Environ. Sci. Technol. 1996, 30, 307-311
PCR Detection of Polycyclic Aromatic Hydrocarbon-Degrading Mycobacteria RONG-FU WANG, ALLISON LUNEAU, WEI-WEN CAO, AND CARL E. CERNIGLIA* Microbiology Division, National Center for Toxicological Research, FDA, Jefferson, Arkansas 72079
Polymerase chain reaction (PCR) methods based on the 16S rRNA genes of Mycobacterium sp. PYR-1 and Mycobacterium sp. PAH135, known PAHdegrading bacteria, were developed. An efficient mycobacterial cell lysis procedure was used for the PCR assay. The PCR methods were positive with the target species, but negative for the other 45 bacterial species tested including other Mycobacterium spp. The PCR sensitivity for pure cultures was 20 cells for Mycobacterium sp. PAH135 and 200 cells for Mycobacterium sp. PYR-1. The PCR with a simple sample preparation procedure was used to monitor Mycobacterium sp. PYR-1 cell concentrations in soil slurries amended with [14C]pyrene. The pyrene mineralization correlated with the Mycobacterium PYR-1 cell concentrations in the soil slurries. When the PCR titer (the maximum dilution for positive PCR results) reached 10-4-10-5 at 5-10 days incubation, approximately 50% of the [14C]pyrene had been mineralized to 14CO2. However, without inoculation with Mycobacterium PYR-1 cells, both the sterile and nonsterile soils had negative PCR results and no pyrene mineralization.
Introduction Bioremediation technologies are being developed to clean up polycyclic aromatic hydrocarbon- (PAH) contaminated soils, because these chemicals are ubiquitous in urban areas and some are highly carcinogenic and genotoxic. The presence and distribution of PAH-degrading bacteria in soil have been well documented (1). Recent studies indicates that nocardioform actinomycetes, including Mycobacterium spp., may play an important role in the degradation of PAHs in soil (2-4). Indeed, several rapidly growing Mycobacterium spp. that efficiently metabolize PAHs have been isolated. Results from our laboratory have shown that Mycobacterium sp. PYR-1 can mineralize higher molecular weight PAHs such as fluoranthene, pyrene, 1-nitropyrene, phenanthrene, and benzo[a]pyrene (4-9). Similar results have been reported by others for Mycobacterium sp. PAH 135 (10). * Corresponding author telephone: 501-543-7341; fax: 501-5437307; e-mail address:
[email protected].
This article not subject to U.S. Copyright. Published 1995 by the American Chemical Society.
For further application of these mycobacterial strains as inoculants in bioremediation of PAH-contaminated sediments, we have determined the 16S rRNA gene sequences for both strains and identified them as new mycobacterial species (11). In this paper, we report the development of polymerase chain reaction (PCR) methods based on the 16S rRNA gene sequences to detect these mycobacteria in soil slurries for use in the metabolism of PAHs.
