Articles pubs.acs.org/acschemicalbiology
Peptide Formation by N‑Methyl Amino Acids in Translation Is Hastened by Higher pH and tRNAPro Jinfan Wang, Marek Kwiatkowski, Michael Y. Pavlov, Måns Ehrenberg, and Anthony C. Forster* Department of Cell and Molecular Biology, Uppsala University, Husargatan 3, Box 596, Uppsala 75124, Sweden S Supporting Information *
ABSTRACT: Applications of N-methyl amino acids (NMAAs) in drug discovery are limited by their low efficiencies of ribosomal incorporation, and little is known mechanistically about the steps leading to incorporation. Here, we demonstrate that a synthetic tRNA body based on a natural N-alkyl amino acid carrier, tRNAPro, increases translation incorporation rates of all three studied NMAAs compared with tRNAPhe- and tRNAAla-based bodies. We also investigate the pH dependence of the incorporation rates and find that the rates increase dramatically in the range of pH 7 to 8.5 with the titration of a single proton. Results support a rate-limiting peptidyl transfer step dependent on deprotonation of the N-nucleophile of the NMAA. Competition experiments demonstrate that several futile cycles of delivery and rejection of A-site NMAA-tRNA are required per peptide bond formed and that increasing magnesium ion concentration increases incorporation yield. Data clarify the mechanism of ribosomal NMAA incorporation and provide three generalizable ways to improve incorporation of NMAAs in translation.
T
then GTP hydrolysis, it has not proved possible to directly discriminate the AA-tRNA accommodation step from the chemistry of peptidyl transfer. On one hand, based upon assays using a fluorescent Phe-tRNAPhe analogue, it was argued that the ribosomal incorporation of AA-tRNA was rate-limited by accommodation into the A-site;12 this was supported by the report of pH-independent incorporation of natural PhetRNA.13 On the other hand, later evidence that included use of N-alkyl AA substrates indicated that α-amino group reactivity had a large effect on the incorporation efficiencies5 and rates3,14,15 and that incorporations of some natural AA-tRNAs, including Phe-tRNAPhe and Pro-tRNAPro, were pH-dependent.15 Such α-amino-specific effects could not be easily explained mechanistically by a rate-limiting accommodation step; rather they were presumed to be explained by a ratelimiting peptidyl transfer step. A combination of both explanations cannot be ruled out, i.e., that the rate-limiting step switches from peptidyl transfer to accommodation as the pH increases.15−17 In this study, we undertook a systematic analysis of the kinetics of incorporation of three NMAAs using different tRNA bodies to clarify the mechanism of their incorporation and rejection in translation and to test ideas for improving their incorporations.
here is considerable interest in studying ribosomal incorporations of N-methyl amino acids (NMAAs), not only for their importance in the pharmaceutical field,1,2 but also for better understanding of the mechanism of translation.3 NMethylation of the peptide backbone improves pharmacological properties by increasing both resistance to proteolysis and membrane permeability. Ribosomal synthesis of such peptides allows genetic encoding of enormous libraries of randomized compounds for in vitro selection. Although the potential of this approach has been demonstrated,1,2 application of NMAAs is limited by their generally low ribosomal incorporation efficiencies.3−7 The poor efficiencies of incorporation of unnatural AAtRNAs, even when using a purified translation system,8 were traced in many cases to low affinities for elongation factor Tu (EF-Tu) that delivers charged AA-tRNAs to the A-site of the ribosome.9 The matching of AA with the adaptor tRNA is important for optimal EF-Tu affinity and hence more efficient delivery to the ribosomal A-site.3,5,10,11 Furthermore, tRNAPro has been shown to be a much more efficient tRNA adaptor for incorporation of the only proteinogenic N-alkyl-AA, Pro, when comparing with tRNAPhe.3 Also, the incorporation efficiency of N-methyl-Phe (NMF) was higher when delivered by tRNAAlaor tRNAAsn-based synthetic tRNAs than from a tRNAPhe-based tRNA.5,7 However, the improved efficiency of incorporation of NMF by tRNAAla could not be explained by differences in EFTu binding affinities,7 and whether tRNAPro will be a better adaptor for NMAAs remains to be tested. From the perspective of investigating translation mechanism, NMAA-tRNAs may be useful tools because NMF incorporates extremely slowly.3,7 For example, after delivery to the ribosome of natural AA-tRNA by EF-Tu:GTP (ternary complex) and © XXXX American Chemical Society
Received: January 17, 2014 Accepted: March 27, 2014
A
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
ACS Chemical Biology
Articles
Figure 1. Synthetic tRNAs charged with natural and unnatural AAs. (a) Natural and unnatural AAs used in our kinetics studies. (b) Synthetic, unmodified tRNAs based on natural E. coli tRNA sequences (black with purple anticodon, post-transcriptional modifications are in green), with changes in blue. Post-transcriptional modifications for the studied tRNAPro isoacceptor are unknown.
