Persulfide Formation Mediates Cysteine and Homocysteine

Subscriber access provided by UNIVERSITY OF LEEDS

Article

Persulfide formation mediates cysteine and homocysteine biosynthesis in Methanosarcina acetivorans Benjamin Julius Rauch, John Klimek, Larry L. David, and John J Perona Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.6b00931 • Publication Date (Web): 06 Feb 2017 Downloaded from http://pubs.acs.org on February 12, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Persulfide formation mediates cysteine and homocysteine biosynthesis in Methanosarcina acetivorans

Benjamin J. Rauch1,2,*, John Klimek2, Larry David2 & John J Perona1, 2

1Department

of Chemistry, P.O. Box 751, Portland State University, Portland, OR, 97207

2Department

of Biochemistry and Molecular Biology, Oregon Health and Sciences University,

3181 Southwest Sam Jackson Park Road, Portland, OR, 97239

*Present address: Department of Microbiology and Immunology, University of California San Francisco, 533 Parnassus Ave, UC Hall, San Francisco, CA 94143

1 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 41

ABSTRACT: The mechanisms of sulfur uptake and trafficking in methanogens inhabiting sulfidic environments are highly distinctive. In aerobes, sulfur transfers between proteins occur via persulfide relay, but direct evidence for persulfides in methanogens has been lacking. Here, we use mass spectrometry to analyze tryptic peptides of the Methanosarcina acetivorans SepCysS and MA1821 proteins purified anaerobically from methanogen cells. These enzymes insert sulfide into phosphoseryl(Sep)-tRNACys and aspartate semialdehyde, respectively, to form Cys-tRNACys and homocysteine. A high frequency of persulfidation at conserved cysteines of each protein was identified, while the substantial presence of persulfides in peptides from other cellular proteins suggests that this modification plays a general physiological role in the organism. Purified native SepCysS containing persulfide at conserved Cys260 generates CystRNACys in anaerobic single-turnover reactions without exogenously added sulfur, directly linking active-site persulfide formation in vivo with catalytic activity.


Rauch 2015

Page 3 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Assimilatory

sulfur

metabolism

in

methanogens

and

some

other

anaerobic

microorganisms is distinct in crucial respects from that found in aerobes, most likely reflecting the abundance of sulfide on the early anoxic Earth.1 All methanogens are able to grow with sulfide as the sole sulfur source, and generally cannot utilize sulfate since they lack the ATPdependent pathway for sulfate conversion to sulfide.2 Many methanogens also lack some or all of the otherwise well-conserved enzymes for biosynthesis of cysteine (O-acetylserine sulfhydrylase; OASS), homocysteine (O-acetylhomocysteine sulfhydrylase; OAHS), persulfides (cysteine desulfurase; CD), and cysteinyl-tRNACys (cysteinyl-tRNA synthetase; CysRS).3 In most organisms, OAHS and OASS each incorporate sulfide into O-acetylhomoserine to generate homocysteine (Hcy) and cysteine (Cys), respectively (Figure 1A).4 Cys then functions as a substrate for both CysRS and CDs; in the CD-catalyzed reaction, the substrate Cys sulfur is transferred to a Cys sulfhydryl on the enzyme, producing alanine and generating an enzymebound persulfide (S-SH).5 The outer sulfur of this persulfide (the “sulfane” sulfur, in the S0 oxidation state) is thus mobilized for further transfers and incorporation into tRNA, iron-sulfur clusters, and other cofactors and metabolites.6 Methanogens possess a conserved set of sulfur assimilation and trafficking proteins that either fully replace or augment these activities. Hcy is biosynthesized by the combined activity of two proteins, COG1900a-CBS (MA1821 locus in Methanosarcina acetivorans; CBS refers to a regulatory domain that has been previously found in the enzyme cystathionine-β-synthase) and the ferredoxin NIL-Fer (located at the immediately downstream MA1822 locus in M. acetivorans), which together catalyze a unique reductive condensation of sulfide with aspartate-semialdehyde to generate Hcy.7,