Experimental Section Bacterial Strains, Culture Medium, and Growth Conditions. A complete list of bacterial strains used in this study and their sources is given in Table 1. The Mycobacterium strains were cultured in Middlebrook 7H10 broth (Difco Laboratories, Detroit, MI). All other bacteria were cultured as described previously (12, 13). Oligonucleotide Primers. The PCR primers were designed based on our determinations of the 16S rRNA sequences of Mycobacterium sp. PYR-1 and PAH135 (11). The two sequences were aligned with the 16S rRNA sequences of 41 other Mycobacterium spp. available from GenBank by the computer program “ALIGN” (Scientific & Educational Software, State Line, PA). The GenBank program “BLAST” (14) was used to ensure that the proposed primers were complementary with the 16S rRNA of the target species but not the other species. The predicted PCR product from Mycobacterium sp. PYR-1 was 831 bp. The forward primer f-PYR was CACCCTTCTGGCTGCATGG (Genbank database numbering in X84977, bp138-156) and the reverse primer r-PYR was GGAATACCTATCTCTAGGCA (bp968-949). The predicted PCR product from Mycobacterium sp. PAH135 was 285 bp. The primer f-135 was CCGAATATGATCATGGCCTG (Genbank database numbering in X84978, bp131-150) and the primer r-135 was CTTGCGCTTCGTCCCTACT (bp415-397). The primers were synthesized by National Biosciences, Inc., Plymouth, MN. PCR Amplification. The bacterial cells from pure cultures were harvested, washed twice with phosphatebuffered saline (PBS), pH 7.4, and once with autoclaved distilled water (dH2O), and then resuspended in 0.1 mL of dH2O at 107 cells/µL as described previously (13). The samples were then diluted to the desired cell concentrations in 50-100 µL of 1% Triton X-100, except for the Mycobacterium cells, this is due to the more resistant cell walls of these species. The mycobacterial cells were diluted in TET buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, and 1% Triton X-100). The mycobacterial cell suspensions were subjected to 5 X (LN-boil) treatment, i.e., five cycles of 3-min freezing in liquid nitrogen and 1-min heating in a boiling water bath. This is a modification of the method described by Reischl et al. (15). The last boiling step was done for 3 min, and then it was immediately cooled in ice-water. The other bacterial (listed in Table 1) cell suspensions in 1% Triton X-100 were only boiled for 5 min. Sample (2 µL each) were directly subjected to the PCR assay without isolation of DNA as described previously (13). The PCR was conducted in an air-thermal cycler (Idaho Technology, Idaho Falls, ID). The amplification condition was one cycle of 94 °C for 15 s, then 35 cycles of 94 °C for 3 s , 50 °C for 10 s, and 74 °C for either 35 s for the PAH135 primer set (285 bp product)
VOL. 30, NO. 1, 1996 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
307
TABLE 1
Bacterial Strains and Results of PCR Assays PCR resultsb bacterial species
strain
sourcea
PYR
135
Mycobacterium sp. Mycobacterium sp. Mycobacterium sp. Mycobacterium vaccae Mycobacterium aurum Mycobacterium gilvum Mycobacterium sp. Mycobacterium sp. Mycobacterium africanum Mycobacterium bovis Mycobacterium chelonae Mycobacterium flavescens Mycobacterium fortuitum Mycobacterium gordonae Mycobacterium gastri Mycobacterium kansasii Mycobacterium microti Mycobacterium scrofulaceum Mycobacterium simiae Mycobacterium smegmatis Mycobacterium triviale Mycobacterium tuberculosis Pseudomonas aeruginosa Pseudomonas pseudoalcaligenes Pseudomonas putida Pseudomonas cepacia Clostridium clostridiiforme Bacteroides vulgatus Bifidobacterium adolescentis Bacillus subtilis Citrobacter freundii Salmonella typhimurium Staphylococcus aureus Enterococcus faecalis Lactobacillus acidophilus Eubacterium lentum Fusobacterium prausnitzii Peptostreptococcus anaerobius Actinomyces naeslundii Propionibacterium acnes Klebsiella pneumoniae Shigella flexneri Corynebacterium kutscheri Streptococcus equi Yersinia enterocolitica Proteus mirabilis Escherichia coli
PYR-1 PYR-1,(DSM 7251)c PAH135 JOB 5 ATCC 23366 Karlsruhe ANT-GCK PYR-GCK ATCC 35711 ATCC 19210 TMC 1543 TMC 1541 TMC 1547 TMC 1318 TMC 1456 TMC 1204 ATCC 19422 TMC 1302 ATCC 25275 ATCC 607 ATCC 23292 H37RV ATCC 27853 ATCC 49536 G7 ATCC 25416 ATCC 25537 ATCC 8482 ATCC 15703 ATCC 6051 ATCC 8090 ATCC 14028 ATCC 25923 ATCC 19433 ATCC 332 ATCC 25559 ATCC 27768 ATCC 27337 ATCC 12104 ATCC 6919 ATCC 13883 ATCC 12022 ATCC 15677 ATCC 9528 ATCC 27729 ATCC 7002 ATCC 25922
NCTR d e f ATCC g NCTR NCTR ATCC ATCC h h h h h h ATCC h ATCC ATCC ATCC ATCC ATCC ATCC i ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC
+ + -
+ -
a Source: NCTR, National Center for Toxicological Research; d, from German collection; e, from Dr. D. Warshawsky at University of Cincinnati; f, from Dr. J. J. Perry at North Carolina State University; g, from Dr. W. G. Zumft at University of Karlsruhe, Germany; h, from Dr. Don Cave at University of Arkansas, Medical Science, Little Rock; i, from Dr. David T. Gibson, University of Iowa. b PCR results: PYR, PCR for PYR-1; 135, PCR for PAH135; +, positive; -, negative. Some bacteria had some nonspecific bands, but the products' sizes were different from the correct PCR products. c DSM 7251 is Mycobacterium sp. PYR-1, which was sent to Germany, and a new designation was given.
