alkyne Metathesis Catalysts: Ligand-Activity Relationship and Their Applications in Efficient Synthesis of Porphyrin-Based Aryleneethynylene Polymers. Adv. Synth. Catal. 2012, 354, 2073−2078. (46) Phillips, J. P.; Breese, R.; Barrall, E. M. Styryl Derivatives of 8Quinolinol. J. Org. Chem. 1959, 24, 1104−1106. (47) Gazzola, G. C.; Dall’Asta, V.; Franchi-Gazzola, R.; White, M. F. Anal. Biochem. 1981, 115, 368. (48) Barilli, A.; Rotoli, B. M.; Visigalli, R.; Bussolati, O.; Gazzola, G. C.; Dall’Asta, V. Arginine transport in human monocytic leukemia THP-1 1162



Article

cells during macrophage differentiation. J. Leukocyte Biol. 2011, 90, 293− 303. (49) Lee, J. Y.; Park, J. H.; Lee, S. J.; Park, H.; Lee, Y. S. Styrylquinazoline derivatives as HIV-1 integrase inhibitors. Arch. Pharm. 2002, 335, 277−282. (50) Zeng, H. P.; Wang, T. T.; Xu, D. F.; Cai, Y. P.; Chen, D. F. Synthesis, crystal structure and biological activity of 2-[2-(quinolin-2yl)vinyl]-8-hydroxyquinoline and 2-[2-(quinolin-4-yl)vinyl]-8-hydroxyquinoline. J. Appl. Crystallogr. 2007, 40, 471−475. (51) Yoneda, A.; Hakushi, T.; Newkome, G. R.; Matsushita, T. trans1,2-Bis(8-hydroxy-2-quinolinyl)-ethene: Comparison with trans-stilbene. Acta Crystallogr., Sect. C: Cryst. Struct. Commun. 1996, 52, 172− 174. (52) Ammor, S.; Coquerel, G.; Perez, G.; Robert, F. Structure of the Gamma’ Form of Copper(II) Quinolinolate and Structural Filiations to Related M2+ Complexes. Eur. J. Solid State Inorg. Chem. 1992, 29, 445− 453. (53) Di Vaira, M.; Bazzicalupi, C.; Orioli, P.; Messori, L.; Bruni, B.; Zatta, P. Clioquinol, a drug for Alzheimer’s disease specifically interfering with brain metal metabolism: Structural characterization of its zinc(II) and copper(II) complexes. Inorg. Chem. 2004, 43, 3795− 3797. (54) Tanaka, J.; Kitamura, C.; Kawatsuki, N.; Yoneda, A. Anal. Sci.: XRay Struct. Anal. Online 2007, 23, x155−x156. (55) Korzeniewski, C.; Callewaert, D. M. An enzyme-release assay for natural cytotoxicity. J. Immunol. Methods 1983, 64, 313−320. (56) Fu, M.; Wang, C.; Li, Z.; Sakamaki, T.; Pestell, R. G. Minireview: Cyclin D1: normal and abnormal functions. Endocrinology 2004, 145, 5439−5447. (57) Jung, Y. S.; Qian, Y.; Chen, X. Examination of the expanding pathways for the regulation of p21 expression and activity. Cell. Signalling 2010, 22, 1003−1012. (58) Siddik, Z. H. Cisplatin: mode of cytotoxic action and molecular basis of resistance. Oncogene 2003, 22, 7265−7279. (59) Ron, D.; Hubbard, S. R. How IRE1 reacts to ER stress. Cell 2008, 132, 24−26. (60) Lee, A. S. The glucose-regulated proteins: stress induction and clinical applications. Trends Biochem. Sci. 2001, 26, 504−510. (61) Tabas, I.; Ron, D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat. Cell Biol. 2011, 13, 184− 190. (62) Krejsa, C. M.; Franklin, C. C.; White, C. C.; Ledbetter, J. A.; Schieven, G. L.; Kavanagh, T. J. Rapid activation of glutamate cysteine ligase following oxidative stress. J. Biol. Chem. 2010, 285, 16116−16124. (63) Ryter, S. W.; Alam, J.; Choi, A. M. Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications. Physiol. Rev. 2006, 86, 583−650. (64) Amstad, P. A.; Krupitza, G.; Cerutti, P. A. Mechanism of c-fos induction by active oxygen. Cancer Res. 1992, 52, 3952−3960. (65) Kornienko, A.; Mathieu, V.; Rastogi, S. K.; Lefranc, F.; Kiss, R. Therapeutic Agents Triggering Nonapoptotic Cancer Cell Death. J. Med. Chem. 2013, 56, 4823−4839. (66) Galluzzi, L.; Vitale, I.; Abrams, J. M.; Alnemri, E. S.; Baehrecke, E. H.; Blagosklonny, M. V.; Dawson, T. M.; Dawson, V. L.; El-Deiry, W. S.; Fulda, S.; Gottlieb, E.; Green, D. R.; Hengartner, M. O.; Kepp, O.; Knight, R. A.; Kumar, S.; Lipton, S. A.; Lu, X.; Madeo, F.; Malorni, W.; Mehlen, P.; Nunez, G.; Peter, M. E.; Piacentini, M.; Rubinsztein, D. C.; Shi, Y.; Simon, H. U.; Vandenabeele, P.; White, E.; Yuan, J.; Zhivotovsky, B.; Melino, G.; Kroemer, G. Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012. Cell Death Differ. 2012, 19, 107−120. (67) Rebucci, M.; Michiels, C. Molecular aspects of cancer cell resistance to chemotherapy. Biochem. Pharmacol. 2013, 85, 1219−1226. (68) Laine, A. L.; Passirani, C. Novel metal-based anticancer drugs: a new challenge in drug delivery. Curr. Opin. Pharmacol. 2012, 12, 420− 426. (69) Hindo, S. S.; Frezza, M.; Tomco, D.; Heeg, M. J.; Hryhorczuk, L.; McGarvey, B. R.; Dou, Q. P.; Verani, C. N. Metals in anticancer therapy:

