p-Nitrophenol Degradation via 4-Nitrocatechol in Burkholderia sp

Apr 1, 2010 - The former involves. 4-nitrocatechol (4-NC), 1,2,4-benzenetriol (BT), and maleylacetate. (MA) as major degradation intermediates, wherea...
1 downloads 0 Views 266KB Size
Download PDF
Environ. Sci. Technol. 2010, 44, 3435–3441

p-Nitrophenol Degradation via 4-Nitrocatechol in Burkholderia sp. SJ98 and Cloning of Some of the Lower Pathway Genes ARCHANA CHAUHAN,† G U N J A N P A N D E Y , †,# NARINDER K. SHARMA,† DEBARATI PAUL,† JANMEJAY PANDEY,† A N D R A K E S H K . J A I N * ,† Institute of Microbial Technology Sector-39A, Chandigarh-160036, India

Received August 17, 2009. Revised manuscript received November 30, 2009. Accepted March 13, 2010.

Microbial degradation studies have pointed toward the occurrence of two distinct PNP catabolic pathways in Gram positive and Gram negative bacteria. The former involves 4-nitrocatechol (4-NC), 1,2,4-benzenetriol (BT), and maleylacetate (MA) as major degradation intermediates, whereas the later proceedsviaformationof1,4-benzoquinone(BQ)andhydroquinone (HQ). In the present study we identified a Gram negative organism viz. Burkholderia sp. strain SJ98 that degrades PNP via 4NC, BT, and MA. A 6.89 Kb genomic DNA fragment of strain SJ98 that encompasses seven putatively identified ORFs (orfA, pnpD, pnpC, orfB, orfC, orfD, and orfE) was cloned. PnpC is benzenetriol dioxygenase belonging to the intradiol dioxygenase superfamily, whereas PnpD is identified as maleylacetate reductase, a member of the Fe-ADH superfamily showing NADH dependent reductase activity. The in vitro activity assays carried out with purified pnpC and pnpD (btd and mar) gene products transformed BT to MA and MA to β-ketoadipate, respectively. The cloning, sequencing, and characterization of these genes along with the functional PNP degradation studies ascertained the involvement of 4-NC, BT, and MA as degradation intermediates of PNP pathway in this strain. This is one of the first conclusive reports for 4-NC and BT mediated degradation of PNP in a Gram negative organism.

Introduction p-Nitrophenol (PNP) is among the most common nitrophenolic compounds that is widely used in pharmaceuticals, explosives, dyes, and agrochemicals (1, 2). Due to its high chemical stability, water solubility, persistence, and toxicity to the life forms, PNP has been listed as the priority pollutant by the United States Environmental Protection Agency (U.S. EPA) (3). The situation therefore requires urgent development of methodologies for the decontamination of environmental niches contaminated with PNP. During recent years a number

of studies have attempted PNP decontamination with approaches based on application of microbial metabolic potential. Some PNP degrading bacterial strains belonging to genera Flavobacterium, Pseudomonas, Moraxella, Nocardia, and Arthrobacter have been isolated and characterized for metabolic activity on PNP along with elucidation of the catabolic pathways (4-6). On the basis of the above studies, two distinct pathways have been identified for microbial degradation of PNP (7, 8). A generalized scheme of these catabolic pathways has been well accepted and is represented in Figure 1. As a variation to the above generalized scheme, Chauhan et al. (9) elucidated a novel PNP catabolic pathway in Arthrobacter protophormiae strain RKJ100 that proceeds via the formation of 4-nitrocatechol (4-NC) and 1,2,4-benezenetriol (BT). However, BT does not act as a substrate for ring hydroxylating dioxygenase, instead it is converted into 2-hydroxy-1,4-benzoquinone (HBQ) by the action of a 1,2,4benzenetriol dioxygenase (BtD). HBQ is subsequently degraded via formation of benzoquinone (BQ) and hydroquinone (HQ). In another recent study Perry and Zylstra (10) reported that the degradation of PNP in Arthrobacter sp. strain JS443 proceeds via HBQ and BT instead of the earlier reported pathways having 4-NC and BT as the degradation intermediates. Therefore, it could be postulated that there may be a few other deviation(s) from the generalized scheme for microbial degradation of PNP. In order to establish the functionality of other PNP degrading pathways it is important to elucidate their underlying molecular mechanisms. Takeo and his co-workers reported cloning and characterization of a PNP hydroxylase (nphRA1A2) gene cluster from Rhodococcus sp. strain PN1 (11). Similarly, another study describes the cloning and characterization of a PNP monooxygenase gene cluster (npcBAC) from Rhodococcus opacus SAO101 (12). Recently, an npd gene cluster, which encodes the enzymes of a PNP catabolic pathway, was cloned from Arthrobacter sp. strain JS443 (10). There are no reports available for the molecular characterization of the PNP degradation pathway specifically in the case of Gram negative PNP degrading bacteria. In the present study we report biochemical and functional characterization of the PNP degradation in Burkholderia sp. strain SJ98 (previously identified as Ralstonia sp. SJ98 (13)). The initial findings indicated toward the involvement of BT as the ring cleavage substrate. These results were confirmed by resting cell/induction studies which showed conversion of PNP to 4-NC along with induced enzyme activities for BtD and maleylacetate reductase (MaR). Further, we carried out the cloning and sequencing of a 6.897 Kb gene cluster from the genomic DNA of strain SJ98; this led to the identification of two ORFs namely, pnpC and pnpD as BtD and MaR that were independently expressed in Escherichia coli in order to confirm the identities of their gene products. The biochemical properties including substrate range; kinetic parameters along with secondary structural properties were also studied. The amino acid sequences of the two proteins were also subjected to phylogenetic analysis for determining their evolutionary relationships with similar/related proteins.