8

The COG1900a portion of MA1821 contains two

highly conserved Cys residues, one of which is essential to activity in vivo.7 Cys is produced as a covalently attached moiety at the 3’-end of cysteinyl-tRNA by the PLP-dependent enzyme Sep3 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 41

tRNA:Cys-tRNA synthase (SepCysS) acting on a phosphoseryl-tRNACys substrate.9 Finally, a fourth conserved protein, COG2122 (MA1715 in M. acetivorans), has not yet been biochemically characterized but is implicated by gene knockout and physiological studies in Methanosarcina acetivorans as crucial to efficient sulfide utilization and incorporation into Hcy and Cys.10 MA1821, SepCysS and MA1715 homologs co-occur in almost all methanogens, and all three also share a common phylogenetic history with methanogenesis enzymes, suggesting coevolution to incorporate environmentally abundant sulfide into the iron-sulfur clusters and sulfur-containing cofactors used in the eponymous pathway.7, 11 A fifth conserved methanogen protein, phosphoseryl-tRNA synthetase (SepRS), plays an important subsidiary role by biosynthesizing Sep-tRNACys from ATP, phosphoserine (Sep) and tRNACys (Figure 1B).9 These five highly conserved methanogen proteins together provide a plausible metabolic framework for anaerobic sulfide assimilation and for biosynthesis of Cys and Hcy. Within this framework, MA1715 appears to play a key assimilatory role by mobilizing environmental sulfide for Cys and Hcy biosynthesis by SepCysS and MA1821/MA1822, respectively.10 However, the mechanisms by which sulfur is transferred among these and other proteins in methanogens remain unknown. Many mesophilic and thermophilic methanogens do possess one or more CDs that likely originated from genes found in the earliest ancestral thermophiles.12 In contrast, most species in the genus Methanococcus, including Methanococcus maripaludis, lack CDs.1 Reflecting the distinctive metabolic framework, the free Cys concentration in M. maripaludis is five to 10-fold lower than commonly found in bacteria, and Cys is not the sulfur source for either Hcy or iron-sulfur cluster biosynthesis.13 Interestingly, mass spectrometry of M. maripaludis ThiI and Ncs6/Ctu1 tRNA thiouridine synthases expressed in Escherichia coli revealed persulfide groups on conserved active-site cysteines.14,

15

Similarly, an active site sulfane sulfur was also found in Methanocaldococcus 4 ACS Paragon Plus Environment

Rauch 2015

Page 5 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

jannaschii SepCysS when the enzyme was expressed in E. coli.16 However, the presence and prevalence of persulfide groups has not been examined in any native methanogen system, and direct linkage of persulfidation with biochemical activity in native cells is not established for any methanogen protein.16 To examine protein persulfidation in methanogens directly, and to obtain insight into the catalytic mechanisms of assimilatory sulfur metabolic enzymes specific to methanogens and some other anaerobes, we expressed the Methanosarcina acetivorans SepCysS and MA1821/MA1822 proteins in native methanogen cells and purified them under anaerobic conditions. Mass spectrometry showed that both proteins carry persulfide groups on conserved active-site Cys residues. Further, the purified SepCysS is active in single-turnover reactions converting Sep-tRNACys to Cys-tRNACys without added sulfur, showing that the active-site persulfide group of SepCysS is a direct sulfur donor for the incorporation of Cys into proteins in M. acetivorans.

EXPERIMENTAL PROCEDURES

Expression and purification of M. acetivorans SepRS in E. coli. The expression plasmid for M. acetivorans SepRS (pBR7) was constructed by inserting the PCR-amplified Nterminal (His)6-tagged SepRS-coding sequence (ma0090) into pET-16b (Novagen) between the NdeI and BamHI restriction sites (primers 1-2; Table S1). E. coli strain DH5α was used for the plasmid construction. Growth and expression conditions in E. coli strain BL21(DE3)pLysS, and purification on immobilized nickel resin, were very similar to the procedures used


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 41

previously to purify M. mazei SepRS.17 For the present preparation, the (His)10 tag was left intact.

Expression and purification of native SepCysS and MA1821 proteins in M. acetivorans. The expression plasmid for M. acetivorans SepCysS was constructed in two steps. First, the PCR-amplified SepCysS-coding sequence (ma0722) was inserted into pET-22b between the NdeI and XhoI restriction sites to yield pBR3, encoding the SepCysS coding region followed by a C-terminal (His)6 tag (primers 3-4; Table S1). Next, the coding sequence for SepCysS-(His)6 from pBR3 was amplified by PCR and inserted into the Methanosarcina expression vector pBR31 between the SphI and BamHI restriction sites,7 yielding the expression plasmid pBR49 (primers 5-6; Table S1). pBR31 contains the tetracycline-dependent PmcrB(tetO1) promoter derived from the pJK031A plasmid constructed in the Metcalf laboratory.7 E. coli strain DH5α/λ-pir+ was used to construct pBR49. All subsequent manipulations were performed anaerobically. The pseudo-wild type M. acetivorans strain WWM75 was first transformed with pBR049.7 Transformants were cultured at 37° C in HSMet medium (high-salt medium supplemented with 3 mM methionine) with 125 mM methanol as growth substrate, in the presence of puromycin sulfate (2 µg/ml) for plasmid selection. Upon reaching A600 of 0.15, tetracyclineHCl (100 µg/ml) was added to induce expression, and, incubation at 37° C was continued for an additional 24 hours to A600 of 1.0. Cellular lysis and protein purification conditions were adapted from those used previously for other M. acetivorans proteins.18 Cells were harvested by centrifugation (20 minutes, 7,000 rcf) in O-ring centrifuge bottles sealed with vinyl tape. Cell pellets were resuspended in 20 ml of SepCysS lysis buffer (10 mM trisHCl (pH 8.0), 1 M KCl, 10 mM imidazole, 15% glycerol) and lysed by bead beating. This was performed by vortexing the cell suspension with 10 ml of 0.1 6 ACS Paragon Plus Environment

