Oxygen Plasma Treated Interactive Polycarbonate DNA Microarraying

Article pubs.acs.org/bc

Oxygen Plasma Treated Interactive Polycarbonate DNA Microarraying Platform Jesús Tamarit-López, Sergi Morais, Rosa Puchades, and Á ngel Maquieira* Departamento de Química, Instituto de Reconocimiento Molecular y Desarrollo Tecnológico, Universidad Politécnica de Valencia, Camino de Vera s/n, 46071 Valencia, Spain S Supporting Information *

ABSTRACT: A novel DNA microarrying platform based on oxygen plasma activation of polycarbonate surface of compact disks (DVD) is presented. Carboxylic acid groups are generated in few seconds on polycarbonate in an efficient, fast, and clean way. Following this surface activation strategy, amino-modified oligonucleotide probes were covalently attached, reaching an immobilization density of 2 pmol cm−2. Atomic force microscopy imaging revealed the nondestructive character of this treatment when applied for short times, allowing for disk scanning in standard DVD drives. DNA assays performed on oxygen plasma treated disks resulted very efficient with maximum hybridization yield of 93% and reaching a low limit of detection (200 pM) for perfect match synthetic oligonucleotide targets when reading the disk with a standard drive as detector. The approach was also evaluated by scoring single nucleotide polymorphisms with a discrimination ratio of 12.8. As proof of concept, the oxygen plasma treated interactive polycarbonate DNA microarraying platform was applied to the detection of PCR products of Salmonella spp., reaching a detection limit of 2 nM that corresponds to a DNA concentration of only 1 c.f.u./mL. The results confirm the suitability of the microarray platform for analysis of biological samples with high sensitivity.

■

biomolecule layer.3,4 Indeed, this strategy has been employed for the vast majority of commercial products because of its versatility, durability, and good functionality.5,6 Covalent linking of probes on optical disks requires functionalization of the surface since polycarbonate (PC), the main component of disks, lacks appropriated reactive chemical groups. A number of chemical and physical processes for covalent attachment of proteins and nucleic acid probes on PC surfaces are reported in the literature.7−12 Most of these methods have limitations since they modify the optomechanical properties of the surface or use experimental setups that disable disk reading with disk drives. Also, classical chemical reactions must be carefully handled on disks as PC can be severely damaged. Our research group has developed chemical approaches, involving covalent attachment of probes on PC.13−15 Several advantages were highlighted in DNA hybridization assays with limits of detection of 2.5 nM and scoring single nucleotide polymorphism (SNP), using covalently anchored aminated oligomers through a glutaraldehyde cross-linker.14

INTRODUCTION DNA assays have been growing due to their broad applications in many fields (e.g., gene analysis, clinical diagnosis, or pathogen detection). Among the numerous assay types, oligonucleotide microarray technology allows for highthroughput, sensitive and selective DNA detection in a miniaturized format. For that, glass is the support commonly employed, but organic polymers also have high potential in microarray analysis due to their good mechanical and optical properties, mass production, and price. Optical disks are attractive analytical supports, given the low cost of mass production and the countless surface chemistry strategies to attach probes for biosensing in different formats. Several approaches have been reported for bioanalytical applications in microarray format on optical disks.1,2 Performances of drive as detector demonstrated that compact disk (CD) technology is very competitive. Ubiquity and the price of a disk reader provide huge advantages compared to the usual equipment, including fluorescence scanners and flow cytometers. Electrostatic immobilization of DNA probes on positively charged surfaces, e.g., amino-silanized glass or charged-nylon membranes, is a common strategy to attach them in a random manner. However, covalent immobilization achieves probe directionality, reduces background noise, and develops a stable © 2011 American Chemical Society

Received: August 3, 2011 Revised: October 31, 2011 Published: November 2, 2011 2573

dx.doi.org/10.1021/bc2004268 | Bioconjugate Chem. 2011, 22, 2573−2580

Bioconjugate Chemistry

Article

Table 1. Oligonucleotide Sequences of Probes and Targetsa

a

name

sequence (5′−3′)

5′ end

3′ end

tracer probe 1 probe 2 target 1 target 2 target 3 target 4 target 5

TTACGATCGATTAGTTAGCCC-(T)15 (T)15-CCCGATTGATTAGCTAGCATT (T)10- TTTGATTACAGCCGGTGTACGACCCT AATGCTAGCTAATCAATCGGG AGGGTCGTACACCGGCTGTAATCAAA AGGGTCGTACATCGGCTGTAATCAAA AGGGTCGCGCACTATCTGTAATCAAA ACCGTCGCGCACTATCTGATTTCAAA

Cy5 C7-NH2 C7-NH2 Cy5 digoxigenin digoxigenin digoxigenin digoxigenin

C7-NH2 none none none none none none none

The nucleotide bases for polymorphism detection are marked in bold.