■
We first need to ascertain the effect on kinetics of a lack of tRNA modifications, a penultimate dC, and the introduced C-G base pair swap in the synthetic tRNAPro. Dipeptide synthesis kinetics9 (also see Methods) from initiator fMet-tRNAfMet and Pro-tRNAProB was compared with the corresponding kinetics for E. coli bulk tRNA charged with Pro by Pro-tRNA synthetase, with the CCG codon in the ribosomal A-site. Similar dipeptide formation rates for Pro-tRNAProB and native Pro-tRNAPro (Figure 2, 1.3-fold difference) showed that these changes of the tRNA body had only a minor effect on the dipeptide synthesis kinetics, validating the AA-tRNA construction method in this study. As found earlier with native
RESULTS AND DISCUSSION Construction and Validation of a Synthetic tRNAProB Body. The tRNAAla-based unmodified synthetic tRNA, tRNAAlaB (Figure 1b), has been shown to improve the incorporation efficiency of NMF (Figure 1a) about 2-fold, both in a 30 min bulk translation experiment5 and in a kinetic assay,7 when comparing with the “cognate” tRNAPheB (Figure 1b). Moreover, it has also been observed that the incorporation rates for Pro from various tRNAPro isoacceptors were 5- to 9fold faster than from tRNAPheB.3 Given this evidence that tRNAPro’s could speed incorporation of an N-alkyl AA, we hypothesized that a tRNAPro body might also hasten the rate of incorporation of other N-alkyl AAs, such as NMAAs. Alternatively, the improvement from the tRNAPro bodies might be specific to just their natural cognate AA, Pro, due to optimizing affinity for EF-Tu3,5,10,11 or proper positioning of the N-nucleophile of Pro at the peptidyl transfer center. We selected the tRNAProCGG isoacceptor to study the kinetics since its matching codon (CCG) was shown to be the most efficient one among all of the four codons for Pro incorporation.3 For the ease of T7 RNA polymerase transcription, similar to the design of tRNA PheB , 5 the tRNAProC1G‑G73CCGG sequence was designed instead of the native sequence (Figure 1b). After production of the 3′CAtruncated version of tRNAProC1G‑G73CCGG, it was ligated to a chemically synthesized N-NitroVeratrylOxyCarbonyl (NVOC)AA-pdCpA by T4 RNA ligase to give NVOC-AA-tRNAProB. The NVOC protecting group was then removed by photolysis.
Figure 2. Effect of tRNA adaptor on the kinetics of dipeptide synthesis with Pro-tRNAs. Representative plots for kinetics of dipeptide synthesis from fMet-tRNAfMet and Pro delivered by native tRNAPro, tRNAProB, and tRNAPheB reading ribosomal A-site cognate codon at pH 7.3. B
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
ACS Chemical Biology
Articles
Figure 3. Effect of tRNA adaptor on the kinetics of dipeptide synthesis with NMAA-tRNAs. Representative plots for kinetics of dipeptide synthesis from fMet-tRNAfMet with NMF (a), NMA (b), and NMG (c) delivered by tRNAProB, tRNAAlaB, and tRNAPheB at pH 7.8.
tRNAPro bodies,3 Pro had faster incorporation rates when delivered by the synthetic tRNAProB than by tRNAPheB (Figure 2). tRNAProB Accelerates the Incorporation Rates of NMAAs. NMF, NMA, and NMG (Figure 1a) were selected to be studied here since they had the highest incorporation yields among all of the NMAA derivatives of natural AAs18 and chemical models of their peptide formation rates have been studied.14 Three NVOC-NMAA-pdCpAs were synthesized and ligated to three tRNA bodies (Figure 1). Kinetics of dipeptide formation (Figure 3, Table 1) from initiator fMet-tRNAfMet and
hypothesis”5,14 where reactivities correlated inversely with steric hindrance of the AA side chains. The observed hastening of incorporation rate of NMG by adding a C-α side chain (i.e., converting it to NMA or NMF) and hastening of incorporations using the tRNAProB body could not be explained simply by altered EF-Tu binding affinities; this is because the NMF-tRNAProB incorporation rates were independent of EF-Tu concentration (Supplementary Figure 1) and the rate of GTP hydrolysis for NMF-tRNAPheB was similar to that of Phe-tRNAPheB.3 We postulate that adding a Cα side chain and using a tRNAPro body are better for NMAA incorporation because of the way that they position the N nucleophile in the peptidyl transfer center. Striking pH Dependence of Ribosomal Incorporation Rates of NMAA-tRNAs. The rate of peptide synthesis from fMet-tRNAfMet to Phe-tRNA has been variously reported to be pH-independent13 and pH-dependent,15 while the only natural N-alkyl AA-tRNA, Pro-tRNA, was reported to be strongly pHdependent.15 To further investigate the effect of N-methylation of the AAs on incorporation kinetics, pH-dependence experiments were undertaken with NMF, NMA, and NMG delivered by tRNAProB. For a control, we measured the pH dependence of Phe, but at 37 °C using our synthetic tRNAPheB adaptor (Supplementary Figure 2a) instead of natural tRNAPhe.15 Precision was insufficient to be conclusive on pH dependence. Swapping the AA on tRNAPheB to Pro gave strong pH dependence (Supplementary Figure 2b), as previously observed for Pro-tRNAPro,15 but now formally demonstrating that the pH dependence was due to the AA, not the tRNA body. Ribosome concentration, which was in large molar excess over the ternary complex, was also varied to confirm that the rate of the reaction on the ribosome was measured (Supplementary Figure 3 and Supplementary Table 1). Next, we tested for pH dependence of NMAA