This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes.
Article pubs.acs.org/JAFC
Cite This: J. Agric. Food Chem. 2019, 67, 6232−6240
Combination of Capsaicin and Capsiate Induces Browning in 3T3-L1 White Adipocytes via Activation of the Peroxisome ProliferatorActivated Receptor γ/β3‑Adrenergic Receptor Signaling Pathways Li Fan,†,‡ Haiyan Xu,†,‡ Rengui Yang,§ Yufan Zang,‡ Jingfang Chen,§ and Hong Qin*,‡ ‡
Downloaded via 91.200.82.106 on July 20, 2019 at 12:50:00 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
Department of Nutrition Science and Food Hygiene, Xiangya School of Public Health, Central South University, 110 Xiangya Road, Changsha, Hunan 410078, People’s Republic of China § Changsha Center for Disease Control and Prevention, Changsha, Hunan 410004, People’s Republic of China ABSTRACT: This study investigated the effects and molecular mechanism of a combination of capsaicin and capsiate on promoting lipid metabolism and inducing browning in 3T3-L1 white adipocytes. The combination significantly suppressed lipid accumulation in adipocytes (p = 0.019) and robustly improved lipid metabolic profiles, including decreased triacylglycerol (0.6703 ± 0.0385 versus 0.2849 ± 0.0188 mmol/g of protein; p < 0.001), total cholesterol (0.1282 ± 0.0241 versus 0.0651 ± 0.0178 mmol/g of protein; p = 0.003), and low-density lipoprotein cholesterol (0.0021 ± 0.0017 versus 0.0005 ± 0.0002 mmol/g of protein; p = 0.024) and increased high-density lipoprotein cholesterol (0.0162 ± 0.0141 versus 0.1002 ± 0.0167 mmol/g of protein; p = 0.012). Furthermore, this combination markedly upgraded the protein levels of cluster of differentiation 36 (p = 0.007) and adipose triglyceride lipase (p = 0.013) and phosphorylation of hormone-sensitive lipase at Ser660, Ser565, and Ser563 (p < 0.001, p = 0.027, and p = 0.002, respectively), indicating increases of fatty acid transport and lipolysis. The levels of lipid metabolism regulators, phosphorylation of adenosine-monophosphate-activated protein kinases α and β (p = 0.011, and p < 0.001, respectively), sirtuin 1 (p = 0.004), and vanilloid transient receptor subtype I (p = 0.014) were also increased by the combination. Moreover, the combination greatly activated the browning program in adipocytes, as demonstrated by increases in beige-specific gene and protein. Further research found that the protein levels of peroxisome proliferator-activated receptor γ (PPARγ; p = 0.001) and β3-adrenergic receptor (β3-AR; p = 0.026) were elevated by the combination, and most of the beige-specific markers were abolished by pretreatment of antagonists of PPARγ or β3-AR. In conclusion, these results indicated that a combination of capsaicin and capsiate could induce browning in white adipocytes via activation of the PPARγ/β3-AR signaling pathway, and this combination might be worth investigating as a potential cure for obesity. KEYWORDS: capsaicin, capsiate, combination, lipid metabolism, browning
■
the browning program in WAT.16−18 Capsaicin and capsiate are derived from hot red peppers and sweet pepper fruit (CH19 Sweet), respectively, and they have similar chemical structures.19 The latest research showed that capsaicin inhibits adipogenesis via PPARγ activation and induces “beige” phenotype in 3T3-L1 cells.20 However, its pungency and propensity for eliciting gastrointestinal side effects limited its use in clinical trials. In comparison to capsaicin, capsiate has less pungent irritancy, while it showed similar or even more effective biological activity, such as improving insulin sensitivity, lipid and glucose metabolism, etc.21,22 There were also studies showing that capsiate reducing body fat in humans was associated with activating brown fat thermogenesis.18 However, the use and popularity of capsiate is not feasible as a result of its high cost and complicated extraction process. The current studies found that quite a few factors combining with capsiate or capsaicin could be more effective than them alone in promoting energy consumption and weight loss, such
INTRODUCTION The globally increasing prevalence of obesity and its associated metabolic syndrome draws great attention to the need for developing effective strategies for obesity treatment. In recent years, an increasing number of reports have shown that promoting brown adipose tissue (BAT)-like function in white adipose tissue (WAT) has therapeutic potential to combat obesity.1−3 The “brown-like” cell within WAT has been called beige adipocyte. The beige adipocyte is characterized as high expression levels of uncoupling protein 1 (UCP1) gene and protein, which let it show the similar function of brown adipocyte in increasing thermogenesis and energy consumption.4,5 Beige adipocytes emerge within the WAT in response to certain environmental cues, such as exercise, chronic cold exposure, peroxisome proliferator-activated receptor γ (PPARγ) agonists, and β-adrenergic receptor (β-AR) agonists.6−9 Induction of the “beige” phenotype using various dietary compounds is emerging as an alternative strategy to increase energy expenditure and obesity treatment.10,11 Evidence has shown that some food agents that naturally occur in peppers seem to be promising candidates to target different medicinal strategies in the treatment of obesity;12−15 even more, some of them have the potential ability to promote © 2019 American Chemical Society
Received: Revised: Accepted: Published: 6232
April 8, 2019 May 8, 2019 May 10, 2019 May 10, 2019 DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
Article
Journal of Agricultural and Food Chemistry as cold exposure, exercise, or some natural compounds.23−25 On the basis of the above, we surmised whether capsaicin combining with capsiate could exert synergistic effects in promoting lipid metabolism and browning of WAT. We therefore compared the effects of the combination of capsaicin and capsiate to each of them alone on lipid metabolism regulation and browning promotion in 3T3-L1 white adipocytes and investigated the underlying mechanism.