Oligonucleotides were from Sigma-Aldrich (Madrid, Spain), and the sequences are shown in Table 1. Digoxigenin labeled PCR products were 151 bp long and used to detect specifically Salmonella spp. Ten nanometer colloidal gold labeled antidigoxigenin immunoglobulin was from Aurion (Wageningen, The Netherlands). N-Hydroxysuccinimide (NHS), 1ethyl-3-(3′-dimethylaminopropyl)carbodiimide (EDC), Crystal Violet, Tween 20, formamide, and silver enhancer solutions were supplied by Sigma-Aldrich (Madrid, Spain). Note: All the chemicals should be handled following the corresponding material safety data sheets. Surface Activation and Characterization. DVD-R disks were purchased from MPO Ibérica (Madrid, Spain). The disks were first conditioned by gentle ethanol washing, water rinsing, and dried by centrifugation. For oxygen plasma activation, disks were introduced inside a microwave plasma reactor PVA Tepla 200 Plasma System (Feldkirchen, Germany) operating at 2.45 GHz and continuous 100 W power for 30 s. Oxygen pressure inside the reactor was 120 Pa. Disks were stored under vacuum and dry conditions until probe attachment. Surface contact angle measurements were taken on OCA20 equipment and data analyzed using SCA20 software from Dataphysics Instruments GmbH (Filderstadt, Germany). The measurements were done in quintuplicate at room conditions with a volume drop of 10 μL. X-ray photoelectron spectra were recorded with a Sage 150 spectrophotometer from SPECS Surface Nano Analysis GmbH (Berlin, Germany). Nonmonochromatic AlKa radiation (1486.6 eV) was used as the X-ray source operating at 30 eV constant pass energy for elemental specific energy binding analysis. Vacuum in the spectrometer chamber was 9 × 10−9 hPa and the sample area analyzed 1.0 mm2. The surface topographies were examined with a Nanoscope IIIa atomic force microscope from Digital Instruments (Santa Barbara, CA, USA), operating in tapping mode in air at room temperature. Crystal violet dye was employed to estimate the density of carboxylic acid groups generated on oxygen plasma treated PC surfaces, as previously described.20 Raw polycarbonate surface from standard DVDs was used as the control. Oligonucleotide Immobilization. Amino modified oligonucleotide probes were attached to oxygen plasma DVD by carbodiimide chemistry. To this end, the oligo probe was serially dissolved (concentration ranging from 0.05 to 5 μM) in printing buffer with EDC and NHS at 20 mM. Solutions were immediately microarrayed on the oxygen plasma activated surface as 50 nL drops with a noncontact dispenser (AD1500, Biodot Inc., Irvine, CA) in a 90% humidity environment. The disk layout consisted of eight segmented areas (45° separation) each one constituted of 30 spots of ∼500 μm diameter, spaced 1 mm and distributed in 6 columns and 5 rows. In this manner,

However, cleaner, easy-going, and more efficient methods are demanded. Thus, Li et al.16 reported UV/O3 treated compact disks, allowing the immobilization of biotin, oligonucletotides, and immunoglobulins by covalent linkage. Maintaining the disk structure, DNA hybridization events were detected with a sensitivity of 25 nM by analyzing errors of the disk reading in a standard CD drive. These figures should be improved to reach the sensitivity required in real applications. Plasma methods have attracted much attention for surface modification of polymeric materials. It is generated by applying an electric discharge to a neutral gas, developing radicals highly reactive with any species or surface they reach. Plasma treatment is a fast, effective, and clean method to create chemical moieties with minimal waste products. Plasma methods to develop chemically reactive polymeric surfaces have been reviewed by Siow et al.17 Surface modification of polymers by plasma has been widely physico-chemically characterized, including treated PC surfaces.18 Oxygen plasma is reported to be more effective than others gases such as air, N2, or Ar, for the treatment of PC, introducing oxygenated groups on the surface and providing a very low treatment depth and homogeneity on a molecular scale.19 To the best of our knowledge, studies about the ability of these treated PC surfaces to covalently link DNA probes for bioassaying have not been published yet. In this article, we describe an oxygen plasma activated PC surface of compact disks to covalently attach aminated oligonucleotide probes, developing a novel and general microarraying platform applicable to nucleic acid based methods. The optimal working conditions to maintain disk operations and surface activity were also approached despite the delicate structure of DVD (PC substrate covered with several layers of different materials) and the hard conditions inside the plasma reactor. This novel microarray platform, compatible with disk reading, is created and applied, as a proof of concept, to score SNPs and detect polymerase chain reaction (PCR) products, achieving good performance.

■

EXPERIMENTAL PROCEDURES Chemicals. The immobilization-printing buffer (HEPES: 50 mM 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid buffer, containing 40% (v/v) glycerol, pH 7.0); hybridization buffer (3 × SSC: 45 mM sodium citrate buffer and 450 mM NaCl, pH 7.0); PBS-T (10 mM sodium phosphate buffer, 150 mM NaCl, and 0.05% (v/v) Tween 20, pH 7.2); and washing solutions were filtered through a 0.22 μm pore size nitrocellulose membrane from Whatman GmbH (Dassel, Germany), before use. 2574



Article

Figure 1. Scheme of oxygen plasma activation procedure of DVD PC surfaces, covalent attachment of oligonucleotides, DNA hybridization, and assay development.