incorporation using the optimal tRNA body, synthetic tRNAProB. As a control, Pro-tRNAProB was found to give the same pH dependence (Figure 4a) as found for Pro-tRNAPheB (Supplementary Figure 2b), formally demonstrating that the pH dependence was not due to post-transcriptional modifications. A striking pH dependence of the incorporation rate was observed for all NMAAs (Figure 4, Supplementary Table 2). In absolute terms, the slow dipeptide formation rate for NMA was hastened to above 1 s−1 at pH > 8 (Supplementary Table 2), a remarkable increase that made it comparable with the incorporation rate of Pro-tRNAProB at pH 7. This indicates that increasing pH can facilitate peptidomimetic synthesis with NMAAs. The pH dependence of incorporation rate for NMA and NMF cases was significantly stronger than for their non-N-
Table 1. Kinetics Data of Dipeptide Formation Reaction from fMet-tRNAfMet and Different NMAA-tRNAs (see Figure 1) at pH 7.8 amino acid NMF
NMA
NMG
tRNA ProB
tRNA tRNAAlaB tRNAPheB tRNAProB tRNAAlaB tRNAPheB tRNAProB tRNAAlaB tRNAPheB
kdip (s−1) 0.058 0.045 0.023 0.63 0.42 0.047 0.0147 0.0098 0.0034
± ± ± ± ± ± ± ± ±
0.007 0.009 0.005 0.03 0.07 0.013 0.0010 0.0008 0.0002
each NMAA-tRNA was measured at pH 7.8. In the control experiment, NMF incorporation from the tRNAAlaB body was 2-fold faster than from the tRNAPheB body, consistent with reported data.5,7 We then tested if the stimulation by tRNAAlaB compared with tRNAPheB could be generalized to other Nmethyl AAs and found that stimulation was also observed with the NMA and NMG substrates (Figure 3). Swapping the tRNA body from tRNA PheB to tRNA ProB stimulated NMAA incorporation even more than tRNAAlaB, although the increases over tRNAAlaB were slight. Interestingly, the biggest rate improvements by tRNAProB and tRNAAlaB over tRNAPheB (13fold and 9-fold, respectively, for NMA; Table 1) were much larger than reported for a NMAA (the improvement by tRNAAlaB over tRNAPheB for NMF was only 2-fold7). When delivered by the same tRNA body, NMA incorporated faster than NMF. Surprisingly, the incorporation rates of NMG were ∼5-fold slower than those of NMF and 14−40-fold slower than those of NMA on the same tRNA body, even though all of them had similar incorporation yields in a bulk translation reaction.18 This was unexpected from the “chemical reactivity C
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
ACS Chemical Biology
Articles
methylated natural counterparts.15 This may be explained by a rate-limiting peptidyl-transfer step and higher pKa values due to N-methylation (Supplementary Table 3). An alternative explanation that cannot be ruled out is that in the case of the non-N-methylated natural counterparts, the rate-limiting step switches from peptidyl-transfer to accommodation as the pH increases.15−17 When the log10(rate) was plotted against pH (Figure 4e), the initial slopes for NMF, NMA, and NMG substrates were all close to 1, indicating a titration of one reaction essential proton, similar to those of Pro-tRNAs. Results were completely in agreement with the presumed mechanism of the pH effect: deprotonation of the unreactive, charged, α-N group in a ratelimiting peptidyl transfer reaction.3,15 Due to technical reasons, such as instability of ribosome at high pH, we could not values for either Pro or any NMAA with estimate the pKobs a good precision from the pH-dependence curves. However, on the basis of the very high pKobs (>8.5) we estimated for the a NMAAs (Supplementary Table 3), ribosomal downshifts of pKa 15 values from pKaq were not apparent. a values Several Futile Cycles of Delivery Are Required per fMet-NMF Dipeptide Formed. Although the fMet-NMF formation rate was 3 orders of magnitude slower than that of fMet-Phe, the rate of GTP hydrolysis on EF-Tu during delivery of NMF-tRNAPheB to the ribosome A-site was only ∼4-fold slower than of Phe-tRNAPheB.3 So delivery of NMF-tRNA to the ribosome is efficient, and most likely accommodation also proceeds efficiently as the methyl group is not expected to prevent AA-tRNA release from EF-Tu or significantly hinder movement of the much larger AA-tRNA inside the ribosome. But does accommodated NMF-tRNAPheB then simply “wait” for the extremely slow peptidyl transfer to occur, or is it efficiently “rejected” (proofread) by the ribosome? The probability for accommodated, natural, cognate AA-tRNA to be rejected by the ribosome prior to peptidyl transfer is believed to be very small due to fast peptide bond formation.19,20 To investigate the effect, if any, of N-methylation on ribosomal rejection, a competition experiment was conducted at pH 7.3. A ternary complex mix containing 0.4 μM NMFtRNAProB, 0.4 μM Pro-tRNAProB, and EF-Tu:GTP in large molar excess over tRNAs was rapidly mixed with 0.25 μM
Figure 4. pH dependence of ribosomal incorporation of AA-tRNAs. (a−d) The ribosomal dipeptide formation rates of Pro-tRNAProB (a), NMF-tRNAProB (b), NMA-tRNAProB (c), and NMG-tRNAProB (d) at different pHs are shown. Error bars represent standard deviations calculated as weighted averages from two or three independent experiments. (e) The decimal logarithm of the peptidyl transfer rate constant (kpep) for different AA-tRNAs plotted vs pH. For PhetRNAPheB, the actual kpep was measured. For the other cases, kpep was approximated by the measured dipeptide formation rate constant (kdip) (see Methods).