Experimental Section * Corresponding author address: Institute of Microbial Technology (CSIR), Sector-39A, Chandigarh-160036, India; phone: +91-172-690713/695215; fax: +91-172-690585/690632; e-mail: [email protected], [email protected]. † Institute of Microbial Technology (CSIR). # Current address: CSIRO Entomology Clunies Ross Street Acton, ACT 2601, Australia. 10.1021/es9024172

 2010 American Chemical Society

Published on Web 04/01/2010

Bacterial Strains, Plasmids, and Culture Conditions. Bacterial strains and plasmids used in this study are listed in Table S1. Strain SJ98 was grown in nutrient broth or in minimal medium [MM, supplemented with 0.3 mM PNP and/or 10 mM of sodium succinate (SS)] according to the method described earlier (14). Filter sterilized antibiotics were VOL. 44, NO. 9, 2010 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

3435

FIGURE 1. Pathways for PNP degradation in bacteria. added at a final concentration of 100 µg mL-1 (ampicillin) or 25 µg mL-1 (kanamycin) wherever required. Degradation Studies and Identification of Intermediates. Strain SJ98 was grown in MM supplemented with PNP (0.3 mM) as a sole source of carbon and energy. The utilization of PNP was indicated by the decolorization of its yellow color. Samples were collected at different time intervals and frozen at -70 °C. Cell free extracts were prepared by cell lysis through ultrasonication (Vibra-Cell VCX 130, Sonics & Materials, Inc., Newtown, CT, USA) followed by centrifugation at 4 °C. The cell free supernatants were subjected to extraction of aromatic compounds as described by Samanta et al (14). Resting cell studies were also performed similarly as described previously (14). Heat killed cells were taken as negative control. Samples were analyzed by TLC, HPLC, GC, and GC-MS methods. TLC studies were performed using 20 × 20 cm, 0.25 mm silica gel 60 F254 TLC sheets from Merck (Darmstadt, Germany) as stationary phase and a mixture of toluene, ethyl acetate, and acetic acid in the ratio of 60:30:5 as the mobile phase. The Rf values for analytes were calculated according to the method described previously (15). The HPLC analysis using C-18 column (Waters 600 model, Wein, Austria) and GC analysis using an ‘AutoSystem-XL’ Gas chromatograph from Perkin-Elmer (Waltham, Massachusetts, USA) equipped with flame-ionization detector (FID) were performed as described by Pandey et al. (15). The GC-MS analysis was carried out at constant temperature of 300 °C for injector and detector and an increasing temperature from 50 to 300 °C with a regular increment of 20 °C min-1 for the capillary column (Shimadzu Scientific Instruments, Columbia, MD, USA). Data obtained were processed with complementary software GC-MS solution, and peaks with molecular weight in the range of 40-700 on the chromatograph were considered for mass fragmentation and library match. Identity of the peaks and their respective mass fragments was ascertained by comparison of data stored in its library i.e. NIST62.LIB available with the GC-MS instrument. Enzyme Assays. BtD activity was assayed as described by Paul et al. (13). The reaction was carried out in 1 mL quartz3436

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 44, NO. 9, 2010

cuvette containing 50 mM sodium phosphate buffer (pH 6.8), 60 µg of total soluble protein (crude enzyme extract), and 0.2 mM BT as substrate. The reaction mixture was scanned over a wavelength of 220 to 350 nm at every two min. Activity of MaR was monitored by a decrease in absorbance at 340 nm (indicating oxidation of NADH in the reaction mixture) in 50 mM Tris-HCl (pH 7.5) containing 20 µg of total soluble protein, 0.2 mM NADH, and 0.1 mM MA as substrate. The above activity assays were also performed with purified BtD and MaR. Partial Amplification of BtD. Degenerate primers were designed from the conserved amino acid sequences of BtD(s) involved in the degradation pathways of different aromatic compounds after multiple sequence alignment in CLUSTAL_X (16). The sequence of the primers set used for amplification of btd (pnpC) were BtD_F 5′-AGGAGTTCATCCTGCT(G/C)(A/T)G-3′ and BtD_R 5′-CGCAC(G/C)CCGAAC AC(A/T)GCGTC-3′ designed from the conserved region in the N terminus (Q84 EFILLS) and the C terminus (D264 AVFGVR), respectively. Gradient PCR was performed to obtain the desired amplification. The reaction mixture consisted of 50-100 ng of genomic DNA template, 16 pmol of each primer, 10 mM each dNTPs, 1X ThermoPol buffer, and 1 U Deep Vent Polymerase (New England Biolabs, MA) in a total reaction volume of 25 µL. Southern Hybridization. Total genomic DNA was isolated from strain SJ98 using Qiagen genomic tip (500/G). For Southern hybridization genomic DNA (8 µg) of strain SJ98 was digested with suitable restriction enzyme(s) and subjected to agarose gel electrophoresis. Separated DNA fragments were transferred to Hybond-N+ Nylon membrane (GE Healthcare) and hybridized with radiolabeled partial btd gene probe. The probe was prepared using the Megaprime DNA labeling kit (GE Healthcare). Hybridization was performed at 42 °C in gold hybridization buffer (GE Healthcare). The membrane was then washed twice in a solution of 1 × SSC (150 mM sodium chloride, 15 mM sodium citrate, pH 7.0) containing 0.1% sodium dodecyl sulfate (SDS) at 50 °C (15 min each) and once in a solution of 0.1 × SSC containing