or 50 s for the PYR-1 primer set (831 bp product) at the transition speed S-9, and finally one cycle of 74 °C for 2 min and 45 °C for 2 s. The PCR products (6-10 µL of each) were separated by electrophoresis in agarose gels containing ethidium bromide (1 µg/mL). PCR Products Confirmation by a Restriction Enzyme (EcoRI) Digestion. The PCR product from Mycobacterium sp. PYR-1 is a 831-bp DNA fragment that contains only one site for the EcoRI digestion at bp 476-481 with sequence GAATTC. After the EcoRI digestion, one DNA fragment should be 476 bp with four base overhang; the second DNA fragment should be 351 bp with four base overhang. Digestion procedure: The PCR product (10 µL) was directly added to 1 µL of EcoRI (12 unit) without adding any buffer, incubated at 37 °C for 2 h, and then separated in a 2-3% agarose gel.
308
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 30, NO. 1, 1996
PCR Detection of Mycobacterium sp. PYR-1 in Soil Slurries and Comparison with PAH Mineralization. Soil which had a loamy sand texture (pH 6.5) was collected from an uncontaminated garden site located in Little Rock, AR, and used for this study. The total numbers of heterotrophic bacteria was 7 × 106 cells/g of soil, which was determined by standard plate count. Part of the soil was autoclaved twice for sterile soil experiments, and the un-autoclaved part was used for the nonsterile soil experiments. The experiments were conducted in 250-mL biometer flasks (Bellco Glass, Inc., Vineland, NJ), each containing 40-mL of minimal basal salts (MBS) broth with nutrients (3, 4) and 10 g of soil. The sidearm of each flask contained 15 mL of CO2 trapping solution (70% ethylene glycol/30% monoethanolamine). Four sets of biometer flasks were set up for each time point: (1) sterile soil plus
TABLE 2
Comparison of Different Lysis Procedures for Mycobacterial Cells buffera
treatmentb
Mycobacterium sp. PAH135 dilutionc PCR resultsd Mycobacterium sp. PYR-1 dilutionc PCR resultsd
H2O
T
TE
TET
T
TET
boil 5 min
boil 5 min
boil 5 min
boil 5 min
5 X (LN-Boil)
5 X (LN-Boil)
10-2 -
10-4 -
10-2 ++
10-4 -
10-2 ++
10-4 -
10-2 ++
10-4 +
10-2 ++
10-4 -
10-2 +++
10-4 ++
10-6 +
10-1 -
10-3 -
10-1 ++
10-3 -
10-1 ++
10-3 -
10-1 ++
10-3 +
10-1 ++
10-3 (
10-1 +++
10-3 ++
10-5 +
a Buffer: H O, autoclaved distilled water; T, 1% Triton X-100 in H O; TE, 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA; TET, 1% Triton X-100 plus TE 2 2 buffer. b Treatment procedures: (1) boil 5 min, boiling 5-min in a boiling water bath; (2) 5 X (LN-boil), five cycles of 3-min freezing in liquid nitrogen and 1-min heating in a boiling water bath. The last boiling was 3-min, as described in Methods Section. c The original cell concentration for both PYR-1 and PAH135 was 107 cells/µL, thus the dilution at 10-6 had a cell concentration of 10 cells/µL, and the test tube contained 20 cells (2-µL sample for PCR test). d PCR results: -, negative; (, weak positive; +, positive; ++, stronger positive, +++, strongest positive.