Figure 5. Competition between NMF-tRNAProB and Pro-tRNAProB. Results of competition experiments (in blue) and control experiments (in black) done in LS3 buffer (a) or LS3 buffer supplemented with 5 mM extra Mg(OAc)2 (b). D
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
ACS Chemical Biology
Articles
Figure 6. Schematic representation of steps leading to the dipeptide syntheses in the competition experiment. Here, k1 and k2 are the association rate constants (overall rate for the ternary complex binding to the ribosomal A-site, GTP hydrolysis on EF-Tu, and AA-tRNA accommodation) of ProtRNAProB:EF-Tu:GTP and NMF-tRNAProB:EF-Tu:GTP ternary complexes with initiated 70S ribosomes; q1 and q2 are the A-site accommodated AAtRNA rejection rate constants for Pro-tRNAProB and NMF-tRNAProB; kNatural and kN‑methyl are the rate constants for peptidyl transfer from fMettRNAfMet to Pro-tRNAProB and NMF-tRNAProB, respectively. After the rejection of either of the AA-tRNA, the ribosome will become available again for the next binding incident to take place, and this binding incident is the result of the competition between the two ternary complexes.
competition experiment (0.19 s−1) was much faster than the fM-NMF formation (0.03 s−1) and accounted for about 40% of the ribosome amount. We concluded that the fast phase of fMP formation in the competition experiment was due to half of the ribosomes that were rapidly bound to the Pro-tRNAProB ternary complex, while the slow phase was caused by half of the ribosomes that were rapidly bound to the NMF-tRNAProB ternary complex and most of the ribosome-bound NMFtRNAProB being subsequently rejected, thereby allowing ProtRNAProB ternary complex to enter the translation cycle. To test this conclusion, we repeated the experiments with the Mg2+ concentration increased by 5 mM. It is well-known that increased Mg2+ concentration decreases the dissociation rate constant of AA-tRNA from the A-site of the mRNAprogrammed ribosome.21 If our conclusion was true, after the addition of 5 mM extra Mg2+, the fast phase amplitude of fMP formation in the competition experiment should remain about
initiated 70S ribosome with the CCG codon in the A-site. Since the delivery of both AA-tRNAs should be similar,3 we expected that in the competition experiment 50% of the ribosomes should be bound initially by NMF-tRNAProB and the other 50% by Pro-tRNAProB. Yet at the end of the reaction, fM-NMF formation accounted for only 10% of the dipeptides formed, while the remaining 90% was fMP (Figure 5a, blue solid lines). Also, at the end of the reaction, the sum of the amounts of the two dipeptides formed (Figure 5a, blue dashed line) reached the same level as in the control experiment omitting the NMFtRNAProB (Figure 5a, black line), confirming that all active ribosomes completed peptidyl transfer. In the competition experiment, fMP formation showed biphasic kinetics with a fast phase whose rate constant (4.17 s−1) was near to that of the control experiment (3.21 s−1) and whose amplitude corresponded to about 50% of the total ribosome amount. The slow phase of fMP formation in the E
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
ACS Chemical Biology
Articles
here, by slowing down the peptidyl transfer reaction with NMF, that we could measure the q2 parameter for NMF-tRNAProB reading the A-site cognate CCG codon, which might be similar to that of Pro-tRNAProB. Our substrates and method can thus act as a tool for studying the mechanisms of ribosomal protein synthesis. Conclusion. We have found that the tRNAProB adaptor improved the incorporation rate constants of NMF, NMA, and NMG and that the reactions had a strong pH dependence, consistent with rate-limiting peptidyl transfer. There were several futile cycles of delivery and rejection of A-site NMAAtRNA required per peptide bond formed, and the rejection rate constant was measured. A higher magnesium concentration increased the yield of N-methyl AA incorporation presumably by decreasing peptidyl-tRNA drop off. Our results together elucidate the translation mechanisms of NMAA incorporation and suggest three ways to improve incorporation efficiencies of NMAAs to facilitate applications: use of the tRNAProB adaptor, high pH, and high magnesium ion concentration.
50% of the total ribosome amount, whereas the slower phase amplitude and rate should decrease. On the other hand, the fMNMF formation amplitude should increase accordingly. Indeed, as shown in Figure 5b, the amplitude of the slow phase of fMP formation in the competition experiment decreased from 40% to 35%, while its rate dropped from 0.19 to 0.12 s−1. Also, the increased Mg2+ concentration doubled the yield of fM-NMF, consistent with ref 4. In further support of our conclusions from Figure 5, Supplementary Figure 4 showed that ongoing fM-NMF dipeptide synthesis was essentially “terminated” upon later addition of Pro-tRNAProB. A model for the competition reaction is given in Figure 6 and the Appendix in Supporting Information. The Pro-tRNAProB (or NMF-tRNAProB) is delivered to the ribosome A-site with the rate constant k1 (or k2), after which it can either be rejected by the ribosome with the rate constant q1 (or q2) or proceed to form dipeptide by peptidyl transfer reaction with the rate constant kNatural (or kN‑methyl). From the calculations presented in the Appendix in Supporting Information, we estimate the rejection rate constant of NMF-tRNAProB, q2 = 0.19 s−1. The dipeptide formation rate constant of NMF-tRNAProB, kN‑methyl, was estimated as about 0.03 s−1 in the standard experiment (Supplementary Table 2). The probability of A-site NMFtRNAProB to form a peptide bond instead of being rejected is then equal to