Copper(II) complexes as inhibitors of the 20S proteasome. Eur. J. Med. Chem. 2009, 44, 4353−4361. (70) Padhye, S.; Yang, H. J.; Jamadar, A.; Cui, Q. C.; Chavan, D.; Dominiak, K.; McKinney, J.; Banerjee, S.; Dou, Q. P.; Sarkar, F. H. New Difluoro Knoevenagel Condensates of Curcumin, Their Schiff Bases and Copper Complexes as Proteasome Inhibitors and Apoptosis Inducers in Cancer Cells. Pharm. Res. 2009, 26, 1874−1880. (71) Sano, R.; Reed, J. C. ER stress-induced cell death mechanisms. Biochim. Biophys. Acta 2013, 1833, 3460−3470. (72) Valko, M.; Morris, H.; Cronin, M. T. D. Metals, toxicity and oxidative stress. Curr. Med. Chem. 2005, 12, 1161−1208. (73) Iuchi, K.; Akagi, K.; Yagura, T. Heterocyclic Organobismuth(III) Compound Targets Tubulin to Induce G(2)/M Arrest in HeLa Cells. J. Pharmacol. Sci. 2009, 109, 573−582. (74) Schmid, W. F.; John, R. O.; Muhlgassner, G.; Heffeter, P.; Jakupec, M. A.; Galanski, M.; Berger, W.; Arion, V. B.; Keppler, B. K. Metal-based paullones as putative CDK inhibitors for antitumor chemotherapy. J. Med. Chem. 2007, 50, 6343−6355. (75) Oyadomari, S.; Mori, M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 2004, 11, 381−389. (76) Schneider-Poetsch, T.; Ju, J.; Eyler, D. E.; Dang, Y.; Bhat, S.; Merrick, W. C.; Green, R.; Shen, B.; Liu, J. O. Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nat. Chem. Biol. 2010, 6, 209−217. (77) Sliskovic, I.; Mutus, B. Reversible inhibition of caspase-3 activity by iron(III) - Potential role in physiological control of apoptosis. FEBS Lett. 2006, 580, 2233−2237. (78) Perry, D. K.; Smyth, M. J.; Stennicke, H. R.; Salvesen, G. S.; Duriez, P.; Poirier, G. G.; Hannun, Y. A. Zinc is a potent inhibitor of the apoptotic protease, caspase-3 - A novel target for zinc in the inhibition of apoptosis. J. Biol. Chem. 1997, 272, 18530−18533. (79) Held, J. M.; Gibson, B. W. Regulatory Control or Oxidative Damage? Proteomic Approaches to Interrogate the Role of Cysteine Oxidation Status in Biological Processes. Mol. Cell. Proteomics 2012, R111, 013037v1. (80) Cremers, C. M.; Jakob, U. Oxidant Sensing by Reversible Disulfide Bond Formation. J. Biol. Chem. 2013, 288, 26489−26496. (81) Hampton, M. B.; Stamenkovic, I.; Winterbourn, C. C. Interaction with substrate sensitises caspase-3 to inactivation by hydrogen peroxide. FEBS Lett. 2002, 517, 229−232. (82) Lee, J. G.; Baek, K.; Soetandyo, N.; Ye, Y. H. Reversible inactivation of deubiquitinases by reactive oxygen species in vitro and in cells. Nat. Commun. 2013, DOI: 10.1038/ncomms2532. (83) Flora, S. J.; Pachauri, V. Chelation in metal intoxication. Int. J. Environ. Res. Public Health 2010, 7, 2745−2788.

1163


Oxidative Stress Induced by Copper and Iron Complexes with 8

Recommend Documents