0.1% SDS at room temperature (15 min) followed by exposure to X-ray films (Hyperfilm, GE Healthcare). Cloning and Sequencing. The DNA fragments were eluted from the region that hybridized with the probe as described above, and these were cloned in pBluescript II KS (+) vector (17). Resulting clones were screened by dot blot hybridization (18) using the same probe. The clone selected after dot blot screening was sequenced (both strands) by primer walking from Microsynth GmbH (Balgach, Switzerland), and ORFs were identified using the ORF finder program at NCBI. The ORF analysis was performed at a cut off value of peptide/ protein size of more than 300 amino acids and using the bacterial genetic code system. Cloning of BtD and MaR in Expression Vector. In order to overexpress BtD and MaR these genes were cloned into vector pET-28c having N-terminal 6 × His tag. This was achieved by incorporating the BamHI and HindIII sites in the forward (ExpBtD_F 5′-CAGTATGGATCCATGAACGAACACCTCACGCAAT-3′) and reverse (ExpBtD_R 5′-GATAAAGCTTTCACGCGGGCTCCTTCACGAGCA-3′) primers for btd gene and NdeI and HindIII sites in the forward (ExpMaR_F 5′ACTTCATATGCAATCGTTCGTTTA 3′) and reverse (ExpMaR_R 5′- CTTCAAGCTTTCATGGTCGTCGTCCT 3′′) for the mar (pnpD) gene, respectively. Using these primers btd and mar genes were PCR amplified. Amplified genes and the vector were digested with appropriate restriction enzymes, ligated, and transformed into E. coli strain BL21. Reverse Transcriptase (RT)-PCR. Total RNA was prepared from cells of strain SJ98 grown on the MM supplemented with PNP and SS using an SV total RNA isolation system (Promega, Madison, WI, USA). On the basis of the nucleotide sequences of the pnpC and pnpD genes, the two primers sets i.e. BtD_F 5′ GATGGCGAGCCGGTGTTCTTTC 3′ and BtD_R 5′ GATGGCGAGCCGGTGTTCTTTC 3′ and MaR_F 5′ CCACTTACGCAGGCTCGGAAATG 3′ and 5′ TTGATGCCGCTCGTCACTGAAAG 3′ were synthesized. RT PCR was performed using Access RT PCR kit according to the manufacturer′s protocol (Promega, Madison, WI, USA). Overexpression of BtD and MaR. Overproduction of the btd gene products was achieved by growing E. coli BL21 clones at 37 °C in terrific broth supplemented with 25 µg mL-1 of kanamycin. When the OD600 reached 0.3 to 0.4, expression of the gene was induced by the addition of 1.0 mM isopropyl-β-D-thiogalactopyranoside (IPTG). The cells were incubated for an additional 4 h before they were harvested by centrifugation. Cells were resuspended in the lysis buffer (50 mM phosphate buffer, 300 mM NaCl, 10 mM imidazole) and protease inhibitors (1 mM phenylmethylsulfonylfluoride, 1 µg mL-1 pepstatin and 1 µg mL-1 leupeptin) were added, lysed by ultrasonication followed by centrifugation at 12,000 rpm for 20 min at 4 °C to remove cell debris, and supernatant was further used for the purification. Overproduction of MaR was carried out similarly except that the cells were grown at 18 °C after induction with 0.1 mM IPTG. The cells were incubated at this temperature for 12-16 h, harvested, and sonicated as described above. Purification of BtD and MaR. The crude extracts containing the overproduced His-tagged proteins were loaded on a Ni-NTA agarose column (Qiagen, Germany). The unbound proteins were washed with native wash buffer (50 mM phosphate buffer, 300 mM NaCl, 50 mM imidazole), and the bound protein was eluted using native elution buffer (50 mM phosphate buffer, 300 mM NaCl, 250 mM imidazole). Purity and molecular mass of the eluted proteins were analyzed by running 12% SDS-PAGE. Stability of the purified proteins was determined at different temperatures. Estimation of Native Molecular Weight of Purified Proteins. The molecular weights of native BtD and MaR were estimated by gel filtration chromatography using Superdex 200/60 column with Acta Prime plus chromatography system

