Paeonol Reverses Adriamycin Induced Cardiac Pathological

Subscriber access provided by BUFFALO STATE

Article

Paeonol Reverses Adriamycin Induced Cardiac Pathological Remodeling through Notch1 Signaling Reactivation in H9c2 Cells and Adult Zebrafish Heart Syeda Thabassum Akhtar Iqbal, Pichiah Balasubramanian Tirupathi Pichiah, Sudhakaran Raja, and Sankarganesh Arunachalam Chem. Res. Toxicol., Just Accepted Manuscript • DOI: 10.1021/acs.chemrestox.9b00093 • Publication Date (Web): 16 Jul 2019 Downloaded from pubs.acs.org on July 17, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Chemical Research in Toxicology

Paeonol Reverses Adriamycin Induced Cardiac Pathological Remodeling through Notch1 Signaling Reactivation in H9c2 Cells and Adult Zebrafish Heart Syeda Thabassum Akhtar Iqbal ⱡ, Pichiah Balasubramanian Tirupathi Pichiah¶, Sudhakaran Raja ⱡ*, Sankarganesh Arunachalam†* ⱡ

School of Bio-Sciences and Technology, Vellore Institute of Technology, Vellore, Tamilnadu, PIN 632014, India; ¶

Department of Food Science & Human Nutrition, Chonbuk National University, 664-14 Duckjin-dong, Jeonju, Jeonbuk 561-756, Republic of Korea;

†

Department of Biotechnology, Kalasalingam Academy of Research and Education, Tamilnadu, PIN 626126, India.

KEYWORDS: Adriamycin, Notch1, Cardiac repair, Cardiomyopathy, Paeonol.

1 Environment ACS Paragon Plus

Chemical Research in Toxicology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT. Adriamycin is a commonly prescribed chemotherapeutic drug for a wide range of cancers. Adriamycin causes cardiotoxicity as an adverse effect that limits its clinical application in cancer treatment. Several mechanisms have been proposed to explain the toxicity it causes in heart cells. Disruption of inherent cardiac repair mechanism is the least understood mechanism of Adriamycin-induced cardiotoxicity. Adriamycin induces pathological remodeling in cardiac cells by promoting apoptosis, hypertrophy and fibrosis. We found that Adriamycin inhibited Notch1 in a time and dose dependent manner in H9c2 cells. We used Paeonol, a Notch1 activator and analyzed the markers of apoptosis, hypertrophy and fibrosis in H9c2 cells in vitro and in adult zebrafish heart in vivo as model system to study Adriamycin induced cardiotoxicity. Paeonol activated Notch1 signaling and expression of its downstream target genes effectively in the Adriamycin treated condition in vitro and in vivo. Also we detected that Notch activation using Paeonol protected the cells from apoptosis, collagen deposition and hypertrophy response using functional assays. We conclude that Adriamycin induced cardiotoxicity by promoting the pathological cardiac remodeling through inhibition of Notch1 signaling and that the Notch1 reactivation by Paeonol protected the cells and reversed the cardiotoxicity.

INTRODUCTION. Anthracyclines are effective anticancer drugs against wide variety of cancers but they are known to cause cardiotoxicity as an adverse side effect. Though anthracyclines induced cardiotoxicity is reversible on a few occasions, it often culminates in cardiac failure. Adriamycin is an anthracycline drug which specifically causes dilated cardiomyopathy. Adriamycin is a secondary metabolite extracted from Streptomyces peucetius var. Caesius. It is used as an effective antineoplastic agent against several solid tumors, leukemia and lymphomas.1 The cardiotoxic effect of Adriamycin is attributed to its propensity to promote the generation of reactive oxygen species, dysregulation of intracellular calcium level, high energy phosphate pool,