■
Inc., Winooski, VT, U.S.A.). Six replicate wells were used for each data point in the experiment. Lipid Content Assays. Intracellular lipid accumulation was quantified by staining with oil red O. The mature cells treated with capsaicin and/or capsiate for 48 h were washed twice with phosphatebuffered saline (PBS), fixed with 4% paraformaldehyde for 10 min, and stained with oil red O working solution for 30 min. After the staining solution was removed, the cells were washed with 60% isopropanol and distilled water. The stained lipid droplets were visualized by an inverted microscope. The stained lipid droplets were dissolved in isopropanol and quantified for absorbance (540 nm) measurement. The levels of TG, TC, LDL-C, and HDL-C were measured by commercially available kits. Western Blot Analysis. The mature cells treated with capsaicin and/or capsiate for 48 h were harvested with radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitors. Protein contents were determined by an ultramicro spectrophotometer. Then, the proteins (40 μg) were separated by 8 or 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS−PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. After the membranes were blocked with 5% skim milk or 3% bovine serum albumin (BSA) in Tris-buffered saline and Tween 20 (TBST) at room temperature for 1 h, they were incubated with primary antibody overnight at 4 °C specific to TRPV1 (1:1000), β3-AR (1:1000), CD36 (1:1000), ATGL (1:1000), HSL (1:1000), pHSL-Ser660 (1:1000), pHSL-Ser565 (1:1000), pHSL-Ser563 (1:1000), UCP1 (1:1000), PPARγ (1:1000), SIRT1 (1:10000), PGC-1α (1:10000), AMPKα (1:1000), pAMPKα (1:1000), AMPKβ1/2 (1:1000), pAMPKβ1 (1:1000), and PRDM16 (1:1000). Membranes were washed in TBST and then incubated with the goat anti-rabbit IgG antibody (1:6000) for 1 h at room temperature. The signal was detected using the chemiluminescence imager (Tanon-5500, Tanon Science & Technology Co., Ltd., Shanghai, China). The relative expression of proteins was quantified by Tanon Gis software and calculated according to the reference bands of β-actin (1:300 000). The data represented for the western blot analyses represent repetitions of the experiments using biologically different samples (n = 3). Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR). Total RNA was isolated from mature cells treated with capsaicin and/or capsiate for 48 h using a PureLink RNA Mini Kit purchased from Thermo Fisher Scientific (Waltham, MA, U.S.A.). RNA (1 μg) was converted to cDNA using HiScriptIIQ RT SuperMix for quantitative polymerase chain reaction (qPCR, Vazyme, Nanjing, China). ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) was employed to quantitatively determine transcription levels of genes with RT-PCR (LightCycler 480 II, Roche). The cycling conditions were as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The melting curve was also analyzed to ensure that only a single product was amplified, and the conditions were as follows: 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. PCR reactions were run in triplicate for each sample, and relative mRNA expression levels were calculated after normalization of values to that of β-actin. Sequences of primer sets used in this study are listed in Table 1. Statistical Analysis. All analyses were performed with SPSS 18.0 software (SPSS, Inc., Chicago, IL, U.S.A.). The data were expressed as the mean ± standard deviation (SD). Differences among groups were calculated by one-way analysis of variance (ANOVA) or independent sample t test (two groups). Values of p < 0.050 were considered to be statistically significant and are presented as (∗) p < 0.050, (∗∗) p < 0.010, or (∗∗∗) p < 0.001.
MATERIALS AND METHODS
Chemicals. Capsaicin (97% pure), capsiate (97.3% pure), insulin, dexamethasone, 3-isobutyl-1-methylxanthine (IBMX), and SR 59230A [a kind of β3-adrenergic receptor (β3-AR) antagonist] were purchased from Sigma-Aldrich (St. Louis, MO, U.S.A.). T0070907 (a kind of PPARγ antagonist) was purchased from MedChem Express (Monmouth Junction, NJ, U.S.A.). 3T3-L1 cells were obtained from the Peking Union Cell Center (Beijing, China). Triacylglycerol (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) kits were obtained from Jiancheng Bioengineering Institute (Nanjing, China). The goat anti-rabbit immunoglobulin G (IgG) antibody combined with horseradish peroxidase and the 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) assay kit were purchased from Ding Guo Changsheng Biotechnology Co., Ltd. (Beijing, China). Oil red O was purchased from Solarbio Science & Technology Co., Ltd. (Beijing, China). Antibodies against hormone-sensitive lipase (HSL, A15686), phosphorylated HSL at Ser563 (pHSL-Ser563, AP0851), pHSL at Ser565 (pHSL-Ser565, AP0852), pHSL at Ser660 (pHSLSer660, AP0853), sirtuin 1 (SIRT1, A0230), adipose triglyceride lipase (ATGL, A6245), cluster of differentiation 36 (CD36, A1470), peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α, A12348), PR domain containing 16 (PRDM16, A11581), vanilloid transient receptor subtype I (TRPV1, A8564), β3-AR (A8607), and βactin (AC026) were purchased from ABclonal (Boston, MA, U.S.A.). Antibodies against UCP1 (14670S), PPARγ (2443S), adenosine monophosphate (AMP)-activated protein kinase α (AMPKα, 5831), AMP-activated protein kinase β1/2 (AMPKβ1/2, 4150), phosphorylated AMPKα (pAMPKα, 2535), and phosphorylated AMPKβ1 (pAMPKβ1, 4181) were purchased from Cell Signaling Technology, Inc. (Boston, MA, U.S.A.). Cell Culture and Differentiation. 