(GE Healthcare). Elution was carried out at 4 °C using 50 mM phosphate buffer (pH 8.0), 150 mM NaCl with a flow rate of 0.4 mL min-1. Molecular weights of purified BtD and MaR were calculated from the standard linear regression curve of reference proteins (molecular weights from 160,000 Da to 12,000 Da). Enzyme Assays and Kinetic Studies. Enzyme assays for BtD and MaR were carried out as described earlier. For kinetic studies the concentration range used for BtD and MaR was BT (5-50 µM) and MA (5-100 µM), respectively. To avoid auto-oxidation stock of BT was always prepared fresh in double distilled water. Since MA is highly unstable, therefore it was prepared in situ by chemical hydrolysis under alkaline conditions by incubating cis-dienelactone with 2 N NaOH (7.5 µL for 15 min); MA so formed is stable for 8 h only (19). The Km and Vmax were determined from Michaelis-Menten Plot and Lineweaver-Burke Double-reciprocal Plot. Effect of pH and temperature on the enzyme activities of MaR and BtD was monitored by using buffers of different pHs from 5.0 to 9.0 and varying the temperature from 5 to 65 °C. Effect of metal ions and putative inhibitors of BtD and MaR activities was determined by incubating the enzymes with 1 mM and 10 mM concentrations of various metal ions and inhibitors for 30 min. Enzyme activity was monitored by addition of respective substrate(s), and the residual activity was calculated as percentage activity to the activity without any inhibitor or metal ion. The enzyme activity of BtD was also tested for various other structurally related substrates such as catechol, 4-NC, 3-methyl catechol, and pyrogallol, etc. Phylogenetic Analysis of BtD and MaR. Phylogenetic analysis for the deduced amino acid sequences of BtD and MaR retrieved from GenBank was carried out by aligning them using CLUSTAL_X, the bootstrap values (1000 bootstrap replications) were calculated using PHYLIP (SEQBOOT), and the tree topology was determined with TreeView. The rooted phylogenetic tree was generated with the DRAWGRAM program. The phylogenetic tree was constructed according to the ‘distance matrix estimation’ method using ‘NeighborJoining and UPGMA’ algorithm. The phylogenetic analyses were also carried using TreeCon software, and the tree topology was inferred with TreeView program. For BtD the amino acid sequences of some of the closely related hydroxyquinol dioxygenases, catechol dioxygenases, and protocatechuate dioxygenases were used, and hydroquinone dioxygenase was used as the out-group. On the other hand, the phylogenetic analysis of MaR was carried out using the amino acid sequences of other related maleylacetate reductases, chloromaleylacetate reductases, propanediol dehydrogenases, and alcohol dehydrogenases; the amino acid sequence of dienelactone hydrolase was used as out-group for this analysis.

Results and Discussion The isolation of strain SJ98 from pesticide contaminated agricultural land, its identification, and ability to utilize PNP as a sole source of carbon and energy have been reported earlier (14). Stoichiometric amounts of nitrite ions were released into the medium concomitant with the degradation of PNP suggesting the involvement of oxidative steps in PNP degradation. The oxidative degradation of PNP is well established in both Gram-negative and Gram-positive bacteria (5, 7, 10). Therefore, the preliminary analysis of the catabolic pathway was performed by carrying out growth studies of strain SJ98 using PNP and its known catabolic intermediates such as 4-NC, BT, and HQ, etc. as a sole source of carbon and energy. Strain SJ98 utilized PNP, 4-NC, and BT; however, it could not grow on HQ suggesting that 4-NC and BT may be the likely intermediates of the PNP degradation pathway. Further, resting cell studies showed that the PNP induced cells of strain SJ98 degraded 4-NC unlike the VOL. 44, NO. 9, 2010 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

3437

FIGURE 2. GC and GC-MS analyses of sample(s) of strain SJ98 grown on PNP. GC analysis at (A) 0 h and (B) 24 h. Mass fragmentation of the intermediates identified in the extracted samples (C) PNP, (D) BT, and (E) 4-NC. uninduced cells (data not shown). The induction of enzymes capable of 4-NC degradation in PNP induced cells indicated that PNP degradation in strain SJ98 could involve 4-NC as one of the intermediates. The TLC analysis following growth of strain SJ98 on PNP indicated the presence of three distinct spots with Rf values of 2.86, 3.81, and 5.47 in samples drawn at 2 to 10 h intervals. These Rf values corresponded with those of the standard compounds BT, 4-NC, and PNP, respectively. Inhibition studies with 2,2′-dipyridyl were also carried out to trap the intermediates as described earlier by Chauhan et al. (9). The HPLC and TLC analyses of the culture supernatant collected at various time intervals showed complete depletion of PNP (0.3 mM) within 24 h and clearly demonstrated accumulation of 4-NC and BT at 15 h onward. A maximum amount of ∼0.09 mM of 4-NC was detected by 36 h (Supporting Information (SI) Figure S1). After 48 h of growth there was accumulation of only BT (∼0.12 mM) indicating BT to be the ring cleavage substrate in this degradation pathway. Furthermore, when TLC plates were sprayed with Folin-Ciocalteu’s reagent an immediate blue coloration was apparent in the case of suspected 4-NC spots since ortho or para diphenols give blue color with this reagent (9). No such results were obtained with control grown on SS. GC studies with the above samples indicated the presence 3438