eight samples can be simultaneously analyzed. The coupling reaction was carried out at 4 °C for 16 h under controlled humidity conditions. After that, the activated surface was washed with PBS-T for 1 min, rinsed with water, and dried by slight centrifugation. DNA Hybridization Assays on DVD. For hybridization studies, both digoxigenin labeled oligomer target and PCR products were used. The latter, first, was denaturated into single DNA strands by high temperature treatment prior to their application to the disk. This method involves a 5 min incubation step at 95 °C followed by 1 min on ice. Target and PCR product solutions (100 μL) in hybridization buffer were evenly distributed on disk areas using 22 × 22 mm glass coverslips. After 1 h at 37 °C, the disk was washed with PBS-T, rinsed with deionized water, and dried by slight centrifugation. Next, 1 mL of gold labeled antidigoxigenin solution (1:100 in PBS-T) was dispensed onto the disk and covered with a 12 cm diameter dummy plastic surface. After 1 h at room temperature, the disk was washed, rinsed, and dried as before. To display the hybridization reaction, the disk was incubated with 1 mL of 1:1 (v/v) silver enhancer solution distributed as before and the reaction stopped by washing with water after 18 min at room temperature. The disk was dried as described above and read with a CD/DVD drive. The CD/DVD drive was from LG Electronics (Englewood Cliffs, NJ, USA) and holds two lasers, 650 and 780 nm, which focus on the spiral data track of CD and DVD disks, respectively. During the disk reading, the laser hits the reaction product which modifies the optical properties of the disk surface, attenuating the signal captured by the photodiode. This signal is related with target concentration. A detailed description of the optical disk drive working as chemical detector is described elsewhere.2 A scheme of surface activation, probe immobilization, and DNA hybridization assays is depicted in Figure 1. Oligonucleotide Surface Density. The immobilization probe density was estimated by measuring the fluorescence of a Cy5-labeled oligonucleotide tracer (Table 1), and the

hybridized target density was calculated through the fluorescence of the target-1 after hybridization with probe-1, immobilized on PC activated chips at different densities. The fluorescent intensity of the spots was determined by a homemade apparatus incorporating a charge couple device camera Retiga EXi from Qimaging Inc. (Burnaby, Canada) and light emitting diodes Toshiba TLOH157P as the fluorescence excitation source.21 After the corresponding immobilization and hybridization steps, the chips were washed, rinsed, and dried, the fluorescence signal of the spots was quantified, and the density of immobilized and hybridized DNA was extracted from the respective calibration curves (Figures S3 and S4, Supporting Information). For each experimental condition tested on the microarrays, 12 replicates spots of each solution were spotted on the treated polycarbonate DVD surface. The experiment was repeated three times. The immobilization and hybridization data presented are the average of these repetitions, and the error bars represent the standard deviation observed on this average. The yield of DNA hybridization was calculated as the ratio of the target to probe densities.

■

RESULTS AND DISCUSSION Surface Characterization. Oxygen activated DVD surface was characterized by water contact angle measurements which give information about surface hydrophilicity that, in fact, is related to the presence of oxygenated functional groups. The contact angle in water decreased from 79° of raw hydrophobic PC surface to a constant value of 16° after 30 s plasma treatment (Figure 2A). The efficiency of oxygen plasma treatment was demonstrated considering that only 5 s of activation decreases the contact angle up to 30°, being in good agreement with that observed in raw polycarbonate after treatment with different plasma gases.19,22 As is shown in Figure 2, uniformity of the oxidized surfaces was corroborated from the low dispersion of the contact angle measurements randomly taken on the disk surface. 2575



Article

buffered solutions. Thus, the contact angle was gradually decreased as the pH was raised, observing two smooth transitions from pH 1.0 to 5.0 and from 8.0 to 12.0 (Figure 2B). Contrarily, the contact angle remained constant on untreated disks within the pH range tested. This might suggest the presence of phenols and aromatic acids on the activated surface since the pKa of benzoic acid and phenol is 4.2 and 9.9, respectively. Nevertheless, the smoothness of the titration leaps points to a mixture of several moieties and other functionalities, in different ratios, making it difficult to identify the nature of each chemical surface group. Although carboxylic acids are the only preferred groups for the subsequent covalent attachment of aminated probes, phenols would not interfere in the coupling efficiency of oligonucleotides through carbodiimide chemistry. Furthermore, phenols contribute to surface hydrophilicity, reducing the nonspecific adsorption of oligonucleotide targets and other assay reagents such as gold-labeled antidigoxigenin immunoglobulin. The whole leap in the contact angle titration curve is about 20°, which is lower than that the obtained with other treatments.23 However, the high density of the functional groups was determined by the crystal violet procedure. The differences in the signal obtained between activated and raw PC surfaces determine a density of ionizable groups (acids and phenols) of 1.2 × 10−9 mol cm−2. This figure is higher than that reported for PC surfaces after 1 h of UV irradiation or 10 min of UV/ozone treatment (0.25 and 0.48 × 10−9 mol cm−2, respectively).24,25 Although the estimated density refers to functional ionizable groups, it can be considered that carboxylic acid moieties constitute approximately half of the total since the magnitudes of the two titration curve leaps were similar (Figure 2B). Even so, the density of carboxylic acid groups is much higher than 0.15 × 10−9 mol cm−2, that is, the one calculated for close-packed ssDNA strands.26 The change of hydrophobicity of the treated surface was also studied by XPS. The C1s and O1s spectra of untreated and treated DVDs revealed a change in the atomic ratio O/C from 0.17 to 0.29 after oxygen plasma treatment for 30 s. Deconvolution of C1s spectra showed that new bonds of C− O are formed during the activation (Figure S1, Supporting Information). Thus, to the bands at 286.6 and 290.5 eV, due to single and quadruple bonds between C and O present in the chemical structure of PC, plasma activation adds new bands at 287.5 and 288.8 eV, corresponding to double and triple bonds, respectively.18 This confirms the presence of new carbonyl and carboxylic groups on the treated surface. Also, a slight increase in the band height at 286.5 eV points the generation of new phenol or phenoxy functionalities. However, given the performances of the XPS technique, new spectra with higher resolution could be required to accurately corroborate these results. Achieving an efficient functionalization of the surface is as important as keeping its physical properties in order to read the disks in a standard CD/DVD drive. AFM imaging of treated and untreated surfaces revealed that the topography of DVDs, in terms of root-mean-square roughness value (Rrms), does not change during the first minute of plasma treatment (Figure S2, Supporting Information). Contrarily, 5 min of activation resulted on disk imperfections (visible by naked eye) because the DVD is composed of several layers of materials whose adherence fails during prolonged plasma treatment. Nevertheless, shorter activation times produce only minimum etching