3T3-L1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/v) newborn calf serum and 1% penicillin−streptomycin solution at 37 °C under a 5% CO2 atmosphere. Differentiation was induced in confluent cells by replacing newborn calf serum with fetal bovine serum. Confluent cells were maintained in differentiation induction medium consisting of 8 μg/mL insulin, 1 μM dexamethasone, and 0.5 mM IBMX in DMEM. After 48 h, cells were switched to the second differentiation medium consisting of 8 μg/mL insulin only for another 48 h. Then, cells were switched to maintenance medium for another 72 h, with the medium replaced every 36 h until mature adipocytes formed. The mature adipocytes were treated with capsaicin (50 μM), capsiate (50 μM), or a combination of capsaicin (25 μM) and capsiate (25 μM) for 48 h. Then, the cells were collected for further detection. In the experiments with the PPARγ and β3-AR antagonists, 3T3-L1 white adipocytes were pretreated with 10 μM T0070907 or 10 μM SR 59230A for 2 h prior to the combination of capsaicin and capsiate treatment. Cell Viability Assay. Pre-adipocytes were seeded in a 96-well plate at a density of 5.0 × 103 cells/well and incubated until mature adipocytes formed, as described above. Then, cells were treated with different concentrations of capsaicin (25, 50, and 100 μM), capsiate (25, 50, and 100 μM), or the combination of capsaicin and capsiate (12.5:12.5, 25:25, and 50:50 μM) for 48 h. At the end of the incubation, 20 μL of MTT solution was added to each well and the cells were further incubated for 4 h. Then, those media were removed, and 150 μL of dimethyl sulfoxide (DMSO) was added for 10 min with shaking to resuspend the cells. Absorbance was measured at 570 nm by a microplate reader (Power Wave XS2, BioTek Instruments,
■
RESULTS Effects of Capsaicin and Capsiate on Viability of 3T3L1 White Adipocytes. The cytotoxic effects of capsaicin and capsiate on 3T3-L1 cells were determined using the MTT assay at different doses. There were no significant decreases in viability at the tested concentrations (Figure 1). On the basis 6233
DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
Article
Journal of Agricultural and Food Chemistry
Effects of Capsaicin and Capsiate on Lipid Accumulation in 3T3-L1 White Adipocytes. In comparison to the control group, the combination treatment led to a decrease in the lipid droplets in 3T3-L1 cells. While the capsaicin and capsiate treatment only induced a tendency in reducing lipid accumulation (panels A and B of Figure 2). The results indicated that the combination of capsaicin and capsiate could effectively reduce the level of lipid accumulation in 3T3-L1 cells. Effects of Capsaicin and Capsiate on TG, TC, LDL-C, and HDL-C Contents in 3T3-L1 White Adipocytes. The TG and LDL-C contents were decreased only in cells treated with the combination, and the TC content was markedly decreased in cells treated with capsaicin and the combination. Meanwhile, in comparison to the control group, the level of HDL-C in cells treated with the combination was increased markedly (Figure 2C). These findings suggested that the combination of capsaicin and capsiate improved the lipid metabolic profiles in 3T3-L1 cells, which was much superior to capsaicin and capsiate alone. Effects of Capsaicin and Capsiate on the Expressions of Lipid-Metabolism-Related Proteins in 3T3-L1 White Adipocytes. To determine how the combination improved lipid metabolism, we measured the protein levels of CD36, ATGL, and HSL and phosphorylation of HSL, which are essential for fatty acid transport and lipolysis, respectively. The treatment with capsiate and the combination markedly increased the level of CD36 to upregulate the fatty acid transport. In the meantime, the treatment with the combination increased the level of ATGL. In comparison to the control group, the capsiate-treated group showed the marked increase in the phosphorylation of HSL at Ser660 and Ser563 and the combination-treated group showed the more significant increase in not only the phosphorylation of HSL at Ser660 and Ser563 but also at Ser565. Furthermore, the combination treatment showed a significant increase in phosphorylation of HSL at Ser660 compared to the capsiate treatment (Figure 3A). In the present study, we found that the treatment with the combination elevated fatty acid transport and lipolysis, which was even superior to capsaicin and capsiate alone.
Table 1. Primer Sequences name Tbx1 Tmem26 Cd40 Ucp1 Prdm16 Pgc-1α β-actin
sequence (5′ → 3′) forward: AAACTGACCAATAACCTG reverse: TCTCCTCAAACACAAAAG forward: TGCCAGGAAGTCAGAGAG reverse: CAAAGCAGCCAGCATAAG forward: GCTATGGGGCTGCTTGTT reverse: GGGTGGCATTGGGTCTTC forward: TTGTGGCTTCTTTTCTGC reverse: TTTGATTTCTTTGGTTGG forward: CATCTTTCCTCCATCCCT reverse: TCCTTGCCTTTGTCTCTG forward: GACGGATTGCCCTCATTT reverse: CTGTGGGTGTGGTTTGCT forward: GTGCTATGTTGCTCTAGACTTCG reverse: ATGCCACAGGATTCCATACC
length (bp) 156 154 156 194 366 218 174
of the results, 50 μM capsaicin, 50 μM capsiate, and a combination of 25 μM capsaicin and 25 μM capsiate were chosen as the experimental doses.
Figure 1. Effects of capsaicin and capsiate on 3T3-L1 white adipocyte viability. Mature adipocytes were treated with different concentrations of capsaicin (25, 50, and 100 μM), capsiate (25, 50, and 100 μM), or the combination of capsaicin and capsiate (12.5:12.5, 25:25, and 50:50 μM) for 48 h. Values are presented as the mean ± SD (n = 6).
Figure 2. Effects of capsaicin and capsiate on lipid accumulation and TG, TC, LDL-C, and HDL-C contents in 3T3-L1 white adipocytes. The mature cells were treated with 50 μM capsaicin, 50 μM capsiate, and a combination of 25 μM capsaicin and 25 μM capsiate, separately, for 48 h. (A) Cells were stained with oil red O to observe lipid droplets at 200× magnification. Scale bar = 200 μm. (B) Oil red O stained cells were extracted by isopropanol, and lipid content was quantified by spectrophotometric analysis at 540 nm. (C) TG, TC, LDL-C, and HDL-C levels of each group were assayed and are expressed in bar charts. Values are presented as the mean ± SD (n = 3). Significant differences between groups are indicated by asterisks: (∗) p < 0.050, (∗∗) p < 0.010, and (∗∗∗) p < 0.001. 6234
DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
Article
Journal of Agricultural and Food Chemistry
Figure 3. Effects of capsaicin and capsiate on the expressions of lipid-metabolism-related proteins and key metabolic regulators in 3T3-L1 white adipocytes. The mature cells were treated with 50 μM capsaicin, 50 μM capsiate, and a combination of 25 μM capsaicin and 25 μM capsiate, separately, for 48 h. (A) Protein expression of CD36, expression of ATGL, and phosphorylation of HSL and (B) phosphorylation of AMPKα, phosphorylation of AMPKβ, and protein expression of SIRT1 and TRPV1 were quantified by densitometry, and the relative intensities are expressed in the bar chart. Values are presented as the mean ± SD (n = 3). Significant differences between groups are indicated by asterisks: (∗) p < 0.050, (∗∗) p < 0.010, and (∗∗∗) p < 0.001.