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 44, NO. 9, 2010

of PNP (2.54 min) and BT (3.01 min) based on their retention times (data not shown). The GC-MS analysis of these samples showed the presence of the two characteristic peaks with mass fragmentation patterns having molecular ion [M+] at m/z of 139 and 126 (Figure 2). Library match of these mass fragmentation patterns ascertained their identities as PNP and BT, respectively. Direct mass analysis of another sample peak showed molecular ion [M+] at m/z )155, characteristic of 4-NC (Figure 2), thereby, confirming the identity of 4-NC and BT as PNP degradation intermediates in strain SJ98. Enzyme Assays. In order to further substantiate the above observations enzyme assays were performed with the crude extracts of PNP grown cells of strain SJ98. A positive BtD activity was observed with PNP grown cells of strain SJ98 (SI Figure S2A); an NADH dependent MaR activity was also shown (SI Figure S2B). Benzenetriol is, therefore, degraded via β-ketoadipate pathway involving the formation of MA. However, no activity was observed when crude cell extract of uninduced cells of strain SJ98 was used for the above assays indicating the inducible nature of the pathway enzymes. Taken together, these results clearly demonstrate that the degradation of PNP in strain SJ98 proceeds via 4-NC, BT, and MA as the pathway intermediates. To the best of our

knowledge this is the first conclusive report indicating the occurrence of this pathway in a Gram-negative organism strain SJ98. Cloning of Gene Cluster Involved in PNP Degradation and Organization of ORFs. To gain insight into the molecular regulation of PNP degradation by strain SJ98, attempts were made to clone the gene cluster involved in the degradation. Based on the initial findings it was presumed that BtD is the crucial enzyme in this degradation pathway; consequently, it was used as the primary target for probing the gene cluster involved in PNP degradation. Two sets of degenerate primers were designed to partially amplify the BtD gene from the genomic DNA of strain SJ98 (see the Experimental Section). Amplification of a DNA fragment having an expected amplicon size (∼540 bp) was obtained using gradient PCR. The above amplicon was cloned into the SmaI site of pBluescriptII KS (+). One of the recombinants so obtained was sequenced using vector specific primers i.e., KS and SK. Translated BLAST (tBLASTx) performed for the sequence of the cloned insert showed good homology with the putative BtD of Rhodopseudomonas palustris CGA009. A multiple sequence alignment of the ∼540 bp partial btd gene with some of the known BtD genes showed characteristic sequence conservation at both termini (SI Figure S3). For cloning of the complete gene encoding BtD and the other gene(s)/gene cluster involved in PNP degradation, a southern hybridization experiment was performed using the PCR amplified ∼540 bp partial btd gene as DNA probe. This hybridized only once in case of every restriction enzymes suggesting the presence of a single copy of the btd in the genome of strain SJ98. EcoRI digested DNA fragments were eluted from the region that hybridized with the above probe and were cloned into pBluescriptII KS (+), and the resulting clones were screened using the same probe by dot blot hybridization by method as described earlier. One of the clones, designated as pSJ262, showed a strong hybridization signal suggesting the presence of an insert harboring genomic DNA along with the btd gene. The size of the insert in the pSJ262 was found to be ∼6.9 kb. Amplification of ∼540 bp btd gene (partial btd gene) from clone pSJ262 by colony PCR ascertained the presence of partial btd gene in the plasmid. Furthermore, clone pSJ262 was found to be positive for BtD enzyme activity indicating the presence of the full length btd gene (data not shown). The insert (∼6.9 kb) in pSJ262 was completely sequenced by primer walking and was annotated; its exact length was found to be 6.897 kb having 15 open reading frames (ORFs). Manual analysis for database comparison showed that seven out of the 15 ORFs had significant homology with previously characterized genes for degradation of aromatic compound(s) (SI Figure S4). Results obtained with protein BLAST analysis of the deduced amino acid sequence of above ORFs are summarized in Table S2. The completely annotated sequence of the 6.897 kb fragment has been submitted to GenBank having accession number AY574278. RT PCR. RT-PCR analysis was carried out using the primer pairs as indicated earlier for both pnpC and pnpD genes (see the Experimental Section). Both genes were transcribed in the total RNA obtained from PNP grown cells of strain SJ98, whereas no transcription was observed in the control RNA obtained from succinate grown cells of strain SJ98. No PCR amplification was observed in the absence of reverse transcriptase, thereby excluding the possibility of DNA contamination. However, amplification was observed in the control PCR reactions containing the DNA of respective genes (SI Figure S5). This clearly led us to conclude that the pnpC and pnpD genes of strain SJ98 are only expressed in the presence of PNP as the growth substrate indicating their involvement in the PNP degradation pathway and that the regulation of pnpC and pnpD genes is induced by PNP.