Page 2 of 41

Page 3 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and extracellular matrix remodeling.2 In the isolated human cardiac progenitor cells, Adriamycin induces apoptosis in the early periods of exposure and caused senescence through telomere shortening in the later period of exposure,3 which lead to the conclusion that Adriamycin suppresses the stem cell-dependent repair and regeneration mechanisms. Mammalian heart is considered a post-mitotic organ, however, the presence of several populations of endogenous cardiac progenitor cells, indicates to be a better target for stem cell therapy. Cardiac progenitor cells (CPCs) are multipotent cells found in the fetal and adult mammalian heart with cardiac repair and regenerative potential.4, 5 Under healthy condition, they are inactive but gets activated in order to differentiate into cardiomyocytes or vascular cells following injury.6,

7

These stem cell

populations are uniquely identified with the expression of stem cell markers such as c-kit,8 Sca-1,9 cardiosphere derived cells10 where Notch1 regulates the commitment of c-kit+ CPCs into myocyte lineage by targeting Nkx2.5. This increases cardiomyogenesis and myocardial regeneration leading to improvement in better cardiac function.11, 12 The Notch is a single transmembrane receptor protein with three domains including a larger extracellular domain, a single pass transmembrane and an intracellular domain.13 There are four receptors including, Notch1, Notch2, Notch3, Notch4 and five ligands such as Jagged1, Jagged2, Delta1, Delta3 and Delta4 in the mammalian Notch family. The structure between the four receptors and five ligands are more or less similar to each other. Binding of the ligands to the receptor of adjacent cell result in its activation through two proteolytic cleavages (1) TACE (TNFα ADAM metalloprotease converting enzyme)/ ADAM cleavage which releases extracellular domain bound to the ligand which gets internalized through endocytosis and undergoes ubiquitination within the signal-sending cell.13 (2) Gamma-secretase cleavage releases the active Notch intracellular domain (NICD) from transmembrane domain. Then this active NICD enters



into the nucleus and binds to the family of CSL (CBF1/Su(H)/Lag-1) transcription factors and activates the target genes by replacing the co-repressors which are responsible for the suppression of Notch targets.14 Notch signaling is vital for its major contribution in the development, influencing cell fate determination, proliferation and its survival, cell adhesion, epithelial-tomesenchymal transition15-19 etc., whereas its deregulation lead to adverse effects. Notch signaling is highly required and regulated during cardiac development20 with its association in survival and proliferation in adult heart post injury.21 In the heart, Notch1 signaling is activated transiently upon injury in various cell types such as cardiomyocytes, endothelial cells and smooth muscle cells.12 Notch activation very importantly enhances the reparative capacity of cardiac progenitor cells in heart21 and its inhibition results in apoptosis leading to hypertrophy and fibrosis of heart tissue. In our earlier investigations, we had demonstrated that the dysregulation of lipid metabolism occurs due to alterations in PPARγ and Klf4 to be one of the major pathological component in Adriamycin induced cardiomyopathy. And this dysregulation is also mimicked in diabetic cardiomyopathy.2224

Since Klf4 is one of the four pluripotent factors25 having role on differentiation of cells such as

goblet cells

26

and also proved to regulate embryogenesis through formation of hatching cells,27

we believed that Klf4 might play a protective role in heart in upon any insult. But studies show that Notch1 signaling plays an upstream regulation over Klf4 in goblet cells differentiation28 hence we deduced to explore in their role in heart cells in the presence of Adriamycin. Adriamycin induced the activation of protective Notch signaling at low dosages (below 0.5µM) and severely suppressed it on higher doses (above 0.5µM) in osteosarcoma cells.29 This led us to explore the effects of Adriamycin over Notch signaling in heart cells where it plays an indispensable role. We used H9c2 cardiomyoblast cells to study the cardiotoxic effect of Adriamycin because H9c2 cells are intriguing experimental alternative for primary cardiomyocytes and mimics the properties such