Figure 2. (A) Change of contact angle in water of DVD PC surfaces treated by oxygen plasma (100 W, 120 Pa) with the activation time. (B) Contact angle titration curves of untreated and oxygen plasma activated (100 W, 120 Pa, 30 s) DVD PC surfaces. The dotted lines are to facilitate reading only. (C) Variation of water contact angle of plasma treated DVD PC surfaces as a function of storage time in a vacuum desiccator.

Considering that the oxygen plasma treatment incorporates to the polycarbonate surface different oxygenated groups such as alcohols, carboxylic acids, and other carbonyl functions and that these groups are protonated or deprotonated depending on their pKa and the pH of the medium, we found out their presence by means of a contact angle titration curve using 2576



Article

of the surface, and PC chemical modification is the dominant process. However, plasma treated polymer surfaces progressively lose their anchoring capacity during storage time: the aging effect. This phenomenon is detected through the increase of hydrophobicity (surface contact angle increasing). As is shown in Figure 2C, when plasma activated DVD PC surfaces were stored under vacuum and dry conditions, the water contact angle only increased from 16° to 21° after a month of storage. This means that the aging effect over the activated disks is minimum, and the surface continues being reactive for biomolecule immobilization after storage. DNA Microarray Platform. A DVD derivatized surface with carboxylic acid moieties constitutes a potential platform to attach probes for biosensing purposes. The application of these modified surfaces by covalent immobilization of aminated oligonucleotide probes on 30 s plasma activated DVDs and further development of DNA hybridization-based assays was demonstrated for the first time. A study to ascertain the best conditions for oligonucleotide immobilization on oxygen plasma treated PC surfaces was carried out. The pH is a paramount parameter that needs to be controlled when using carbodiimide chemistry; indeed, slightly acidic solutions (pH 5) are known to better stabilize active NHS esters, but alkaline conditions are needed to reach a good density of the nonprotonated amino group of modified oligonucleotides and for nucleophilic attack to occur at the activated surface (pKa of conjugated acid of aliphatic amino is approximately 9.0). Thus, comparing different printing buffers, a maximum oligonucleotide immobilization density was reached at neutral medium (HEPES buffer pH 7.0). The high hydrophilicity of the treated surfaces causes the spreading of the printed spots in a manner in which they overlapped each other. Also, this diffusion of the spotted solutions increased the evaporation speed, hindering reaction of probes with the disk surface. To control these issues, glycerol was added to the printing solution showing that 40% (v/v) was the optimal content to avoid the aforementioned problems. Operating at the described conditions, the probe immobilization was studied over PC oxygen plasma treated surfaces at different times, using fluorescent dye marked oligonucleotide as the tracer (See Experimental Procedures). Probe immobilization density increased with the surface treatment time, probably due to the higher carboxylic acid group density, but 1 min treatment or longer decreased the efficiency to attach oligonucleotides (Figure 3). Extended plasma treatments might also generate low molecular weight material on it, including a weak boundary layer, due to the etching of the surface.18 This material, together with the immobilized probe, is removed from the surface after the washing step, and therefore, less amount of oligonucleotide is finally attached on the surface. However, the immobilization density increases with the concentration of oligonucleotide dispensed on the surface, reaching a plateau at concentrations between 5 and 10 μM. An immobilization density of 2 pmol cm−2 was reached in the studied conditions. This density was similar to that reported by others authors working on activated plastics (5 and 10 pmol cm−2 for UV-Ozone activated PC and aminated PMMA, respectively)25,27 or commercial reactive microarray glass slides (11 pmol cm−2).28 High immobilization densities do not necessarily imply an improvement in the hybridization yield, so

Figure 3. Oligonucleotide immobilization density on activated DVD PC surfaces by oxygen plasma (100 W, 120 Pa) at different times. Inlet, immobilized density dependence on the time of plasma activation for two concentrations of tracer. Density values were calculated from fluorescence intensity values of Cy5 labeled probes measured with a CCD camera.21 EDC/NHS in printing buffer without probe oligonucleotide were employed as negative controls.