Effects of Capsaicin and Capsiate on the Expressions of Key Lipid Metabolic Regulators in 3T3-L1 White Adipocytes. AMPK is an important sensor in energy metabolism and is also known as an upstream kinase of CD36, ATGL, and HSL.26 To further investigate the mechanism by which capsaicin and capsiate exerted their metabolic regulatory activity, the phosphorylation status of AMPK in 3T3-L1 adipocytes was examined. We found that the combination treatment markedly increased the phosphorylation of AMPKα in 3T3-L1 adipocytes. In addition, the three treatment groups fairly elevated the phosphorylation of AMPKβ1 in 3T3-L1 adipocytes, and a tendency toward a higher level was seen in cells treated with the combination compared to capsaicin. SIRT1 is also partially involved in the AMPK signaling pathway and plays a major role in regulating energy metabolism.27 We thus proceeded to investigate the effects of capsaicin and capsiate on the level of SIRT1. We found that only the group treated with the combination
extremely increased the level of SIRT1 protein expression. Moreover, given that both capsaicin and capsiate have similar chemical structures and bind with high affinity to TRPV1 and that TRPV1 showed the potential ability to activate AMPK to play an anti-obesity role,28 we measured the protein level of TRPV1 and found a positive increase in cells treated with the combination (Figure 3B). Taken together, these results indicated that the combination of capsaicin and capsiate could improve lipid metabolism by enhancing the phosphorylation of AMPK and the expression of SIRT1 and TRPV1, which was even superior to the capsaicin and capsiate treatment alone. Effects of Capsaicin and Capsiate on the Expressions of Beige-Specific Markers in 3T3-L1 White Adipocytes. To investigate whether the combined effects of capsaicin and capsiate on promoting lipid metabolism were related to inducing browning in 3T3-L1 white adipocytes, we analyzed the levels of beige-specific genes and proteins in these cells. We 6235
DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
Article
Journal of Agricultural and Food Chemistry
Figure 4. Effects of capsaicin and capsiate on the expressions of beige-specific genes and proteins in 3T3-L1 white adipocytes. The mature cells were treated with 50 μM capsaicin, 50 μM capsiate, and a combination of 25 μM capsaicin and 25 μM capsiate, separately, for 48 h. (A) mRNA expressions of Tbx1, Tmem26, Cd40, Ucp1, Prdm16, and Pgc-1α and (B) protein expressions of UCP1, PRDM16, and PGC-1α were quantified by densitometry, and the relative intensities are expressed in the bar chart. Values are presented as the mean ± SD (n = 3). Significant differences between groups are indicated by asterisks: (∗) p < 0.050, (∗∗) p < 0.010, and (∗∗∗) p < 0.001.
Figure 5. Effects of capsaicin and capsiate on the expressions of browning program regulators in 3T3-L1 white adipocytes. The mature cells were treated with 50 μM capsaicin, 50 μM capsiate, and a combination of 25 μM capsaicin and 25 μM capsiate, separately, for 48 h. Protein expressions of PPARγ and β3-AR were quantified by densitometry, and the relative intensities are expressed in the bar chart. Values are presented as the mean ± SD (n = 3). Significant differences between groups are indicated by asterisks: (∗) p < 0.050 and (∗∗) p < 0.010.
found obvious increases in the levels of beige-specific genes, including Tbx1, Tmem26, Cd40, Ucp1, and Prdm16, in cells
treated with the combination (Figure 4A). Furthermore, the combination treatment increased the protein levels of UCP1, 6236
DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
Article
Journal of Agricultural and Food Chemistry
Figure 6. Effects of T0070907 and SR 59230A on the expressions of beige-specific genes and proteins in 3T3-L1 white adipocytes treated with the combination of capsaicin and capsiate. The mature cells were pretreated with 10 μM T0070907 or 10 μM SR 59230A for 2 h prior to the combination of 25 μM capsaicin and 25 μM capsiate treatment. (A) mRNA expressions of Tbx1, Tmem26, Cd40, Ucp1, Prdm16, and Pgc-1α and (B) protein expressions of PPARγ, β3-AR, UCP1, PRDM16, and PGC-1α were quantified by densitometry, and the relative intensities are expressed in the bar chart. Values are presented as the mean ± SD (n = 3). Significant differences between groups are indicated by asterisks: (∗) p < 0.050, (∗∗) p < 0.010, and (∗∗∗) p < 0.001.
These results suggested that the combination-induced browning might have an association with the activation of the PPARγ/β3-AR signaling pathways in 3T3-L1 white adipocytes. Effects of T0070907 and SR 59230A on the Expressions of Beige-Specific Markers in 3T3-L1 White Adipocytes Treated with the Combination of Capsaicin and Capsiate. To confirm whether the combined effects of capsaicin and capsiate on promoting browning were mediated by PPARγ/β3-AR activation, T0070907 and SR 59230A, antagonists of PPARγ and β3-AR, respectively, were used. We analyzed the levels of beige-specific genes and proteins in 3T3L1 adipocytes pretreated with T0070907 or SR 59230A prior to the combination of capsaicin and capsiate treatment and found that most of the beige-specific markers were partially abolished by the antagonists of PPARγ or β3-AR (Figure 6).