Page 4 of 41

Page 5 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


as responses to stress, energy metabolism patterns, mitochondrial morphology and its function, bioenergetics and metabolism etc,.30 Immortalized H9c2 cells can be similarly used to study the toxicity effect of Adriamycin as used to study ischemia reperfusion injury.31 Paeonol is a traditionally obtained medicinal compound extracted from radix of Paeonia suffruticosa. Paeonol has many therapeutic properties such as analgesic and anti-inflammatory, anti-oxidant and also used to prevent free radical formation.32 In this study Paeonol is used to activate Notch signaling which was already reported to be an efficient activator of Notch33 although the exact mechanism of its activation is not known completely. We used zebrafish model system as in vivo model in our study and is commonly used in toxicity studies for the analysis of various organ toxicity due to its genomic similarities to humans. Zebrafish have potential value for assessment of drug-induced cardiotoxicity.34 Adriamycininduced cardiomyopathy was established in zebrafish model using Adriamycin treatment with a minimum of 20µg per gram of zebrafish.35 The in vitro cell based findings are reliably echoed in zebrafish in vivo model. Thus the effect of Adriamycin on cardiac remodeling mechanism through modulation of Notch signaling is studied also using adult zebrafish heart. METHODS Cell Culture and Differentiation. H9c2 cells were purchased from National Center for Cell Science (NCCS; Pune, India). The cells were cultured using passage numbers between 25 to 33 and used them for differentiation as described previously.36 Prior to the experiment, cells were cultured in 10% DMEM for 24 hours followed by treatment with 10nM Al trans- Retinoic acid for 6 days, freshly supplemented each day. Differentiated cells were used for the experiments. Animals and Treatment. Wild isolates of zebrafish were obtained and maintained under the required condition of temperature about (26 ± 2°C) with photoperiod of 14 hour (light):10 hour



(dark) cycle and were fed thrice in a day with protein rich diet (micro pellets from Perfect Companion Group Co, Ltd). For the study we included only female fishes preferably. The Adriamycin concentration used for inducing cardiotoxicity was 20µg per gram of body weight which equals the amount required to induce cardiotoxicity in human beings of about 15mg/kg of body weight or 550mg/m2.35 The Paeonol concentration was determined from acute toxicity study according to OECD guidelines for 96 hours post intraperitoneal injection. Zebrafish were anesthetized using 0.16 mg/mL tricaine for a while and placed ventral side up on a wet sponge. Different concentrations 0, 250, 275, 300, 325µg per gram body weight of the fish were injected with 10 fishes in a group to analyze LD50 (Lethal dose) from which ED50 (Effective dose) was calculated to use for the further experiment. The 31G needle was used for injection using 20µl of the drug solution. The fishes were fasted for 12 hours prior to injection. Cell Viability Assay. To measure the viability, the H9c2 cells were cultured in 10% DMEM in the 96 well plate with 8000 cells per well cell density. Then the cells were differentiated for 5 days using 10nM Al trans- Retinoic acid with the medium changed every 24 hours. The treatments were carried out after the day 6 of differentiation. The treatments were done with respective doses individually and in combination as indicated in Figure 1. After the treatment the dye 3-(4, 5Dimethylthiazol-2-Yl)-2, 5-Diphenyltetrazolium Bromide (MTT) was used with a final concentration of 0.5mg/ml to assess the reducing capability of viable cells into formazan crystals. The DMSO was used to dissolve the crystals and the absorbance was measured at 570nm filter (Biotek ELISA reader). The cell viability was measured as previously described.37 RNA Isolation and Quantitative Real Time PCR. From cells and the dissected hearts RNA isolation was performed using RNAiso plus (Clontech) according to the manufacturer’s instruction. RNA was measured quantitatively using NanoDrop 2000 (Thermo Scientific™). Then