■
METHODS
AA-pdCpAs Synthesis. N-NVOC derivatives of L-N-Me-phenylalanine, L-N-Me-alanine, and N-Me-glycine were prepared as described.26 N-NVOC-protected cyanomethyl esters of AAs were prepared according to standard methodology.27 N-NVOC-Phenylalanine-pdCpA was described earlier.9 The acylation of the pdCpA was done at 10 μmol scale in the presence of 5 molar equiv of the activated AA. Both components were dissolved in a 2 mL Soersted tube in 0.2 mL of DMF followed by addition of dry acetonitrile (0.5 mL). The partially precipitated reaction mixture was dried by azeotropic coevaporation of water using a vacuum evaporator (SpeedVac) and dissolved in dry DMF (0.2 mL), and acylation was started by addition of dry triethylamine (25 mL). The tube was incubated at 50 °C for 16 h, and all volatile matter was evaporated. The residue was dissolved in 0.5 M ammonium acetate (pH 4.5) and acetonitrile 1:1, analyzed on reversed-phase RP-18 HPLC column using a gradient of acetonitrile in 50 mM ammonium acetate, and purified preparatively using LiChrospher 100 RP-18 column with the same gradient system. N-NVOC- L -N-Me-Phenylalanine-pdCpA. Light yellow solid: MALDI-TOF m/z calculated from C39H46N10O21P2 1036.24, found (M + H)+ 1037.22, (M + Na)+ 1059.22. N-NVOC-L-N-Me-Alanine-pdCpA. Light yellow solid: MALDI-TOF m/z calculated from C33H42N10O20P2 960.21, found (M + H)+ 961.20, (M + Na)+ 983.18. N-NVOC-L-N-Me-Glycine-pdCpA. Light yellow solid: MALDI-TOF m/z calculated from C32H40N10O20P2 946.19, found (M + H)+ 947.08, (M + Na)+ 969.08. N-NVOC-L-Proline-pdCpA. Light yellow solid: MALDI-TOF m/z calculated from C34H42N10O20P2 972.21, found (M + H)+ 973.17, (M + Na)+ 995.17. tRNA Preparations. tRNAPheB and tRNAAlaB were prepared as described before.5 The DNA template for tRNAProB was constructed by GenScript such that the sense strand of tRNAProB was flanked by the T7 RNA polymerase promoter and HindIII, FokI, EarI, and EcoRI sites precisely as follows:
kN ‐ methyl /(kN ‐ methyl + q2) = 1/8
implying that 8 cycles of delivery and rejection of NMFtRNAProB were required per peptide bond formation. When 5 mM extra Mg2+ was added to the LS3 buffer, the rejection rate constant reduced to about 0.13 s−1 corresponding to about 5 cycles of delivery and rejection being required per peptide bond formation with NMF- tRNAProB in this case. Moreover, from the model calculations, we noticed that the reduction of rejection rate constant q2 by higher Mg2+ concentration would not affect considerably the rate of NMAA incorporation into peptides due to fast delivery of NMAA-tRNA back to the A-site by EF-Tu at our ternary complex concentrations (Appendix in Supporting Information). Nevertheless, the intrinsic slow peptidyl transfer rates with NMAAs (Supplementary Table 2) would affect the processivity of NMAAs incorporations in protein synthesis. Although the peptidyl-tRNA, after being quickly translocated to the P-site, will bind to the ribosome with relatively higher stability (with the residence time in the range of 1 min,22 the slow peptide bond formation with the next NMAA would still imply a high probability of drop-off from the P-site. One remedy here would be to increase the rate of peptide bond formation with NMAA, which can be achieved by using the tRNAProB body and by increasing the reaction pH. One could also increase Mg2+ concentration to further stabilize the P-site peptidyl-tRNA21 with some compromise of accuracy.19 However, high accuracy is not likely to be important for peptidomimetic evolution experiments. Another possible way to increase incorporation efficiencies of N-alkyl AAs is by addition of elongation factor P.23−25 Importantly, our combination of methods might open a kinetic window for estimation of the ribosomal rejection rate for any AA-tRNA when reading a cognate mRNA codon. Experimental challenges have prevented direct determinations of the rejection rates (the q1 parameter in our model, Figure 6) of natural AA-tRNAs in the cognate reactions19,20 due to the very fast forward peptidyl transfer reaction. We have shown
...AAGCTTAATACGACTCACTATA‐tRNA ‐TGAAGAGCATCCGAATTC...
The insert cut at the underlined sites was subcloned into HindIII/ EcoRI-cut pUC18. 3′CA-truncated tRNAProB was produced by digestion of the plasmid with FokI and in vitro transcription with T7 RNA polymerase, while the full-length tRNAProB was prepared by digestion with EarI (instead of BstNI described in ref 5, due to an internal BstNI site). GMP was added to the transcription reaction at a final concentration 20 mM so that the tRNA had the native 5′ monophosphate. F
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
ACS Chemical Biology
Articles
AA-tRNAs. Various N-NVOC-AA-pdCpAs were ligated to different 3′CA-truncated tRNAs by T4 RNA ligase as described.8,28 The Cterminus 6×His-tagged T4 RNA ligase was produced by overexpression of pRHT4 plasmid as described.29 The ligation yields were estimated as higher than 70% of the input 3′CA-truncated tRNAs by 6.5% urea acid polyacrylamide gel electrophoresis. The ligation products were purified on a Q-column as described.3 The amino protecting group, NVOC, was removed by photolysis prior to translation experiments as described.3 mRNA Preparations. mRNAs encoding fMet-Pro-Phe-stop (mMPF), fMet-Phe-Phe-stop (mMFF), fMet-Ala-Phe-stop (mMAF) were prepared by in vitro transcription with T7 RNA polymerase and purified on an oligo-dT column. All the mRNAs had the same strong Shine-Dalgarno sequence (uaaggaggu) in the upstream sequence. The mRNA sequences were as follows (with sense codons xxx):