PRDM16, and PGC-1α in 3T3-L1 cells, the markers of beige adipocytes, which suggested that the combination induced beige adipocyte biogenesis in 3T3-L1 cells. Besides, like the combination treatment group, the capsiate treatment group also showed a significantly higher protein level of UCP1 compared to the control group (Figure 4B). The results indicated that the combination of capsaicin and capsiate could effectively induce beige adipocyte biogenesis in 3T3-L1 white adipocytes. Effects of Capsaicin and Capsiate on the Expressions of Browning Program Regulators in 3T3-L1 White Adipocytes. PPARγ and β3-AR are important regulators for adipocyte browning. Therefore, we investigated the levels of PPARγ and β3-AR in 3T3-L1 cells. In comparison to the control group, the PPARγ was markedly increased in cells treated with capsiate and the combination and the most significant increase was observed in the combination-treated group. Meanwhile, we found that only the combination treatment positively increased the level of β3-AR (Figure 5). 6237
DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
Article
Journal of Agricultural and Food Chemistry
■
DISCUSSION Obesity has reached epidemic proportions and has become a global health concern, urging the development of novel strategies to combat it. In this study, for the first time, we demonstrated that a combination of capsaicin and capsiate could promote lipid metabolism via induction of brown adipocyte-like features in 3T3-L1 white adipocytes. These effects were associated with the activation of the PPARγ/β3-AR signaling pathways. The current obesity epidemic has drawn great attention to strategies controlling energy balance. Adipose tissue plays a central role in the control of energy homeostasis. Steps affecting lipid metabolism include extracellular fatty acid transport and intracellular lipolysis. CD36 is a membrane glycoprotein of adipocyte that facilitates the inward transport of fatty acids, and the increase in the level of CD36 indicated an increase of fatty acid transport into cells.29,30 ATGL and HSL are two major enzymes involved in fatty acid mobilization.31 On the one hand, ATGL functions essentially as a triacylglycerol lipase. The upregulation of ATGL promotes TG breakdown to fatty acids.32 On the other hand, HSL catalyzes the rate-limiting step, leading to lipolysis in adipocytes, and when phosphorylated, it can work together with ATGL to mobilize free fatty acids from lipid-storing tissues.33,34 In the present study, the increased levels of CD36 and ATGL and phosphorylation of HSL indicated that the fatty acid transport and lipolysis were promoted by the combination treatment in 3T3-L1 cells, and these were probably associated with the observed decreased contents of TG, TC, and LDL-C and increased content of HDL-C in the cells. AMPK is an upstream kinase of CD36, ATGL, and HSL, which is an important sensor in energy consumption.26,35 It is generally recognized that the phosphorylation of the AMPKα subunit is necessary for AMPK activity and that AMPKβ subunits are critical players in AMPK function.36,37 Previous studies mentioned that phosphorylation of AMPKα could activate SIRT1 directly and that SIRT1 also played a major role in regulating lipid metabolism.17,27,38 Our findings showed that the combination of capsaicin and capsiate greatly elevated the phosphorylation of AMPKα and AMPKβ1 and SIRT1 as well, which contributed to decreased lipid accumulation in 3T3-L1 adipocytes. Meanwhile, there is also evidence showing that the treatment of capsaicin or capsiate activated TRPV1 and then aroused phosphorylation of AMPK to exert the weight loss function.17,22 In this work, in comparison to the treatment of capsaicin or capsiate alone, the higher increase of TRPV1 was also observed in cells treated with the combination. In combination of the above phenomena, AMPK has been shown to play an important role in the browning program of WAT.39−41 We next determined whether the combined effects of capsaicin and capsiate on promoting lipid metabolism were related to inducing “beige phenotype” in 3T3-L1 cells. We found that the levels of beige-specific genes, including Tbx1, Tmem26, Cd40, Ucp1, and Prdm16, were increased in cells treated with the combination, which indicated that the browning program of white adipocytes was carried out by the combination of capsaicin and capsiate.4,42,43 Simultaneously, the protein levels of UCP1 and PRDM16 have also been raised, which further confirmed the beige features on 3T3-L1 cells.43−45 In addition, PGC-1α is also a beige-specific
marker; although there was no difference in the gene level of Pgc-1α, the protein level of PGC-1α in the combination-treated cells was higher than that in other groups (Figures 4A and 6A). We therefore hypothesized that there might be less degradation or an increase in stability of PGC-1α in the combination-treated cells, and further investigation to better understand the mechanism would be taken into consideration. The above evidence of increased lipolysis and browning in adipocytes pushed us to think further about the mechanism of browning induced by the combination of capsaicin and capsiate. Browning of WAT occurred when WAT was treated with certain inducers, such as the activators of PPARγ or β-AR. PPARγ is an important regulatory element that stimulates the initiation of the browning program in WAT. Studies showed that PPARγ activation promoted a brown adipocyte-like phenotype in WAT via induction of brown-specific genes, such as Ucp1 and Pgc-1α.46−49 Meanwhile, in the adipose tissue, β3-AR stimulation also displays the same effects as stimulation of PPARγ.50 When activated, β3-AR could induce browning by promoting expression of beige-specific genes, including Tbx1, Prdm16, Tmem26, and Ucp1.51,52 To further explore the mechanism that promotes browning by the combination of capsaicin and capsiate, the levels of PPARγ and β3-AR were investigated and pronounced changes were found in the cells treated with the combination. Furthermore, in the case of pretreating with antagonists of PPARγ or β3-AR, most of the beige-specific markers were abolished, which verified the roles of PPARγ and β3-AR in the effects of a combination of capsaicin and capsiate on promoting browning in adipocytes. In summary, the data that we presented illustrated a potential mechanism of inducing browning of white adipocytes by a combination of capsaicin and capsiate, which may be associated with the activation of the PPARγ/β3-AR signaling pathways. The present study supported the potential therapeutic utility of a combination of capsaicin and capsiate to treat obesity and provided a basis for reducing the individual doses of capsaicin and capsiate to develop the combined drugs or dietary supplement. It is noteworthy that future work is warranted to explore the further effects and molecular mechanisms of the combination of capsaicin and capsiate and even find an optimal ratio between them. In addition, the results in vitro do not necessarily reflect in vivo studies; more extensive studies on the biological effects of the metabolites of capsaicin and capsiate will make sense for further understanding and utilization of capsaicin and capsiate.