Page 6 of 41

Page 7 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1µg of RNA from each sample was converted to its complementary DNA using PrimeScript™ 1st strand cDNA Synthesis Kit (Clontech). The cDNA was diluted with a ratio of 1:4 and used for quantitative real-time PCR analysis on ABI StepOneTM (USA) using SYBR® Premix Ex Taq™ II (Clontech). β-actin and α-actin was used as housekeeping gene for rat and zebrafish respectively for normalization in the quantification of relative gene expression studies. The qRT-PCR was performed using SYBR green type of quantitation method. The 2 step PCR amplification was performed using following conditions: Initial denaturation at 95°C for 30 seconds followed by 40 cycles of denaturation at 95°C for 5 seconds combined with primer annealing and extension at 72°C for 35 seconds. The details of primers are given in the Table 1. The relative expression of genes was analyzed using the comparative CT method. Table 1. Primers sequence details used for quantitative RT- PCR for analyzing gene expression in H9c2 cells and Zebrafish S.No

Species

Primers

Forward Sequence 5’ to 3’

Reverse Sequence 5’ to 3’

1

Danio rerio

Actin

CGTGCTGCTTTCCCATCCA

TCACCAACGTAGCTGTCTTCTG

2

Danio rerio

Notch1a1

TGTCGGACTCAAGCCTTTG

CTGACGTGATCCAACTGAC

3

Danio rerio

Hey2

GAAGCGGAGAGGGATCATTG

CCAATGTCATCTGCAATATTTCC

4

Rattus

Actin B

ACCACCATGTACCCAGGCATT

CCACACAGAGTACTTGCGCTCA

Notch1

CTCACGCTGATGTCAATGCT

CGTTCTTCAGGAGCACAACA

Hes1

GGAGAGGCTGCCAAGGTTTT

GCAAATTGGCCGTCAGGA

Hey1

AAAGACGGAGAGGCATCATCG

GCAGTGTGCAGCATTTTCAGG

norvegicus 5

Rattus norvegicus

6

Rattus norvegicus

7

Rattus norvegicus



8

Rattus

Page 8 of 41

Klf4

CCCTTCGGTCATCAGTGTTAG

GGACGGCCTCTTGCTTAAT

Myh7

TGTGAAGGAGGACCAGGTGA

GCGTAGCGCTCCTTGAGATT

Myocardin

CTGTGTGGAGTCCTCAGGTCAA

GATGTGATGCGGGCTCTTCAG

norvegicus 9

Rattus norvegicus

10

Rattus norvegicus

11

Rattus

ACC TGFβ

AAGAAGTCACCCGCGTGCTA

TGTGTGATGTCTTTGGTTTTGTCA

norvegicus

Immunoblot Analysis. Treated cells were briefly rinsed with ice-cold PBS and then processed with ice-cold RIPA buffer supplemented with the protease inhibitor. Samples with 10 to 30µg were separated by 8-10% SDS-PAGE and transferred to the PVDF membranes. The transferred membranes were blocked using 5% skim milk in TBST for 1 hour at room temperature. The blocked membranes were incubated with primary antibodies: Notch1 antibody (1:1000), (Cell Signaling Technology®, USA (Cat no: D6F11) XP® Rabbit mAB); β-actin (C4) antibody (1:1000), (Santa Cruz, USA (Cat no: sc-47778) mouse monoclonal antibody) at 4°C overnight. The membranes were then washed with TBST thrice for 5 minutes each and incubated with secondary antibodies (1:5000 dilution) Anti-rabbit IgG HRP linked antibody for Notch1 (Cell Signaling Technology®, Cat no: #7074) and goat anti-Mouse IgG-HRP for β-actin (Genei, Cat no: 114068001A) for 1 hour at room temperature. Followed by washes with TBST thrice for 5 minutes each, then the blots were developed with enhanced chemiluminescence method. Images were analyzed using Image J software. Collagen Assay. The cells were cultured overnight and pretreated with Paeonol (1mM) for an hour followed by Adriamycin (0.5µM) treatment for 24 hours. Then the cells were briefly washed with PBS (pH 7.4) for twice on ice and then fixed with methanol for 15 minutes at 4°C followed