109 cells of Mycobacterium sp. PYR-1, (2) nonsterile soil plus 109 cells of Mycobacterium sp. PYR-1, (3) nonsterile soil without inoculation of Mycobacterium sp. PYR-1 cells, (4) sterile soil without inoculation of Mycobacterium sp. PYR-1 cells. Each flask was dosed with 100 µg of unlabeled pyrene in 10 µL of N,N-dimethylformamide (DMF) and 0.5 µCi of [14C]pyrene (specific activity 55 mCi/mmol) in 15 µL of DMF. Pure cultures of Mycobacterium sp. PYR-1 were grown at 25 °C in MBS broth containing organic nutrients and pyrene (4, 5). The cultures were allowed to grow for 6 days. The cells were collected by centrifugation, washed twice with PBS and once with MBS broth, and then were resuspended to 109 cells/mL in MBS broth for inoculation. The cell numbers were determined by direct microscopic count as described previously (13). The experimental flasks were incubated on a rotary shaker (80 rpm) at 25 °C for 17 days. Flasks were sampled at various time intervals for the PCR and PAH mineralization analysis. To determine the mineralization of pyrene to 14CO2, duplicate 1.0-mL samples were removed from the sidearm of the flasks at designated intervals. Fifteen milliliters of Ultima Gold (Packard Instrument Company, Meriden, CT) was added to each sample, mixed well, and counted for 2 min in a scintillation counter. For PCR, 1.5 mL of each sample was removed from the flask and placed into an Eppendorf tube. The samples were centrifuged at 200g for 5 min to remove the soil particles. This step was repeated three times. After the last centrifugation, 1 mL of the upper phase from each tube was saved and further centrifuged at 8500g to obtain the cells. The cell pellets were washed three times with PBS and once with water and then resuspended in 0.1 mL of water. The samples were diluted to 10-1, 10-2, 10-3, 10-4, and 10-5 in 50 µL of TET buffer and treated by 5 X (LN-boil) as described above. Two microliters of each treated sample was directly subjected to the PCR assay without isolation of the DNA.
Results Initially, a conventional cell lysis procedure that worked well for a wide phylogenetic spectrum of bacteria and viruses (13, 16-20), i.e., boiling the samples in 1% Triton X-100, was used for the PCR assays with Mycobacterium sp. PYR-1 and Mycobacterium sp. PAH135 but lower sensitivity was observed. This is probably due to the lipopolysacchariderich mycobacterial cell wall, which is extremely difficult to disrupt. Thus, several cell lysis procedures were compared (Table 2). The 5 X (LN-boil) procedure (i.e., treating the
FIGURE 1. PCR products in agarose gel. (A) PCR sensitivity test for Mycobacterium sp. PYR-1 in pure culture. (B) Confirmation by EcoRI digestion. Lane m, DNA size markers (sizes are shown at the left). Number of Mycobacterium sp. PYR-1 cells are as follows: lane 1, 2 × 106; lane 2, 2 × 105; lane 3, 2 × 104; lane 4, 2 × 103; lane 5, 2 × 102; lane 6, 20; lane 7, 4; lane 8, PCR product without EcoRI digestion; lane 9, EcoRI digestion of the PCR product.