Kinetics of Incorporation of NMAAs Delivered by Different tRNAs at pH 7.8. Dipeptide formation experiments were done with NMF-, NMA-, and NMG-tRNAProB with the method described above, except the pH of the two mixtures was adjusted to pH 7.8 by addition of microliter volumes of 0.5 M KOH and measured with a microelectrode. For HPLC analysis, fMet-NMF dipeptide was eluted with 54% methanol/0.1% trifluoroacetic acid, fMet-NMA with 18% methanol/0.1% trifluoroacetic acid, and fMet-NMG with 12% methanol/0.1% trifluoroacetic acid. After quantifying the [3H]dipeptide fraction from the total [3H] signal on the HPLC, data were analyzed by the nonlinear regression program Origin7.5 (OriginLab Corp.). For NMA and NMF experiments, the fast phase (which was around 60% of the total amplitude for NMA and 70% for NMF) was fitted to the 2-step kinetic model, and the slow phase was fitted to a single-step kinetic model.9 For NMG experiments, the 2step kinetic model was applied. pH Dependence Experiments. Dipeptide formation was done at different pHs, where pH was adjusted in ribosomal and ternary complex mixes by addition of microliter volumes of 0.5 M KOH or 1 M HCl and measured with a microelectrode. Titration of the ribosome concentration (with ternary complex concentrations kept the same) was done to make sure the ribosome concentration was high enough that all the dipeptide formation rates measured were close to the maximal kdip value, kmax dip . kdip is defined as the inverse of the mean time to form a peptide bond after mixing of ternary complex with 70S initiation complex, τdip. For Pro incorporations, final 4 μM 70S ribosome was determined to be sufficient, whereas for NMF, NMA, and NMG 1 μM was enough. When titrating the ribosome concentration, IF2 was added to 0.5-fold of the 70S ribosome concentration, while IF1, IF3, [3H]fMet-tRNAfMet, and mRNA were 1.5-fold. Reactions were done either on the quench-flow apparatus or by taking hand points, depended on the incorporation rates. The reaction set-up was similar to that described above with the exception that the reactions were quenched by final 17% formic acid. Sample treatment after quenching was thus different. The quenched reaction mixture was centrifuged at 20000 × g for 15 min at 4 °C. To the pellet was added 120 μL of 0.5 M KOH to release the [3H]dipeptide and the unreacted [3H]fMet from tRNAs. Then formic acid was added up to 17% to precipitate the deacylated tRNAs. After another 10 min of incubation on ice, samples were centrifuged at 20000 × g for 15 min at 4 °C. The HPLC and data analysis methods were the same as described above. For Phe-tRNAPheB, kpep was measured with the method described in ref 3 with minor modifications at different pHs. kpep, the peptidyl transfer rate constant, is defined as the inverse of the mean time for all steps that lead to peptide bond formation after GTP hydrolysis on EFTu. For the other AA-tRNAs plotted in Figure 4e, kpep was approximated by kdip because the time of GTP hydrolysis (1/kGTP) was negligible compared with the time of peptide bond formation (1/ kpep) (see ref 3 and Appendix in Supporting Information). Final concentrations after combining equal volumes of the ribosomal mix and ternary complex mix are given. In the LS3 buffer, 2 μM ribosomes was used for the ribosomal mix. For the ternary complex mix, the 1 mM GTP in LS3 buffer was replaced by 1 mM ATP. The ternary complex contained 0.5 μM EF-Tu, 0.5 μM [3H]GTP, and 0.6 μM PhetRNAPheB. Also, EF-Ts was excluded from the mix. For the ternary complex mix, pH was adjusted to the desired value before adding EFTu (since EF-Tu stock was very concentrated, only a very small volume was needed). After preincubation for 30 min for the ternary complex mix and 15 min for the ribosomal mix, the kinetic assay was done on the quench flow apparatus. For the analysis of GTP hydrolysis on EF-Tu, [3H]GTP and [3H]GDP in the supernatant from the first centrifugation of the samples were quantified by HPLC with a MonoQ ion exchange column coupled with the β-RAM model 3 radioactivity detector (IN/US Systems). The pellet treatment method was the same as described above for the analysis of dipeptide formation. The GTP hydrolysis data were fitted to a single-step kinetic model, and the dipeptide formation data were fitted to a 2-step kinetic model. The rate for peptidyl transfer, kpep, was calculated as the inverse of the mean time of peptidyl transfer reaction, which was derived by