Overexpression and Characterization of the Purified Proteins. Out of the above-mentioned 7 ORFs two ORFs i.e. PnpC and PnpD (SI Figure S4) encoding BtD and MaR, respectively, were part of the PNP degradation pathway (indicated by the degradation studies discussed earlier). Therefore, these proteins were further biochemically characterized by overexpressing them in the pET-28c vector. Histagged protein(s) were purified using standard Ni-NTA affinity chromatography. SDS-PAGE analysis of the purified BtD showed it to be of ∼32 kDa in size (Figure 3A). The purified protein was subjected to enzyme assay wherein the positive activities for above assay confirmed the identity of PnpC as BtD. Temperature and pH related studies on the enzyme activity of BtD showed that BtD was active over a temperature range of 10 to 45 °C with an optimal activity at 30 °C and a pH range of 6.0 to 7.6 with an optimum activity at pH 6.8 (SI Figure S6A). Further, the purified enzyme was stable for 2-3 weeks at 4 °C for three months at -20 °C and six months at -70 °C in 30% glycerol. Purified BtD was unable to catalyze ring cleavage of structural analogues of BT such as catechol, 3-nitrocatechol, 3-methyl catechol, 4- nitrocatechol, 4-methyl catechol, and 4-chlorocatechol, and pyrogallol, etc. indicating its high substrate specificity (20). The Km and Vmax values of BtDascalculatedfromMichaelisMentenplotandLineweaverBurke’ Double Reciprocal Plot were found to be 4.6 µM and 14.5 µmole min-1 mg-1 of protein, respectively (SI Figure S6B). The native molecular weight of BtD as determined by gel filtration chromatography was found to be 68 kDa using the standard linear regression curve of reference proteins (SI Figure S6C) demonstrating that BtD is present as a homodimeric molecule in strain SJ98, and its specific activity was calculated to be 22.8 Umg-1. Similarly, biochemical characterization studies with MaR showed it to be active over a temperature range of 10 to 40 °C and pH between 5.0 and 9.0, respectively, with optimal activity being at 25 °C and pH of 7.8 (SI Figure S7A). This enzyme was found to be highly unstable and prone to precipitation at a concentration of 1 mg mL-1 or more in 50 mM Tris-Cl (pH 8.0) containing 50 mM NaCl at ambient temperatures. The stability of MaR could be successfully improved by the addition of glycerol (at 30% v/v concentration) or by increasing the NaCl concentration (up to 1 M) in the above buffer. Further, stability of MaR under different storage conditions indicated that purified enzyme retained its activity for 2-3 weeks at 4 °C, 3-4 months at -20 °C, and 6 months at -70 °C when stored in 30% glycerol. SDS PAGE analysis of MaR showed that the monomeric unit has a molecular weight of ∼40 kDa (Figure 3B). Gel filtration studies with purified MaR also revealed that the native molecular weight of MaR is ∼40 kDa using the standard linear regression curve of reference proteins which indicated that MaR exists as a monomer in strain SJ98 (SI Figure S7B). However, earlier studies reported MaR to be a dimer of 74-80 kDa (21, 22). Therefore, to the best of our knowledge, this is the first report of MaR to exit as a monomer. The Matrix Associated Light Desorption Ionization (MALDI) analysis ascertained the exact monomeric molecular weight of MaR to be 39.9 kDa (SI Figure S7C). The specific activity of MaR was calculated to be 13.33 Umg-1 of protein, whereas the Km and Vmax values were 11 µM and 230.3 µmol min-1 mg-1, respectively (SI Figure S7D). The wide distribution of BT as an intermediate in the degradation of various aromatic compounds implies an important role for BtD in detoxification by acting as the central ring hydroxylating dioxygenase in microbial degradation of different aromatic compounds such as BT, 6-chlorobenzenetriol, 3-methyl catechol, or pyrogallol (23). Relatively relaxed substrate specificity of BtD toward substrates the above compounds has been reported in different bacterial isolates (24). Although BtD purified during this study was found to be a dimer which is in agreement with other earlier VOL. 44, NO. 9, 2010 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

3439

FIGURE 3. SDS-PAGE analysis of Ni-NTA purified (A) BtD and (B) MaR. Molecular weight marker shown in kDa (lane M). Lanes 2, 3, and 4 show crude extract, flow through, and elution fractions of the respective proteins. reports (12, 24, 25), however it showed stringent substrate specificity. MaR has been shown to play a role, for example, in quinol, resorcinol, and 2,4-dihydroxybenzoate degradation wherein they form β-ketoadipate by reduction of carboncarbon double bond (26). Other aromatic growth substrates involving the action of MaR are more exotic since they carry a fluorine substituent (19), a sulfo group (27), a nitro group (5), or several chlorine substituents (28). The mar gene(s) has generally been found to be part of specialized chlorocatechol gene cluster (25). However, ours is one of the few reports of cloning and characterization of mar not belonging to the chlorocatechol gene cluster. Till date MaR has been reported to be a dimer of around 75-80 kDa, whereas the MaR cloned and characterized in the present study was found to be a monomer of 39.9 kDa. The above-mentioned deviations in the properties of BtD (stringent substrate specifity) and MaR (functional monomeric nature) could be due to subtle phylogenetic variations acquired by strain SJ98 during the course of evolution for acquiring the ability to degrade aromatic compound(s). To test this hypothesis a phylogenetic analysis of the deduced amino acid sequences of BtD and MaR was carried out using “distance estimation method”. The phylogenetic relatedness of BtD was evaluated with some of the previously sequenced/ 3440