the obtained one is suitable to detect DNA with high sensitivity. However, a negligible response (S/N < 3) was obtained from a nonspecific probe anchoring on a plasma treated polycarbonate surface when fluorescent labeled oligonucleotides without an amino group are used (Target 1) or when the amino modified oligonucleotides were used in the absence of EDC/NHS (negative controls). This confirmed that other reactive groups formed on the PC surface during the plasma treatment, such as epoxides or oxygen radicals, were not present in such an amount to react and produce significant nonspecific probe immobilization. Likewise, although some degree of π−π or other hydrophobic interactions could be established between purine and pyrimidine bases and the aromatic moiety of the polycarbonate, no signal was observed, over nonactivated disks at the probe concentrations employed, supporting the suitability of the plasma treated surfaces for covalent attachment of aminated probes at low concentrations. DNA Hybridization Assays. The performance of oxygen plasma activated DVDs to attach DNA probes was assessed through hybridization assays with oligonucleotides and PCR products, establishing its sensitivity and selectivity. Several considerations related with the design of the oligonucleotides sequence were taken into account before carrying out optimization studies. First, a poly T tail 10 to15 long was added at the 5′ end with the role of spacer to physically separate them from the surface, alleviating possible steric interferences. 29 Second, the length of probes and targets ranged 21 to 26 bp as a trade off between hybridization efficiency and specificity.30 The yield of hybridization was determined by comparison of the response obtained after the recognition event between Probe 1 and Target 1 to that achieved by the immobilization of tracer. As shown in Figure 4A, hybridized target density increased with target concentration, reaching a plateau at 200 nM for the tested probe concentrations (0.5−5 μM) and a maximum DNA target density of 0.93 pmol cm−2 (probe, 5 μM; target, 500 nM). This figure was similar to that achieved on other activated plastics25,27 and corresponds to a hybrid2577



Article

reaction product for quantification whereas reactions that are too long increase the level and noise of the background, dropping the signal-to-noise ratio. In our case, 18 min was selected as the suitable amplification time to get the best contrast and S/R values. This time is longer than the optimal one found for assays over other PC disks, probably due to the different surface chemistry achieved with plasma treatment. 1,14 The linear dynamic range and limit of detection (LOD) related to the probe density and target concentration is shown in Figure 4B. Thus, a limit of detection of 200 pM, calculated as the concentration of target giving a signal equal to three times the standard deviation of the background signal, was reached when immobilizing the 5 μM probe. Likewise, the dynamic range for the hybridization assay can be improved by controlling the amount of immobilized probe and the reaction time of the silver enhancement step (e.g., shortening the reaction time to avoid saturation for higher target concentrations, Figure S6, Supporting Information). At the conditions described here, the background signal was negligible (S/N < 3), saving the blocking step with BSA or ethanolamine and reducing assay time. In addition, such a background level is indicative of low nonspecific adsorption of gold-labeled antidigoxigenin immunoglobulin on this hydrophilic surface. The relatively high yield of hybridized target achieved with our approach implies that very little amount of DNA probe is needed to obtain a detectable signal. Thus, dispensing 50 nL of 5 μM probe solution means that only 50 fmol of oligonucleotide per assay is used (considering a single spot as an individual assay), which is quite low compared to that in other protocols such as microfluidic arrays. However, it is also important to keep the stability of the probe-coated surface with time. Thus, weekly hybridization assays demonstrated that the immobilized probes on plasma treated PC surfaces were active during, at least, two months after being printed on the disks without significant loss (12%) of the hybridization signal. The selectivity of our approach was evaluated through hybridization assays using target oligonucleotides with mismatched bases with respect to the sequence of the immobilized probe. Negligible responses (S/N < 3) were obtained assaying 5 and 10 base-pair mismatch targets (Figure 5A) for a broad range of concentrations (from 0.1 to 500 nM). More interesting, due to its potential application in genotyping, is the ability of the sensing platform to discriminate single nucleotide polymorphisms (SNPs), predicting disease predispositions or drug responses in individuals.36 Working with stringent conditions, such as a lower ionic strength hybridization buffer (1 × SSC) and the addition of formamide at 50% (v/v), maximum discrimination ratio of 12.8 was reached (Figure 5B), being in the range of those achieved with other approaches for oligonucleotides of similar length.37 Also, the potential of the new microarray disk surface for sensitive and selective detection of PCR amplified DNA products of pathogens was tested. The nucleotide sequence of the immobilized probe 2 was complementary to the central region of 151 bp amplicon specific to detect Salmonella spp. Although the high temperature pretreatment denatures PCR products (dsDNA) into ssDNA complementary strands, during its application on the disk, incubation time is an essential parameter to avoid amplicon reassociation and control the hybridization assay, as shown in Figure 5C. Thus, higher responses were obtained after 60 min. At the described

Figure 4. (A) Hybridized target density on oxygen plasma activated DVD PC surfaces (100 W, 120 Pa, 30 s), calculated from fluorescence intensity values of Cy5 labeled targets obtained with a CCD camera. 21 Hybridization buffer without target was employed as the negative control. (B) Absolute signal and S/N values (mean value ± standard deviation of 15 replicates) for DNA hybridization assays on plasma activated standard DVDs with different probe and target concentrations read with a standard DVD drive. Hybridization buffer without target was employed as the negative control.