■
AUTHOR INFORMATION
Corresponding Author
*Telephone: +8615974222668. E-mail:
[email protected]. ORCID
Hong Qin: 0000-0002-4578-5118 Author Contributions †
Li Fan and Haiyan Xu contributed equally to this work.
Funding
This work was supported by the National Natural Science Foundation of China (81302421), the Natural Science Foundation of Hunan Province (2018JJ2550), and the Fundamental Research Funds for the Central Universities of Central South University (2018zzts857). Notes
The authors declare no competing financial interest. 6238
DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
Article
Journal of Agricultural and Food Chemistry
■
(13) Zang, Y.; Fan, L.; Chen, J.; Huang, R.; Qin, H. Improvement of Lipid and Glucose Metabolism by Capsiate in Palmitic Acid-Treated HepG2 Cells via Activation of the AMPK/SIRT1 Signaling Pathway. J. Agric. Food Chem. 2018, 66 (26), 6772−6781. (14) Hong, Q.; Xia, C.; Xiangying, H.; Quan, Y. Capsinoids suppress fat accumulation via lipid metabolism. Mol. Med. Rep. 2015, 11 (3), 1669−1674. (15) Lee, E.; Jung, D. Y.; Kim, J. H.; Patel, P. R.; Hu, X.; Lee, Y.; Azuma, Y.; Wang, H. F.; Tsitsilianos, N.; Shafiq, U.; Kwon, J. Y.; Lee, H. J.; Lee, K. W.; Kim, J. K. Transient receptor potential vanilloid type-1 channel regulates diet-induced obesity, insulin resistance, and leptin resistance. FASEB J. 2015, 29 (8), 3182−3192. (16) Watanabe, T.; Terada, Y. Food Compounds Activating Thermosensitive TRP Channels in Asian Herbal and Medicinal Foods. J. Nutr. Sci. Vitaminol. 2015, 61 (Supplement), S86−S88. (17) Baskaran, P.; Krishnan, V.; Ren, J.; Thyagarajan, B. Capsaicin induces browning of white adipose tissue and counters obesity by activating TRPV1 channel-dependent mechanisms. Br. J. Pharmacol. 2016, 173 (15), 2369−2389. (18) Saito, M.; Yoneshiro, T. Capsinoids and related food ingredients activating brown fat thermogenesis and reducing body fat in humans. Curr. Opin. Lipidol. 2013, 24 (1), 71−77. (19) Luo, X. J.; Peng, J.; Li, Y. J. Recent advances in the study on capsaicinoids and capsinoids. Eur. J. Pharmacol. 2011, 650 (1), 1−7. (20) Baboota, R. K.; Singh, D. P.; Sarma, S. M.; Kaur, J.; Sandhir, R.; Boparai, R. K.; Kondepudi, K. K.; Bishnoi, M. Capsaicin induces ″brite″ phenotype in differentiating 3T3-L1 preadipocytes. PLoS One 2014, 9 (7), No. e103093. (21) Watanabe, T.; Ohnuki, K.; Kobata, K. Studies on the metabolism and toxicology of emerging capsinoids. Expert Opin. Drug Metab. Toxicol. 2011, 7 (5), 533−542. (22) Kwon, D. Y.; Kim, Y. S.; Ryu, S. Y.; Cha, M. R.; Yon, G. H.; Yang, H. J.; Kim, M. J.; Kang, S.; Park, S. Capsiate improves glucose metabolism by improving insulin sensitivity better than capsaicin in diabetic rats. J. Nutr. Biochem. 2013, 24 (6), 1078−1085. (23) Ohyama, K.; Nogusa, Y.; Shinoda, K.; Suzuki, K.; Bannai, M.; Kajimura, S. A Synergistic Antiobesity Effect by a Combination of Capsinoids and Cold Temperature Through Promoting Beige Adipocyte Biogenesis. Diabetes 2016, 65 (5), 1410−1423. (24) Ohyama, K.; Nogusa, Y.; Suzuki, K.; Shinoda, K.; Kajimura, S.; Bannai, M. A combination of exercise and capsinoid supplementation additively suppresses diet-induced obesity by increasing energy expenditure in mice. Am. J. Physiol Endocrinol Metab 2015, 308 (4), E315−E323. (25) Tan, S.; Gao, B.; Tao, Y.; Guo, J.; Su, Z. Q. Antiobese effects of capsaicin-chitosan microsphere (CCMS) in obese rats induced by high fat diet. J. Agric. Food Chem. 2014, 62 (8), 1866−1874. (26) Chen, Y.-C.; Kao, T.-H.; Tseng, C.-Y.; Chang, W.-T.; Hsu, C.L. Methanolic extract of black garlic ameliorates diet-induced obesity via regulating adipogenesis, adipokine biosynthesis, and lipolysis. J. Funct. Foods 2014, 9, 98−108. (27) Hou, X.; Xu, S.; Maitland-Toolan, K. A.; Sato, K.; Jiang, B.; Ido, Y.; Lan, F.; Walsh, K.; Wierzbicki, M.; Verbeuren, T. J.; Cohen, R. A.; Zang, M. SIRT1 regulates hepatocyte lipid metabolism through activating AMP-activated protein kinase. J. Biol. Chem. 2008, 283 (29), 20015−20026. (28) Zhang, L. L.; Yan Liu, D.; Ma, L. Q.; Luo, Z. D.; Cao, T. B.; Zhong, J.; Yan, Z. C.; Wang, L. J.; Zhao, Z. G.; Zhu, S. J.; Schrader, M.; Thilo, F.; Zhu, Z. M.; Tepel, M. Activation of transient receptor potential vanilloid type-1 channel prevents adipogenesis and obesity. Circ. Res. 2007, 100 (7), 1063−1070. (29) Ibrahimi, A.; Abumrad, N. A. Role of CD36 in membrane transport of long-chain fatty acids. Curr. Opin. Clin. Nutr. Metab. Care 2002, 5 (2), 139−145. (30) Hames, K. C.; Vella, A.; Kemp, B. J.; Jensen, M. D. Free fatty acid uptake in humans with CD36 deficiency. Diabetes 2014, 63 (11), 3606−3614. (31) Schweiger, M.; Schreiber, R.; Haemmerle, G.; Lass, A.; Fledelius, C.; Jacobsen, P.; Tornqvist, H.; Zechner, R.;
ACKNOWLEDGMENTS The authors thank Dr. Ren-gui Yang for valuable advice. The authors also thank Dr. Jing-fang Chen for helpful assistance with the experiments.