cells in TET buffer for five cycles of 3-min freezing in liquid nitrogen and 1-min heating in a boiling water bath) was the best method for releasing and denaturing the DNA from the mycobacterial cells to perform the PCR assay without DNA isolation. Using this method, 20 cells of Mycobacterium sp. PAH135 (at 10-6 dilution, Table 2) and 200 cells of Mycobacterium sp. PYR-1 (at 10-5 dilution, Table 2) were detected. The reason for the sensitivity difference is probably due to the size difference of the PCR products for Mycobacterium sp. PYR-1 (831 bp) and Mycobacterium sp. PAH135 (285 bp). Panel A of Figure 1 also shows the results of the PCR sensitivity test for Mycobacterium sp. PYR-1 in pure culture. Lanes 1-5 are positive, which indicates that as few as 200 cells (lane 5) of Mycobacterium sp. PYR-1 in pure culture are detectable by this PCR method. Panel B of Figure 1 shows the results of PCR confirmation by a restriction enzyme EcoRI digestion. Lane 8 is the 831-bp PCR product without EcoRI digestion. Lane 9 shows the EcoRI digestion results. After the EcoRI digestion, one DNA fragment should be 476 bp with four base overhang; the second DNA fragment should be 351 bp with four base overhang. One can see two DNA bands in the agarose gel: one band is close to the 500-bp DNA size marker (lane M); another band is under the 400 bp. A weak band on the 831 bp
VOL. 30, NO. 1, 1996 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
309
FIGURE 3. Comparison of pyrene mineralization and PCR titers of Mycobacterium sp. PYR-1 in soil slurries (the maximum dilutions for the positive PCR results). A, pyrene mineralization, solid lines; B, PCR titers, open lines; 1, sterile soil plus Mycobacterium sp. PYR-1; 2, nonsterile soil plus Mycobacterium sp. PYR-1; 3, nonsterile soil without inoculating Mycobacterium sp. PYR-1; 4, sterile soil without inoculating Mycobacterium sp. PYR-1.
FIGURE 2. PCR specificity test. PCR products (831 bp) were separated in 1% agarose gel containing ethidium bromide. Lane m, DNA size markers (sizes are shown at the left); lane 1, Mycobacterium sp. PYR-1; lanes 2-16, M. africanum ATCC 35711, M. bovis ATCC 19210, M. chelonae TMC 1543, M. flavescens TMC 1541, M. fortuitum TMC 1547, M. gordonae TMC 1318, M. gastri TMC 1456, M. kansasii TMC 1204, M. microti ATCC 19422, M. scrofulaceum TMC 1302, M. simiae ATCC 25275, M. smegmatis ATCC 607, M. triviale ATCC 23292, M. tuberculosis H37RV, and Mycobacterium sp. ANT-GCK, respectively; lane 17; Mycobacterium sp. DSM 7251 (PYR-1 was sent to German culture collection and they gave it another strain designation); lanes 18-22, M. vaccae JOB 5, M. aurum ATCC 23366, M. gilvum karlsruhe, Mycobacterium sp. PYR-GCK, and Mycobacterium sp. PAH135, respectively. shows a small amount of the undigested PCR products. These results confirm that this PCR method is correct. Figure 2 shows the PCR products in agarose gel for the PCR specificity test for Mycobacterium sp. PYR-1. The designed primer set (f-PYR + r-PYR) was only positive with the target species, Mycobacterium sp. PYR-1 (lanes 1 and 17), but negative with 20 other species of Mycobacterium (lanes 2-16 and 18-21). Lanes 1 and 17 are the same strains Mycobacterium sp. PYR-1. We sent our strain to the Germany culture collection, they gave Mycobacterium sp. PYR-1 a new strain name as Mycobacterium sp. DSM 7251. Use of the two strains for PCR positive control confirmed that the strains did not change, and the PCR method is specific. The PCR product size was the same as predicted, 831 bp. Only one species, M. flavescens (lane 5 in Figure 2), had a nonspecific band, but the size of the PCR product was different from 831 bp. The results of the PCR specificity test for the two PCR methods are given in Table 1. Both PCR methods were positive only with the target species and negative with 45 other bacterial species tested including other Mycobacterium sp. Some bacterial species produced some nonspecific bands, but the sizes of the products were different from the correct PCR products (831 and 285 bp, respectively). The PCR method was used to quantitatively detect the Mycobacterium sp. PYR-1 cell concentration in the experi-