ization yield of 46%. The efficiency is higher than that reached on other polymeric surfaces (between 6 and 18%), probably due to the superiority of this novel platform to immobilize probes at the optimal density. Indeed, it is well known that hybridization efficiency depends strongly on the amount of probe attached on the sensing surface in a manner that full hybridization is only achieved at lower probe densities because repulsive electrostatic and steric interactions are minimized. 31 Although recent approaches have reported to avoid it, 32 this “sweet spot” phenomenon has been confirmed multiple times by others authors over several DNA microarray supports.33,34 Likewise, and in good agreement with these observations, the yield of hybridization on oxygen plasma activated PC was 93% at the lowest probe density tested (0.56 pmol cm−2). Detection of DNA target was performed on a DVD disk by using 5′-digoxigenin labeled oligonucleotides and gold labeled antidigoxigenin immunoglobulin and silver amplification to produce a solid reaction product. The hybridization assay performed with these reagents showed the highest S/N values compared to those of others using biotin labeled oligonucleotides and gold labeled streptavidin (Figure S5, Supporting Information). However, the modulation of the silver enhancement conditions is paramount to achieve an optimal contrast for detection.35 Thus, shorter reactions do not develop enough 2578



Article

sensitivity, together with the ultrafast and nonaggressive performance of surface modification protocol, reveal plasma treated DVDs as practical platforms for DNA microarray sensing. Moreover, the DVD disk and drive approach constitutes an analytical tool with high potential compared to other microarray detection platforms such as confocal fluorescent scanners or flow cytometers, with advantages such as low cost, portability, and high-throughput capability to analyze thousands of samples in field conditions.

■

CONCLUSIONS Oxygen plasma treated DVD polycarbonate surface is a novel and superior DNA microarray support. The surface activation is fast and clean adding to the optical and mechanical properties of the disk's new capabilities, allowing scanning with standard disk drives. The treatment generates active and stable moieties on the polycarbonate surface, allowing for the covalent immobilization of amino modified probes with appropriate densities for developing sensitive DNA hybridization assays. Mass production of functionalized disks could be carried out smartly and easily since only 30 s of treatment gives an appropriate surface density of functional moieties. At the same time, in this process, the chemical modification is independent of substrate geometry, making it possible to uniformly activate several disks during a single plasma treatment. This is a clean activation strategy because it requires tiny amounts of chemicals or solvents, avoiding the generation of classical synthesis waste byproducts, adding extra value as an environmentally friendly procedure. However, polycarbonate could be derivatized with different functional groups by proper selection of the employed plasma gases (e.g., introduction of amines from ammonia plasma for attaching biomolecules containing carboxylic acids). Also, other immobilization strategies such as streptavidin−biotin or the use of monofunctional or bifunctional linkers are of direct and simple implementation.39 Detection of PCR amplified DNA products were also demonstrated, reaching high sensitivity and selectivity, with an inverse relationship between probe density and hybridization yield. The limits of detection are very low and comparable to those reported in the literature using fluorescent, enzymatic, or metal nanoparticle labels on plastic supports. The advantages shown by compact disk reading technology, such as ubiquity, low cost, portability, and high-throughput, give this approach scalability and great potential.

Figure 5. Optical density images of DNA hybridization assays performed on DVD-Rs and read with a standard DVD drive. Columns, from left to right, correspond to probe 2 at concentrations of 5, 1, 0.5, 0.25, 0.1, and 0.05 μM, respectively. (A) Hybridization with target at 5 nM in nonstringent conditions (3× SSC buffer without formamide). Panels 1−4 correspond to perfect match, single, 5, and 10 base mismatch oligonucleotides targets, respectively (targets 2, 3, 4, and 5, respectively). (B) Hybridization with target at 5 nM in stringent conditions (1× SSC buffer with formamide at 50% (v/v)). Panels 1−4 correspond to perfect match, single, 5, and 10 base mismatch targets, respectively (targets 2, 3, 4, and 5, respectively). (C) Panels 1−3 correspond to hybridization with Salmonella spp. PCR product at 2 nM for 15, 60, and 120 min, respectively. Panel 4 corresponds to hybridization with Cronobacter amplicon at 2 nM for 60 min used as the negative control. S/N values were 21.8, 17.0, 8.7, 5.5, 2.2, and 0.5 (panel 2) and 15.0, 11.4, 6.8, 3.8, 3.1, and 3.5 (panel 3) for 5, 1, 0.5, 0.25, 0.1, and 0.05 μM probe 2 concentration, respectively.