■
ABBREVIATIONS USED AMPK, AMP-activated protein kinase; ATGL, adipose triglyceride lipase; BAT, brown adipose tissue; CD36, cluster of differentiation 36; HDL-C, high-density lipoprotein cholesterol; HSL, hormone-sensitive lipase; LDL-C, lowdensity lipoprotein cholesterol; pAMPK, phosphorylated AMP-activated protein kinase; pHSL, phosphorylated hormone-sensitive lipase; PPARγ, peroxisome proliferator-activated receptor γ; PGC-1α, peroxisome proliferator-activated receptor γ coactivator 1α; PRDM16, PR domain containing 16; SIRT1, sirtuin 1; TG, triacylglycerol; TC, total cholesterol; TRPV1, vanilloid transient receptor subtype I; UCP1, uncoupling protein 1; WAT, white adipose tissue; β-AR, βadrenergic receptor
■
REFERENCES
(1) Jennissen, K.; Siegel, F.; Liebig-Gonglach, M.; Hermann, M. R.; Kipschull, S.; van Dooren, S.; Kunz, W. S.; Fassler, R.; Pfeifer, A. A VASP-Rac-soluble guanylyl cyclase pathway controls cGMP production in adipocytes. Sci. Signaling 2012, 5 (239), ra62. (2) Shen, W.; Wang, Y.; Lu, S.-F.; Hong, H.; Fu, S.; He, S.; Li, Q.; Yue, J.; Xu, B.; Zhu, B.-M. Acupuncture promotes white adipose tissue browning by inducing UCP1 expression on DIO mice. BMC Complementary Altern. Med. 2014, 14, 501. (3) Lu, P.; Zhang, F. C.; Qian, S. W.; Li, X.; Cui, Z. M.; Dang, Y. J.; Tang, Q. Q. Artemisinin derivatives prevent obesity by inducing browning of WAT and enhancing BAT function. Cell Res. 2016, 26 (10), 1169−1172. (4) Wu, J.; Bostrom, P.; Sparks, L. M.; Ye, L.; Choi, J. H.; Giang, A. H.; Khandekar, M.; Virtanen, K. A.; Nuutila, P.; Schaart, G.; Huang, K.; Tu, H.; van Marken Lichtenbelt, W. D.; Hoeks, J.; Enerback, S.; Schrauwen, P.; Spiegelman, B. M. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 2012, 150 (2), 366−376. (5) Rosen, E. D.; Spiegelman, B. M. What we talk about when we talk about fat. Cell 2014, 156 (1−2), 20−44. (6) Harms, M.; Seale, P. Brown and beige fat: Development, function and therapeutic potential. Nat. Med. 2013, 19 (10), 1252− 1263. (7) Lidell, M. E.; Betz, M. J.; Leinhard, O. D.; Heglind, M.; Elander, L.; Slawik, M.; Mussack, T.; Nilsson, D.; Romu, T.; Nuutila, P.; Virtanen, K. A.; Beuschlein, F.; Persson, A.; Borga, M.; Enerback, S. Evidence for two types of brown adipose tissue in humans. Nat. Med. 2013, 19 (5), 631−634. (8) McDonald, M. E.; Li, C.; Bian, H.; Smith, B. D.; Layne, M. D.; Farmer, S. R. Myocardin-related transcription factor A regulates conversion of progenitors to beige adipocytes. Cell 2015, 160 (1−2), 105−118. (9) Kajimura, S.; Spiegelman, B. M.; Seale, P. Brown and Beige Fat: Physiological Roles beyond Heat Generation. Cell Metab. 2015, 22 (4), 546−559. (10) Bonet, M. L.; Oliver, P.; Palou, A. Pharmacological and nutritional agents promoting browning of white adipose tissue. Biochim. Biophys. Acta, Mol. Cell Biol. Lipids 2013, 1831 (5), 969−985. (11) Bonet, M. L.; Mercader, J.; Palou, A. A nutritional perspective on UCP1-dependent thermogenesis. Biochimie 2017, 134, 99−117. (12) Rohm, B.; Holik, A. K.; Kretschy, N.; Somoza, M. M.; Ley, J. P.; Widder, S.; Krammer, G. E.; Marko, D.; Somoza, V. Nonivamide enhances miRNA let-7d expression and decreases adipogenesis PPARγ expression in 3T3-L1 cells. J. Cell. Biochem. 2015, 116 (6), 1153−1163. 6239
DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
Article
Journal of Agricultural and Food Chemistry Zimmermann, R. Adipose triglyceride lipase and hormone-sensitive lipase are the major enzymes in adipose tissue triacylglycerol catabolism. J. Biol. Chem. 2006, 281 (52), 40236−40241. (32) Santucci, P.; Canaan, S. Lipid Droplets Breakdown: Adipose Triglyceride Lipase Leads the Way. Curr. Protein Pept. Sci. 2018, 19 (11), 1131−1133. (33) Deiuliis, J. A.; Liu, L. F.; Belury, M. A.; Rim, J. S.; Shin, S.; Lee, K. β3-Adrenergic signaling acutely down regulates adipose triglyceride lipase in brown adipocytes. Lipids 2010, 45 (6), 479−489. (34) Zechner, R.; Zimmermann, R.; Eichmann, T. O.; Kohlwein, S. D.; Haemmerle, G.; Lass, A.; Madeo, F. FAT SIGNALS–lipases and lipolysis in lipid metabolism and signaling. Cell Metab. 