gggaauucgggcccuuguuaacaauuaaggagguauauc xxx xxx xxx uaauugcagaaaaaaaaaaaaa xxx xxx xxx = AUG CCG UUC for mMPF = AUG UUU UUU for mMFF = AUG GCA UUU for mMAF In Vitro Translation System. All components for the purified in vitro translation system, including MRE600 E. coli 70S ribosomes, synthetic mRNAs, initiation factors (IFs), and elongation factors, were prepared as described30 and did not include elongation factor P. [3H]Met was purchased from PerkinElmer. All in vitro translation experiments were conducted at 37 °C and, unless specified otherwise, in a polymix-like buffer, LS3,3 containing 95 mM KCl, 5 mM NH4Cl, 0.5 mM CaCl2, 8 mM putrescine, 1 mM spermidine, 30 mM HEPES, 1 mM dithioerythritol, 2 mM phosphoenolpyruvate (PEP), 5 mM Mg(OAc)2, 1 mM ATP, and 1 mM GTP supplemented with 1 μg/mL pyruvate kinase and 0.1 μg/mL myokinase for energy regeneration. Dipeptide Formation Experiments for Validation of tRNAProB. Dipeptide formation kinetics from fMet-tRNAfMet to native Pro-tRNAPro, Pro-tRNAProB, and Pro-tRNAPheB were compared. A ribosomal mix and a ternary complex mix were prepared in the LS3 buffer (pH 7.3). Concentrations are given as the final values after mixing equal volumes of these two mixtures. The ribosomal mix contained 70S ribosomes (1 μM), IF1 (1.5 μM), IF2 (0.5 μM), IF3 (1.5 μM), [3H]fMet-tRNAfMet (1.5 μM), and mRNA (1.5 μM). For the assays of native Pro-tRNAPro and Pro-tRNAProB incorporations, mMPF was used, whereas for the assays of Pro-tRNAPheB mMFF was used. The ternary complex mix contained 5 μM EF-Tu, 0.25 μM EFTs, and 0.15 μM active, chemoenzymatically synthesized, and photodeprotected AA-tRNA (Pro-tRNAProB or Pro-tRNAPheB, active concentration estimated from dipeptide formation with other components in excess). For the native tRNAPro case, instead of AAtRNA, E. coli total tRNA was added to the concentration such that the tRNAPro isoacceptor reading the CCG codon had a concentration of 0.15 μM (also quantified by dipeptide formation with other components in excess), supplemented with 0.2 mM proline and 0.1 unit/μL ProRS. After preincubation of the two mixtures at 37 °C for 15 min, equal volume of ribosomal mix and ternary complex mix were rapidly mixed in a temperature-controlled quench-flow apparatus (RQF-3; KinTeck Corp.). The reaction was quenched by rapidly mixing with 0.5 M KOH after different reaction times. After quenching, samples were incubated for 30 min at 37 °C. Then formic acid was added up to 17% to precipitate the deacylated tRNAs. After another 10 min of incubation on ice, samples were centrifuged at 20000 × g for 15 min at 4 °C. Supernatant containing [3H]dipeptide and the unreacted [3H]fMet from each time point sample was analyzed by C18 reverse phase HPLC coupled with a β-RAM model 3 radioactivity detector (IN/US Systems). The fMet-Pro dipeptide was eluted with 27% methanol/0.1% trifluoroacetic acid. After quantifying the [3H]dipeptide fraction from the total [3H] signal on the HPLC, the data were analyzed by the nonlinear regression program Origin7.5 (OriginLab Corp.) with a 2-step kinetic model.31 G
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
ACS Chemical Biology
Articles
subtracting the mean time of GTP hydrolysis on EF-Tu from the mean time of dipeptide formation. The fast phase dipeptide formation rates at various pHs with NMA and NMF, the rates from experiments with Pro and NMG, and the kpep values from experiments with Phe were then further analyzed by fitting to the pH dependence model.15 Competition Experiments. For the competition experiments in Figure 5, the ribosomal mix was prepared as described above, with 0.4 μM 70S ribosomes, which was in excess to 0.25 μM [3H]fMettRNAfMet such that only a single round of initiation complex would be formed. Pro-tRNAProB and NMF-tRNAProB were added to final 0.4 μM each in the ternary complex mix, and 10 μM of EF-Tu was added for the maximal formation of ternary complex. Control experiments were done by omitting the NMF-tRNAProB in the ternary complex mix. The competition experiments were done at pH 7.3, in buffer LS3 and also in buffer LS3 supplemented with 5 mM extra Mg(OAc)2. For the staggered competition experiments, slightly different conditions were used (see Supplementary Figure 4 legend). All reactions were quenched by formic acid. The peptides samples were analyzed by HPLC as described before, except that separation of fM-NMF and fMP dipeptides was achieved by elution with 27% methanol/0.1% trifluoroacetic acid for 15 min before another 20 min elution with 90% methanol/0.1% trifluoroacetic acid. Data analysis was done as described in the Appendix in Supporting Information.
■
(6) Subtelny, A. O., Hartman, M. C., and Szostak, J. W. (2008) Ribosomal synthesis of N-methyl peptides. J. Am. Chem. Soc. 130, 6131−6136. (7) Ieong, K. W., Pavlov, M. Y., Kwiatkowski, M., Ehrenberg, M., and Forster, A. C. (2014) A tRNA body with high affinity for EF-Tu hastens ribosomal incorporation of unnatural amino acids. RNA, DOI: 10.1261/rna.042234.113. (8) Forster, A. C., Tan, Z., Nalam, M. N., Lin, H., Qu, H., Cornish, V. W., and Blacklow, S. C. (2003) Programming peptidomimetic syntheses by translating genetic codes designed de novo. Proc. Natl. Acad. Sci. U.S.A. 100, 6353−6357. (9) Ieong, K. W., Pavlov, M. Y., Kwiatkowski, M., Forster, A. C., and Ehrenberg, M. (2012) Inefficient delivery but fast peptide bond formation of unnatural L-aminoacyl-tRNAs in translation. J. Am. Chem. Soc. 134, 17955−17962. (10) LaRiviere, F. J., Wolfson, A. D., and Uhlenbeck, O. C. (2001) Uniform binding of aminoacyl-tRNAs to elongation factor Tu by thermodynamic compensation. Science 294, 165−168. (11) Cload, S. T., Liu, D. R., Froland, W. A., and Schultz, P. G. (1996) Development of improved tRNAs for in vitro biosynthesis of proteins containing unnatural amino acids. Chem. Biol. 3, 1033−1038. (12) Pape, T., Wintermeyer, W., and Rodnina, M. V. (1998) Complete kinetic mechanism of elongation factor Tu-dependent binding of aminoacyl-tRNA