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 44, NO. 9, 2010

characterized ‘ring hydroxylating dioxygenase (RHDO) e.g. hydroxyquinol 1,2-dioxygenase, catechol 1,2-dioxygenase, and protocatechuate 3,4-dioxygenase. The resulting dendogram demonstrated that BtD of strain SJ98 has a close phylogenetic relationship with ‘hydroxyquinol 1,2-dioxygenase’ as compared to other tested RHDOs (SI Figure S8A). Interestingly, BtD of strain SJ98 fell into a separate branch indicating a possible evolutionary divergence from all of the other hydroxyquinol dioxygenases. Similarly, the phylogenetic analysis of MaR was also carried out using amino acid sequences of some of the closely related MaRs, chloromaleylacetate reductases, alcohol dehydrogenases, and propanediol dehydrogenases. The resulting dendrogram showed MaR to be closely related to alcohol dehydrogenases (exist in different oligomeric forms) and a few MaRs of other Burkholderia spp. (exist as dimers), whereas MaRs and alcohol dehydrogenases from other genera fall as separate group (SI Figure S8B). The dendogram also showed clustering of propanediol dehydrogenase as a secluded group clearly demonstrating its phylogenetic nonrelatedness with MaRs. Therefore, it is difficult to postulate a hypothesis for the monomeric existence of MaR. Further studies for determining the structural features of this protein may be essential to

elucidate the functional advantage, if any, provided by the monomeric status of this protein. In summary, this study conclusively demonstrates complete PNP degradation pathway via 4-NC and BT in a Gramnegative bacterium Burkholderia sp. SJ98. We have also reported the cloning, purification, and biochemical characterization of two PNP degradation lower pathway gene(s) i.e. btd and mar.

(12)

(13)

(14)

Acknowledgments We thank Dr. Purnnananda Guptasarma for his help in CD and MALDI analysis and Mr. Surendra Vikram and Ms. Sangeetha Sukumar for their help in preparing the manuscript. We also acknowledge the research fellowships awarded by the Council of Scientific and Industrial Research (CSIR), Govt. of India. This is IMTECH communication no. 04/2009. A.C. and G.P. contributed equally.

Supporting Information Available Time course analysis of PNP degradation in Figure S1, BtD and MaR enzyme assay in Figure S2, multiple amino acid sequence alignment of BtDs in Figure S3, organization of ORFs in Figure S4, RT PCR analyses of pnpC and pnpD in Figure S5, biochemical characterization of BtD and MaR in Figures S6 and S7, and phylogenetic trees of BtD and MaR in Figure S8. This material is available free of charge via the Internet at http://pubs.acs.org.

Literature Cited (1) Kunugita, N.; Oyama, T.; Kawamoto, T. [p-Nitrophenol]. Nippon Rinsho 2004, 62, 495–497. (2) Padda, R. S.; Wang, C.; Hughes, J. B.; Kutty, R.; Bennett, G. N. Mutagenicity of nitroaromatic degradation compounds. Environ. Toxicol. Chem. 2003, 22, 2293–2297. (3) Letzel, S.; Goen, T.; Bader, M.; Angerer, J.; Kraus, T. Exposure to nitroaromatic explosives and health effects during disposal of military waste. Occup. Environ. Med. 2003, 60, 483–488. (4) Hanne, L. F.; Kirk, L. L.; Appel, S. M.; Narayan, A. D.; Bains, K. K. Degradation and induction specificity in actinomycetes that degrade p-nitrophenol. Appl. Environ. Microbiol. 1993, 59, 3505– 3508. (5) Spain, J. C.; Gibson, D. T. Pathway for biodegradation of p-nitrophenol in Moraxella sp. Appl. Environ. Microbiol. 1991, 57, 812–819. (6) Liu, H.; Zhang, J. J.; Wang, S. J.; Zhang, X. E.; Zhou, N. Y. Plasmidborne catabolism of methyl parathion and p-nitrophenol in Pseudomonas sp. strain WBC-3. Biochem. Biophys. Res. Commun. 2005, 334, 1107–1114. (7) Jain, R. K.; Dreisbach, J. H.; Spain, J. C. Biodegradation of p-nitrophenol via 1,2,4-benzenetriol by an Arthrobacter sp. Appl. Environ. Microbiol. 1994, 60, 3030–3032. (8) Kadiyala, V.; Spain, J. C. A two-component monooxygenase catalyzes both the hydroxylation of p-nitrophenol and the oxidative release of nitrite from 4-nitrocatechol in Bacillus sphaericus JS905. Appl. Environ. Microbiol. 1998, 64, 2479–2484. (9) Chauhan, A.; Chakraborti, A. K.; Jain, R. K. Plasmid-encoded degradation of p-nitrophenol and 4-nitrocatechol by Arthrobacter protophormiae. Biochem. Biophys. Res. Commun. 2000, 270, 733–740. (10) Perry, L. L.; Zylstra, G. J. Cloning of a gene involved in the catabolism of p-nitrophenol by Arthrobacter sp. strain JS443 and characterization ofp-nitrophenol monooxygenase. J. Bacteriol. 2007, 189, 7563–7572. (11) Takeo, M.; Yasukawa, T.; Abe, Y.; Niihara, S.; Maeda, Y.; Negoro, S. Cloning and characterization of a 4-nitrophenol hydroxylase