conditions, the new microarray was able to detect 2 nM of amplicon. This limit of detection is about 1 order of magnitude better than that reached with synthetic oligonucleotides, probably due to the lower diffusion coefficient of larger targets and the reassociation of the two amplicon strands during hybridization on the disk. However, negligible responses (S/N < 3) in the detection of negative PCR control products (Cronobacter sakazakii) confirmed the selectivity of our approach. Considering the target solution volume used for hybridization assays (100 μL), and the number of spots printed per array (30), a limit of detection of 200 pM is equivalent to 700 amol of DNA molecules, which is 2 orders of magnitude lower than the reported one for DNA detection on UV/ozone treated compact disks.16 However, differences in assay format (line array instead of spot microarray), type of disk (CD instead of DVD), and reading strategy (error reading detection instead of acquiring the attenuated analog signal) could be decisive for the differences found between the two approximations.2,38 Indeed, at this stage, the approach presented here shows an important sensitivity enhancement on the state of the art (DNA microarrays on standard disk surfaces).14,37 The detection limit of 2 nM of PCR product reached with our approach is equivalent to detect 150 μgL−1 of PCR amplified DNA. This result is very interesting because this amount of DNA comes from 1 colony-forming unit/mL. This achievement in

■

ASSOCIATED CONTENT

S Supporting Information *

XPS spectra and AFM images of treated and untreated disks; calibration curves for oligonucleotide surface density calculation; study of other oligonucleotide labels; signal amplification times; and hybridization conditions. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author *Tel: +34-963877342; Fax: +34-963879349. E-mail: [email protected].

■

ACKNOWLEDGMENTS This research was funded through projects FEDER MICINN CTQ2010-15943 (CICYT, Spain) and by Generalitat Valenci2579



Article

on silicon nitride barrier films on polycarbonate substrates. Thin Solid Films 514, 188−192. (20) Xu, F., Datta, P., Wang, H., Gurung, S., Hashimoto, M., Wei, S., Goettert, J., McCarley, R. L., and Soper, S. A. (2007) Polymer microfluidic chips with integrated waveguides for reading microarrays. Anal. Chem. 79, 9007−9013. (21) Mira, D., Llorente, R., Morais, S., Puchades, R., Maquieira, A., and Martí, J. (2004) High throughput screening of surface-enhanced fluorescence on industrial standard digital recording media. Proc. SPIEInt. Soc. Opt. Eng. 5617, 364−373. (22) Sharma, R., Holcomb, E., Trigwell, S., and Mazumder, M. (2007) Stability of atmospheric-pressure plasma induced changes on polycarbonate surfaces. J. Electrostatics 65, 269−273. (23) Wang, Z., and Li, R.-X. (2007) Fabrication of DNA micropatterns on the polycarbonate surface of compact discs. Nanoscale Res. Lett. 2, 69−74. (24) McCarley, R. L., Vaidya, B., Wei, S., Smith, A. F., Patel, A. B., Feng, J., Murphy, M. C., and Soper, S. A. (2005) Resist-free patterning of surface architectures in polymer-based microanalytical devices. J. Am. Chem. Soc. 127, 842−843. (25) Li, Y., Wang, Z., Ou, L. M. L., and Yu, H.-Z. (2007) DNA Detection on plastic: a mild and efficient surface activation protocol converts polycarbonate substrates to biochip platforms. Anal. Chem. 79, 426−433. (26) Steel, A. B., Levicky, R. L., Herne, T. M., and Tarlov, M. J. (2000) Immobilization of nucleic acids at solid surfaces: effect of oligonucleotide length on layer assembly. Biophys. J. 79, 975−981. (27) Fixe, F., Dufva, M., Telleman, P., and Christensen, C. B. V. (2004) Functionalization of poly(methyl methacrylate) (PMMA) as a substrate for DNA microarrays. Nucleic Acids Res. 32, e9. (28) Gong, P., Harbers, G. M., and Grainger, D. W. (2006) Multitechnique comparison of immobilized and hybridized oligonucleotide surface density on commercial amine-reactive microarray slides. Anal. Chem. 78, 2342−2351. (29) Shchepinov, M. S., Case-Green, S. C., and Southern, E. M. (1997) Steric factors influencing hybridisation of nucleic acids to oligonucleotides arrays. Nucleic Acids Res. 25, 1155−1161. (30) Relógio, A., Schwager, C., Richter, A., Ansorge, W., and Valcárcel, J. (2002) Optimization of oigonucleotide-based DNA microarrays. Nucleic Acids Res. 30, e51. (31) Vainrub, A., and Pettitt, B. M. (2002) Coulomb blockage of hybridization in two-dimensional DNA arrays. Phys. Rev. E 66, 041905. (32) Song, K.-S., Nimse, S. B., Kim, J., Kim, J., Nguyen, V.-T., Ta, V.T., and Kim, T. (2011) 9G DNA Chip: microarray based on the multiple interactions of 9 consecutive guanines. Chem. Commun. 47, 7101−7103. (33) Peterson, A. W., Heaton, R. J., and Georgiadis, R. M. (2001) The effect of surface probe density on DNA hybridization. Nucleic Acids Res. 29, 5163−5168. (34) Gong, P., and Levicky, R. (2008) DNA surface hybridization regimes. Proc. Natl. Acad. Sci. U.S.A. 105, 5301−5306. (35) Taton, T. A., Mirkin, C. A., and Letsinger, R. L. (2000) Scanometric DNA array detection with nanoparticle probes. Science 289, 1757−1760. (36) McCarthy, J. J., and Hilfiker, R. (2000) The use of singlenucleotide polymorphism maps in pharmacogenomics. Nat. Biotechnol. 18, 505−508. (37) Morais, S., Marco-Molés, R., Puchades, R., and Maquieira, A. (2006) DNA microarraying on compact disc surfaces. Application to the analysis of single nucleotide polymorphisms in Plum pox virus. Chem. Commun. 22, 2368−2370. (38) Morais, S., Tortajada-Genaro, L. A., Arnandis-Chover, T., Puchades, R., and Maquieira, A. (2009) Multiplexed microimmunoassays on a digital versatile disk. Anal. Chem. 81, 5646−5654. (39) Hermanson, G. T. (2008) Bioconjugate Techniques, 2nd ed., Academic Press, San Diego, CA.

ana (GV/2009/028 and PROMETEO/2010/008). The Spanish Ministerio de Educación y Ciencia provided J.T.-L. with a grant for his Ph.D. studies. We thank Juan Hurtado for his technical assistance with the plasma reactor.