310
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 30, NO. 1, 1996
ments in which this organism was inoculated into a soil slurry amended with the high molecular weight PAH, pyrene. Figure 3 shows the correlation between the pyrene mineralization and the PCR titers (the maximum dilutions for positive PCR results) for Mycobacterium sp. PYR-1 in soil slurries. Without the addition of PYR-1 cells, both the nonsterile and sterile soil had negative PCR results (B-3 and B-4 in Figure 3), and there was almost no pyrene mineralization in those controls (A-3 and A-4 in Figure 3). However, when Mycobacterium sp. PYR-1 cells were added to the soil slurry, the pyrene mineralization correlated with PYR-1 cell concentration. When the PCR titer reached to 10-4-10-5 (B-1 and B-2 in Figure 3) at 5-10 days incubation, approximately 50% of the pyrene was mineralized to 14CO2 (A-1 and A-2 in Figure 3). At 17-days incubation, the PCR titer decreased to 10-2-10-3, and further pyrene mineralization was not observed.
Discussion In this paper, we report the quantitative detection of PAHdegrading mycobacteria by PCR. This technology has potential application in the study of the microbial ecology of soil remediation. We also describe a simple procedure to remove the PCR-interfering materials from soil, an improved cell lysis procedure, and the introduction of direct PCR on cells without lengthy DNA purification. Most PCR methods for detection or identification of Mycobacterium spp. require DNA isolation procedures, which involve enzymatic treatment and the use of phenol/chloroform (21-23). Soils and sediments contain many compounds, such as humic acids and mineral constituents, that could inhibit PCR analysis (24, 25). PCR detection of bacteria in soil usually requires DNA purification. For example, Herrick et al. (25) indicated that several attempts at direct PCR amplification of a gene from a sediment were unsuccessful. Thus, they developed a procedure to purify DNA for the PCR assay, which included lysozyme-SDS-freeze-thawethanol precipitate-agarose gel containing poly(vinyl pyrrolidone) to aid in the separation of humic compounds from nucleic acids. In contrast, the procedure reported in this study was very simple and efficient. The centrifugation and washing steps were enough to remove the humic compounds and mineral constituents. After cell lysis, the resulting materials did not interfere with the PCR assays.
The PCR titer (the maximum dilution for the positive PCR results) in the inoculated sterile soil slurry at 10-days incubation reached to 10-5 (Figure 3), which is equivelent to 109/mL of cells (105 × 200 cells/2 µL × 1000 µL/10). At 17 days, the PCR titer decreased to 10-2-10-3, which suggested that the Mycobacterium PYR-1 cells were in a die-off phase and the DNA from the dead cells was probably digested by the indigenous microflora in the soil or by the active Mycobacterium PYR-1 cells in the sterile soil experiments. In conclusion, PCR methods specific for two species of PAH-degrading Mycobacterium were developed. The PCR method reported in this study is a very effective technique in monitoring the PAH-degrading Mycobacterium PYR-1 in the bioremediation of PAH-contaminated soil. The PAH mineralization was correlated with the mycobacterial cell concentration in the soil slurry.
Acknowledgments This research was supported in part by appointments (for W.-W.C.) to the Postgraduate Research Program at the National Center for Toxicological Research (NCTR) administered by the Oak Ridge Institute for Science and Education through an interagency agreement between the U.S. Department of Energy and the U.S. Food and Drug Administration. We thank Dr. Don Cave at University of Arkansas, Medical Science Campus, Little Rock, AR, for culturing and providing 13 Mycobacterium species. We appreciate David Warshawsky at University of Cincinnati for kindly providing the Mycobacterium sp. PAH135. We also appreciate Wirt Franklin in the Microbiology Division, NCTR, for helping to culture many bacterial strains.