(15)

(16)

(17) (18)

(19)

(20)

(21)

(22)

(23)

(24)

(25)

(26)

(27)

(28)

gene cluster from Rhodococcus sp. PN1. J. Biosci. Bioeng. 2003, 95, 139–145. Kitagawa, W.; Kimura, N.; Kamagata, Y. A novel PNP degradation gene cluster from a Gram positive bacterium Rhodococcus opacus SAO101. J. Bacteriol. 2004, 186, 4894–4902. Paul, D.; Rastogi, N.; Krauss, U.; Schlomann, M.; Pandey, G.; Pandey, J.; Ghosh, A.; Jain, R. K. Diversity of ‘benzenetriol dioxygenase’ involved in p-nitrophenol degradation in soil bacteria. Indian J. Microbiol. 2008, 48, 279–286. Samanta, S. K.; Bhushan, B.; Chauhan, A.; Jain, R. K. Chemotaxis of a Ralstonia sp. SJ98 toward different nitroaromatic compounds and their degradation. Biochem. Biophys. Res. Commun. 2000, 269, 117–123. Pandey, G.; Paul, D.; Jain, R. K. Branching of o-nitrobenzoate degradation pathway in Arthrobacter protophormiae RKJ100: identification of new intermediates. FEMS Microbiol. Lett. 2003, 229, 231–236. Thompson, J. D.; Gibson, T. J.; Higgins, D. G. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Curr. Protoc. Bioinf 2002, Chapter 2, Unit 2 3. Short, J. M.; Fernandez, J. M.; Sorge, J. A.; Huse, W. D. Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties. Nucleic Acids Res. 1988, 16, 7583–7600. Sambrook, J.; Russell, D. W. Molecular cloning: a laboratory manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y., U.S.A., 2001. Seibert, V.; Kourbatova, E. M.; Golovleva, L. A.; Schlomann, M. Characterization of the maleylacetate reductase macA of Rhodococcus opacus 1CP and evidence for the presence of an isofunctional enzyme. J. Bacteriol. 1998, 180, 3503–3508. Lima, L. M.; de Prat-Gay, G. Conformational changes and stabilization induced by ligand binding in the DNA-binding domain of the E2 protein from human papillomavirus. J. Biol. Chem. 1997, 272, 19295–19303. Kaschabek, S. R.; Reineke, W. Purification and characterization of maleylacetate reductase from Pseudomonas sp. strain B13. J. Bacteriol. 1993, 175, 6075–6081. Travkin, V. M.; Linko, E. V.; Golovleva, L. A. Purification and characterization of maleylacetate reductase from Nocardioides simplex 3E utilizing phenoxyalcanoic herbicides 2,4-D and 2,4,5T. Biochemistry (Moscow) 1999, 64, 625–630. Wu, J. F.; Jiang, C. Y.; Wang, B. J.; Ma, Y. F.; Liu, Z. P.; Liu, S. J. Novel partial reductive pathway for 4-chloronitrobenzene and nitrobenzene degradation in Comamonas sp. strain CNB-1. Appl. Environ. Microbiol. 2006, 72, 1759–1765. Hatta, T.; Nakano, O.; Imai, N.; Takizawa, N.; Kiyohara, H. Cloning and sequence analysis of hydroxyquinol 1,2-dioxygenase gene in 2,4,6-trichlorophenol degrading Ralstonia pickettii DTP0602 and characterization of its product. J. Biosci. Bioeng. 1999, 87, 267–272. Daubaras, D. L.; Saido, K.; Chakrabarty, A. M. Purification of hydroxyquinol 1,2-dioxygenase and maleylacetate reductase: the lower pathway of 2,4,5-trichlorophenoxyacetic acid metabolism byBurkholderia cepacia AC1100. Appl. Environ. Microbiol. 1996, 62, 4276–4279. Stolz, A.; Knackmuss, H. J. Degradation of 2,4-dihydroxybenzoate byPseudomonas sp. BN9. FEMS Microbiol. Lett. 1993, 108, 219– 224. Feigel, B. J.; Knackmuss, H. J. Syntrophic interactions during degradation of 4-aminobenzenesulfonic acid by a two species bacterial culture. Arch. Microbiol. 1993, 159, 124–130. Zaborina, O.; Latus, M.; Eberspacher, J.; Golovleva, L. A.; Lingens, F. Purification and characterization of 6-chlorohydroxyquinol 1,2-dioxygenase from Streptomyces rochei 303: comparison with an analogous enzyme from Azotobacter sp. strain GP1. J. Bacteriol. 1995, 177, 229–234.

ES9024172

VOL. 44, NO. 9, 2010 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

3441