2012, 15 (3), 279−291. (35) Kondo, A.; Otsuka, T.; Kato, K.; Matsushima-Nishiwaki, R.; Kuroyanagi, G.; Mizutani, J.; Tokuda, H.; Kozawa, O. AMP-activated protein kinase regulates thyroid hormone-stimulated osteocalcin synthesis in osteoblasts. Int. J. Mol. Med. 2013, 31 (6), 1457−1462. (36) Fogarty, S.; Hardie, D. G. Development of protein kinase activators: AMPK as a target in metabolic disorders and cancer. Biochim. Biophys. Acta, Proteins Proteomics 2010, 1804 (3), 581−591. (37) Sanz, P.; Rubio, T.; Garcia-Gimeno, M. A. AMPKβ subunits: More than just a scaffold in the formation of AMPK complex. FEBS J. 2013, 280 (16), 3723−3733. (38) Li, Y.; Wong, K.; Giles, A.; Jiang, J.; Lee, J. W.; Adams, A. C.; Kharitonenkov, A.; Yang, Q.; Gao, B.; Guarente, L.; Zang, M. Hepatic SIRT1 attenuates hepatic steatosis and controls energy balance in mice by inducing fibroblast growth factor 21. Gastroenterology 2014, 146 (2), 539−549.e7. (39) Shan, T.; Liang, X.; Bi, P.; Kuang, S. Myostatin knockout drives browning of white adipose tissue through activating the AMPKPGC1α-Fndc5 pathway in muscle. FASEB J. 2013, 27 (5), 1981− 1989. (40) Wang, S.; Liang, X.; Yang, Q.; Fu, X.; Rogers, C. J.; Zhu, M.; Rodgers, B. D.; Jiang, Q.; Dodson, M. V.; Du, M. Resveratrol induces brown-like adipocyte formation in white fat through activation of AMP-activated protein kinase (AMPK) α1. Int. J. Obes. 2015, 39 (6), 967−976. (41) Day, E. A.; Ford, R. J.; Steinberg, G. R. AMPK as a Therapeutic Target for Treating Metabolic Diseases. Trends Endocrinol. Metab. 2017, 28 (8), 545−560. (42) Lee, P.; Linderman, J. D.; Smith, S.; Brychta, R. J.; Wang, J.; Idelson, C.; Perron, R. M.; Werner, C. D.; Phan, G. Q.; Kammula, U. S.; Kebebew, E.; Pacak, K.; Chen, K. Y.; Celi, F. S. Irisin and FGF21 are cold-induced endocrine activators of brown fat function in humans. Cell Metab. 2014, 19 (2), 302−309. (43) Seale, P.; Kajimura, S.; Yang, W.; Chin, S.; Rohas, L. M.; Uldry, M.; Tavernier, G.; Langin, D.; Spiegelman, B. M. Transcriptional control of brown fat determination by PRDM16. Cell Metab. 2007, 6 (1), 38−54. (44) Wu, J.; Cohen, P.; Spiegelman, B. M. Adaptive thermogenesis in adipocytes: Is beige the new brown? Genes Dev. 2013, 27 (3), 234− 50. (45) Seale, P.; Conroe, H. M.; Estall, J.; Kajimura, S.; Frontini, A.; Ishibashi, J.; Cohen, P.; Cinti, S.; Spiegelman, B. M. Prdm16 determines the thermogenic program of subcutaneous white adipose tissue in mice. J. Clin. Invest. 2011, 121 (1), 96−105. (46) Villanueva, C. J.; Vergnes, L.; Wang, J.; Drew, B. G.; Hong, C.; Tu, Y.; Hu, Y.; Peng, X.; Xu, F.; Saez, E.; Wroblewski, K.; Hevener, A. L.; Reue, K.; Fong, L. G.; Young, S. G.; Tontonoz, P. Adipose subtype-selective recruitment of TLE3 or Prdm16 by PPARγ specifies lipid storage versus thermogenic gene programs. Cell Metab. 2013, 17 (3), 423−435. (47) Kissig, M.; Shapira, S. N.; Seale, P. SnapShot: Brown and Beige Adipose Thermogenesis. Cell 2016, 166 (1), 258−258.e1. (48) Zhou, Y.; Yang, J.; Huang, J.; Li, T.; Xu, D.; Zuo, B.; Hou, L.; Wu, W.; Zhang, L.; Xia, X.; Ma, Z.; Ren, Z.; Xiong, Y. The formation of brown adipose tissue induced by transgenic over-expression of PPARγ2. Biochem. Biophys. Res. Commun. 2014, 446 (4), 959−964.
(49) Vernochet, C.; Peres, S. B.; Davis, K. E.; McDonald, M. E.; Qiang, L.; Wang, H.; Scherer, P. E.; Farmer, S. R. C/EBPα and the corepressors CtBP1 and CtBP2 regulate repression of select visceral white adipose genes during induction of the brown phenotype in white adipocytes by peroxisome proliferator-activated receptor γ agonists. Mol. Cell. Biol. 2009, 29 (17), 4714−4728. (50) Bogacka, I.; Gettys, T. W.; de Jonge, L.; Nguyen, T.; Smith, J. M.; Xie, H.; Greenway, F.; Smith, S. R. The Effect of -Adrenergic and Peroxisome Proliferator−Activated Receptor-Stimulation on Target Genes Related to Lipid Metabolism in Human Subcutaneous Adipose Tissue. Diabetes Care 2007, 30 (5), 1179−1186. (51) Park, P. J.; Cho, J. Y.; Cho, E. G. Specific visible radiation facilitates lipolysis in mature 3T3-L1 adipocytes via rhodopsindependent β3-adrenergic signaling. Eur. J. Cell Biol. 2017, 96 (4), 301−311. (52) Choi, M.; Mukherjee, S.; Kang, N. H.; Barkat, J. L.; Parray, H. A.; Yun, J. W. L-rhamnose induces browning in 3T3-L1 white adipocytes and activates HIB1B brown adipocytes. IUBMB Life 2018, 70 (6), 563−573.
6240
DOI: 10.1021/acs.jafc.9b02191 J. Agric. Food Chem. 2019, 67, 6232−6240