to the A site of the E. coli ribosome. EMBO J. 17, 7490−7497. (13) Bieling, P., Beringer, M., Adio, S., and Rodnina, M. V. (2006) Peptide bond formation does not involve acid-base catalysis by ribosomal residues. Nat. Struct. Mol. Biol. 13, 423−428. (14) Watts, R. E., and Forster, A. C. (2010) Chemical models of peptide formation in translation. Biochemistry 49, 2177−2185. (15) Johansson, M., Ieong, K. W., Trobro, S., Strazewski, P., Aqvist, J., Pavlov, M. Y., and Ehrenberg, M. (2011) pH-sensitivity of the ribosomal peptidyl transfer reaction dependent on the identity of the A-site aminoacyl-tRNA. Proc. Natl. Acad. Sci. U.S.A. 108, 79−84. (16) Wohlgemuth, I., Pohl, C., and Rodnina, M. V. (2010) Optimization of speed and accuracy of decoding in translation. EMBO J. 29, 3701−3709. (17) Rodnina, M. V. (2013) The ribosome as a versatile catalyst: reactions at the peptidyl transferase center. Curr. Opin. Struct. Biol. 23, 595−602. (18) Kawakami, T., Murakami, H., and Suga, H. (2008) Messenger RNA-programmed incorporation of multiple N-methyl-amino acids into linear and cyclic peptides. Chem. Biol. 15, 32−42. (19) Johansson, M., Zhang, J., and Ehrenberg, M. (2012) Genetic code translation displays a linear trade-off between efficiency and accuracy of tRNA selection. Proc. Natl. Acad. Sci. U.S.A. 109, 131−136. (20) Gromadski, K. B., Daviter, T., and Rodnina, M. V. (2006) A uniform response to mismatches in codon-anticodon complexes ensures ribosomal fidelity. Mol. Cell 21, 369−377. (21) Lill, R., Robertson, J. M., and Wintermeyer, W. (1986) Affinities of tRNA binding sites of ribosomes from Escherichia coli. Biochemistry 25, 3245−3255. (22) Lovmar, M., Tenson, T., and Ehrenberg, M. (2004) Kinetics of macrolide action: the josamycin and erythromycin cases. J. Biol. Chem. 279, 53506−53515. (23) Doerfel, L. K., Wohlgemuth, I., Kothe, C., Peske, F., Urlaub, H., and Rodnina, M. V. (2013) EF-P is essential for rapid synthesis of proteins containing consecutive proline residues. Science 339, 85−88. (24) Kawakami, T., Ishizawa, T., and Murakami, H. (2013) Extensive reprogramming of the genetic code for genetically encoded synthesis of highly N-alkylated polycyclic peptidomimetics. J. Am. Chem. Soc. 135, 12297−12304. (25) Ude, S., Lassak, J., Starosta, A. L., Kraxenberger, T., Wilson, D. N., and Jung, K. (2013) Translation elongation factor EF-P alleviates ribosome stalling at polyproline stretches. Science 339, 82−85. (26) Tan, Z., Forster, A. C., Blacklow, S. C., and Cornish, V. W. (2004) Amino acid backbone specificity of the Escherichia coli translation machinery. J. Am. Chem. Soc. 126, 12752−12753.
ASSOCIATED CONTENT
S Supporting Information *
Additional figures, data, and Appendix. This material is available free of charge via the Internet at http://pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Notes
The authors declare the following competing financial interest(s): A.C.F. owns patent US6977150 licensed to Ra Pharmaceuticals, Inc., owns shares in the company and is a member of its scientific advisory board.
■
ACKNOWLEDGMENTS This work was supported by grants from the Swedish Research Council (project grants and Linnaeus Uppsala RNA Research Centre to M.E. and A.C.F.) and Knut and Alice Wallenberg Foundation (to M.E.). We thank R. Gao for subcloning the tRNAProB gene and P. J. Unrau for kindly providing us the pRHT4 plasmid.
■
REFERENCES
(1) Yamagishi, Y., Shoji, I., Miyagawa, S., Kawakami, T., Katoh, T., Goto, Y., and Suga, H. (2011) Natural product-like macrocyclic Nmethyl-peptide inhibitors against a ubiquitin ligase uncovered from a ribosome-expressed de novo library. Chem. Biol. 18, 1562−1570. (2) Schlippe, Y. V., Hartman, M. C., Josephson, K., and Szostak, J. W. (2012) In vitro selection of highly modified cyclic peptides that act as tight binding inhibitors. J. Am. Chem. Soc. 134, 10469−10477. (3) Pavlov, M. Y., Watts, R. E., Tan, Z., Cornish, V. W., Ehrenberg, M., and Forster, A. C. (2009) Slow peptide bond formation by proline and other N-alkylamino acids in translation. Proc. Natl. Acad. Sci. U.S.A. 106, 50−54. (4) Merryman, C., and Green, R. (2004) Transformation of aminoacyl tRNAs for the in vitro selection of ″drug-like″ molecules. Chem. Biol. 11, 575−582. (5) Zhang, B., Tan, Z., Dickson, L. G., Nalam, M. N., Cornish, V. W., and Forster, A. C. (2007) Specificity of translation for N-alkyl amino acids. J. Am. Chem. Soc. 129, 11316−11317. H
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
ACS Chemical Biology
Articles
(27) Ellman, J., Mendel, D., Anthony-Cahill, S., Noren, C. J., and Schultz, P. G. (1991) Biosynthetic method for introducing unnatural amino acids site-specifically into proteins. Methods Enzymol. 202, 301− 336. (28) Hecht, S. M., Alford, B. L., Kuroda, Y., and Kitano, S. (1978) ″Chemical aminoacylation″ of tRNA’s. J. Biol. Chem. 253, 4517−4520. (29) Wang, Q. S., and Unrau, P. J. (2002) Purification of histidinetagged T4 RNA ligase from E-coli. BioTechniques 33, 1256−1260. (30) Pavlov, M. Y., Freistroffer, D. V., MacDougall, J., Buckingham, R. H., and Ehrenberg, M. (1997) Fast recycling of Escherichia coli ribosomes requires both ribosome recycling factor (RRF) and release factor RF3. EMBO J. 16, 4134−4141. (31) Johansson, M., Bouakaz, E., Lovmar, M., and Ehrenberg, M. (2008) The kinetics of ribosomal peptidyl transfer revisited. Mol. Cell 30, 589−598.
I
dx.doi.org/10.1021/cb500036a | ACS Chem. Biol. XXXX, XXX, XXX−XXX