Page 9 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by staining with 0.1% Direct Red 80 (Sigma Aldrich®) prepared in saturated picric acid for an hour at room temperature. Then dye was removed and washed with acidified water for twice and then stained collagen samples were eluted using 0.1N NaOH.38 The unknown collagen content in the samples was estimated by using a standard curve of known collagen concentrations by reading the absorbance wavelength at 540nm in a microplate reader (Biotek ELISA reader). Cell Size Analysis. The cultured H9c2 cells in 24 well plate were pretreated with Paeonol 1mM for 1 hour and then with Adriamycin 0.5µM for 24 hours. After the treatment, the cells were trypsinized and washed with PBS (pH 7.4) by centrifugation at 300 × g for 5 minutes then the cells were fixed using 4% formaldehyde for 15 minutes on ice. The pellets were resuspended with 1ml of PBS after centrifugation. Then the cells were screened and recorded with forward scatter 39 and side scatter (SS)40 to analyze the relative size difference between the treatments (BD FACSCelestaTM). Caspase 3/7 Activity Assay. The caspase activity assay was based on the luminogenic substrate containing DEVD sequence. The assay was performed as per the instructions given in the kit (Promega). The H9c2 cells were seeded with an equal number of 20000 cells per well in 96 well plate (white walled plate). To the cultured cells Adriamycin was treated for 7 hours with or without pre-treatment with Paeonol 1mM for 1 hour, followed by the addition of caspase reagent (1:1 ratio) and incubated for 30 minutes. Then the luminescence was measured using luminescence microplate reader (Berthold Technologies) at the excitation wavelength of 499nm and emission wavelength at 521nm.41 Masson’s Trichrome Staining. The dissected heart tissues were fixed in 4% paraformaldehyde and embedded in paraffin. The embedded sections were cut and were subjected to Masson’s



trichrome staining. The vertical section images of heart were obtained from three individual fishes using inverted optical microscope (MagnusPro). Statistical Analysis. All the data are represented as mean ± SEM. Student's t-test and one way ANOVA were used for analysis. Post-test such as Dunnett's multiple comparison test was performed. P< 0.05 was considered to be statistically significant and is represented as nonsignificant for (P> 0.05),* for (P≤ 0.05), ** for (P≤ 0.01), *** for (P≤ 0.001) **** for (P≤ 0.0001). RESULTS Cell Viability Assay. The dose dependent effect of Adriamycin and Paeonol were determined using MTT assay in differentiated H9c2 cells. Adriamycin at 5µM concentration was used (viability 65%) for inducing remodeling markers (Figure 1A). Paeonol with range of concentrations was analyzed with cell viability assay (Figure 1B) from which 2.5mM concentration was chosen for combination treatment with Adriamycin through pre-treatment for an hour followed by Adriamycin treatment for the maximum duration of 24 hours (Figure 1C). Further experiments were carried out with Paeonol 2.5mM and lesser (optimized based on Notch induction) whereas Adriamycin was used with maximum dose of 5µM and to a lesser (optimized for inducing different markers of fibrosis, hypertrophy and apoptosis with clues from early reports).


Page 10 of 41

Page 11 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Cell viability determined by MTT assay. The respective drugs with represented concentrations were exposed followed by MTT reagent (0.5mg/ml) addition to the treated wells and incubated for 3 hours. The formazan crystals formed were dissolved using DMSO and it was read using absorbance wavelength at 570 nm (A) Adriamycin with 0-30µM exposed for 24 hours. Significance plot compared with that of control (B) Paeonol with 0-10mM exposed for 24 hours. Significance plot (Paeonol) compared with that of respective DMSO control (C) Pre-treatment using Paeonol (0.5 to 2.5mM for 1 hour followed by Adriamycin (5µM) for 24 hours. Significance **** P

Paeonol Reverses Adriamycin Induced Cardiac Pathological

Recommend Documents