■

REFERENCES

(1) Morais, S., Carrascosa, J., Mira, D., Puchades, R., and Maquieira, A. (2007) Microimmunoanalysis on standard compact discs to determine low abundant compounds. Anal. Chem. 79, 7628−7635. (2) Morais, S., Tamarit-López, J., Carrascosa, J., Puchades, R., and Maquieira, A. (2008) Analytical prospect of compact disk technology in immunosensing. Anal. Bioanal. Chem. 391, 2837−2844. (3) Du, Q., Larsson, O., Swerdlow, H., and Liang, Z. (2006) DNA immobilization: silanized nucleic acids and nanoprinting. Top. Curr. Chem. 261, 45−61. (4) Ivanova, E. P., Wright, J. P., Pham, D. K., Brack, N., Pigram, P., Alekseeva, Y. V., Demyashev, G. M., and Nicolau, D. V. (2006) A comparative study between the adsorption and covalent binding of human immunoglobulin and lysozyme on surface-modified poly(tertbutyl methacrylate). Biomed. Mater. 1, 24−32. (5) Di Giusto, D. A., and King, G. C. (2006) Special-Purpose modifications and immobilized functional nucleic acids for biomolecular interactions. Top. Curr. Chem. 261, 131−168. (6) Sassolas, A., Leca-Bouvier, B. D., and Blum, L. J. (2008) DNA biosensors and microarrays. Chem. Rev. 108, 109−139. (7) Bora, U., Sharma, P., Kumar, S., Kannan, K., and Nahar, P. (2006) Photochemical activation of a polycarbonate surface for covalent immobilization of a protein ligand. Talanta 70, 624−629. (8) Witek, M. A., Llopis, S. D., Wheatley, A., McCarley, R. L., and Soper, S. A. (2006) Purification and preconcentration of genomic DNA from whole cell lysates using photoactivated polycarbonate (PPC) microfluidic chips. Nucleic Acids Res. 34, e74. (9) Carion, O., Souplet, V., Olivier, C., Maillet, C., Medard, N., ElMahdi, O., Durand, J.-O., and Melnyk, O. (2007) Chemical micropatterning of polycarbonate for site-specific peptide immobilization and biomolecular interactions. ChemBioChem 8, 315−322. (10) Najmabadi, P., Ko, K.-S., La Clair, J. J., and Burkart, M. D. (2008) A method for fabrication of polycarbonate-based bioactive platforms. JALA 13, 284−288. (11) Remacle, J., Alexandre, I., and Houbion, Y. (2002) US Patent 177144. (12) La Clair, J. J., and Burkart, M. D. (2003) Molecular screening on a compact disc. Org. Biomol. Chem. 1, 3244−3249. (13) Bañuls, M. J., González-Pedro, V., Puchades, R., and Maquieira, A. (2007) PMMA isocyanate-modified digital discs as a support for oligonucleotide-based assays. Bioconjugate Chem. 18, 1408−1414. (14) Bañuls, M. J., García-Piñón, F., Puchades, R., and Maquieira, A. (2008) Chemical derivatization of compact disc polycarbonate surfaces for SNPs detection. Bioconjugate Chem. 19, 665−672. (15) Tamarit-López, J., Morais, S., Puchades, R., and Maquieira, A. (2011) Direct hapten-linked multiplexed immunoassays on polycarbonate surface. Biosens. Bioelectron. 26, 2694−2698. (16) Li, Y., Ou, L. M. L., and Yu, H.-Z. (2008) Digitized molecular diagnostics: reading disk-based bioassays with standard computer drives. Anal. Chem. 80, 8216−8223. (17) Siow, K. S., Britcher, L., Kumar, S., and Griesser, H. J. (2006) Plasma methods for the generation of chemically reactive surfaces for biomolecule immobilization and cell colonization: a review. Plasma Process. Polym. 3, 392−418. (18) Muir, B. W., Mc Arthur, S. L., Thissen, H., Simon, G. P., Griesser, H. J., and Castner, D. G. (2006) Effects of oxygen plasma treatment on the surface of bisphenol A polycarbonate: a study using SIMS, principal component analysis, ellipsometry, XPS and AFM nanoindentation. Surf. Interface Anal. 38, 1186−1197. (19) Chen, T. N., Wuu, D. S., Wu, C. C., Chiang, C. C., Lin, H. B., Chen, Y. P., and Horng, R. H. (2006) Effects of plasma pretreatment 2580


Oxygen Plasma Treated Interactive Polycarbonate DNA Microarraying

Recommend Documents