Literature Cited (1) Cerniglia, C. E. Cur. Opin. Biotechnol. 1993, 4, 331. (2) Kastner, M.; Breuer-Jammali, M.; Mahro, B. Appl. Microbiol. Biotechnol. 1994, 41, 267. (3) Boldrin, B.; Tiehm, A.; Fritzsche. C. Appl. Environ. Microbiol. 1993, 59, 1927. (4) Heitkamp, M. A.; Franklin, W.; Cerniglia C. E. Appl. Environ. Microbiol. 1988, 54, 2549.
(5) Heitkamp, M. A.; Cerniglia, C. E. Appl. Environ. Microbiol. 1988, 54, 1612. (6) Heitkamp, M. A.; Cerniglia, C. E. Appl. Environ. Microbiol. 1989, 55, 1968. (7) Kelley, I.; Cerniglia, C. E. J. Soil Contam. 1995, 4, 77. (8) Kelley, I.; Freeman, J. P.; Evans, F. E.; Cerniglia, C. E. Appl. Environ. Microbiol. 1991, 57, 636. (9) Rafii, F.; Selby, A. L.; Newton, R. K.; Cerniglia, C. E. Appl. Environ. Microbiol. 1994, 60, 4263. (10) Grosser, R. J.; Warshawsky, D.; Vestal, J. R. Appl. Environ. Microbiol. 1991, 57, 3462. (11) Wang, R.-F.; Cao, W.-W.; Cerniglia, C. E. FEMS Microbiol. Lett. 1995, 130, 75. (12) Wang, R.-F.; Cao, W.-W.; Johnson, M. G. Appl. Environ. Microbiol. 1991, 57, 3666. (13) Wang, R.-F.; Cao, W.-W.; Franklin, W.; Campbell, W.; Cerniglia, C. E. Mol. Cell. Probes 1994, 8, 131. (14) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. J. Mol. Biol. 1990, 215, 403. (15) Reischl, U.; Pulz, M.; Ehret, W.; Wolf, H. BioTechniques 1994, 17, 844. (16) Wang, R.-F.; Cao, W.-W.; Johnson, M. G. Appl. Environ. Microbiol. 1992, 58, 2827. (17) Wang, R.-F.; Slavik, M. F.; Cao, W.-W. J. Rapid Methods Autom. Microbiol. 1992, 1, 101. (18) Wang, R.-F.; Cao, W.-W.; Johnson, M. G. FEMS Microbiol. Lett. 1993, 106, 85. (19) Wang, R.-F.; Beasley, J. N; Cao, W.-W.; Slavik, M. F.; Johnson, M. G. Mol. Cell. Probes 1993, 7, 127. (20) Wang, R.-F.; Cao, W.-W.; Campbell, W. L.; Hairston, L.; Franklin, W.; Cerniglia, C. E.. FEMS Microbiol. Lett. 1994, 124, 229. (21) Cousins, D. V.; Wilton, S. D.; Francis, B. R.; Gow, B. L. J. Clin. Microbiol. 1992, 30, 255. (22) Miyazaki, Y.; Koga, H.; Kohno, S.; Kaku, M. J. Clin. Microbiol. 1993, 31, 2228. (23) Takewaki, S. I.; Okuzumi, K.; Ishiko, H.; Nakahara, K. I.; Ohkubo, A.; Nagai, R. J. Clin. Microbiol. 1993, 31, 446. (24) Tsai, Y.-L.; Olson, B. H. Appl. Environ. Microbiol. 1992, 58, 2292. (25) Herrick, J. B.; Madsen, E. L.; Batt, C. A.; Ghiorse, W. C. Appl. Environ. Microbiol. 1993, 59, 687.
Received for review June 6, 1995. Revised manuscript received August 16, 1995. Accepted August 16, 1995.X ES950388B X
Abstract published in Advance ACS Abstracts, November 1, 1995.
VOL. 30, NO. 1, 1996 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
311