Rauch 2015

Page 7 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

mm glass beads in a 50 ml falcon tube for approximately 2 minutes. Pyridoxal phosphate (PLP) (20 µM) and DNase (10 µg/ml) were added to the crude lysate, which was then cleared by centrifugation for 40 minutes at 17,000 rcf. Approximately 16 ml of cleared lysate was recovered and cleared further by filtration (0.45 µm). SepCysS was purified by affinity chromatography with Ni-NTA resin. The cleared lysate was incubated for 30 minutes with 4 ml of resin that was pre-equilibrated in SepCysS lysis buffer. The lysate-nickel resin mixture was poured over a column (1 cm diameter), and the resin was then washed with 40 ml SepCysS lysis buffer with reduced KCl concentration (0.1 M). SepCysS was eluted with 16 ml SepCysS lysis buffer with reduced KCl concentration (0.1 M) and increased imidazole concentration (0.2 M). The elution fraction was concentrated with a centrifugal filtration device (30 kDa MWCO, Pall), sealed with vinyl tape, to a concentration of 0.3 mg/ml, and dialyzed into storage buffer (50 mM HEPES (pH 8.0), 100 mM NaCl and 50% glycerol). Expression of MA1821 in M. acetivorans cells was accomplished using the expression plasmid pBR70, which was constructed previously.7 A homocysteine-auxotrophic, ma1821deletion strain, BJR10, was transformed with the double expression plasmid pBR70 encoding MA1821-(His)8 and MA1822-(His)6 fusion proteins. Transformants were cultured at 37° C to an optical density of 1.0 in HSDTT medium supplemented with puromycin sulfate (2 µg/ml), tetracyclineHCl (75 µg/ml) and sodium sulfide (1.5 mM). HSDTT medium contains 1.5 mM dithiothreitol as reductant and does not support growth without addition of a viable sulfur source (in this case, sodium sulfide).7 Techniques for cell harvest, cell lysis and protein purification were carried out as described above for SepCysS, with minor variations and omission of pyridoxal phosphate (PLP). All buffers used to purify MA1821 lacked glycerol and contained β-mercaptoethanol (2 mM). 7 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 41

Identification of persulfide modifications by mass spectrometry. SepCysS and MA1821/MA1822 protein samples were dialyzed at 4° C into a buffer lacking glycerol and reducing agents (50 mM tris-HCl (pH 8.0), 100 mM KCl), with a dilution factor of 1:10,000, under anaerobic conditions. To accomplish this, the dialysis buffer was first purged with O2scrubbed nitrogen for 1 hr in a 1 liter pyrex bottle, on a hot plate set to 100°C (to reduce viscosity). Prior to dialysis, the buffer was stoppered and transferred to a 4°C refrigerator. Dialysis was performed in the anaerobic chamber using 3.5kD mwco snakeskin tubing for ~12 hrs. The dialyzed samples were re-assessed for their protein concentrations by UV absorption. Following transfer to 1.5 ml microcentrifuge tubes, solvent was removed from the protein samples under vacuum. Dried protein samples were then resuspended in 4X urea buffer (8 M urea, 1 M trisHCl (pH 8.5), 8 mM CaCl2 and 200 mM methylamine) to a final protein concentration of 0.5 mg/ml. Aliquots (10 µl each) were then distributed into 1.5 ml microcentrifuge tubes for alkylation under either reducing or non-reducing conditions for any disulfides and persulfides present. Anaerobiosis was not maintained at this step, as the MS analysis (below) showed that alkylation was efficient despite competition from oxygen. Reducing conditions were established by supplementing the 10 µl aliquot with 1 µl of 200 mM DTT and incubating for 15 minutes at 50° C followed by 5 minutes at ambient temperature. Alkylation of the reduced samples was then accomplished by addition of 1 µl of a 500 mM solution of iodoacetic acid and incubation for 30 minutes in the dark at ambient temperature. The reaction was quenched by the addition of 1 µl of a 200 mM solution of DTT and an additional 15 minute incubation in the dark at room temperature. Samples were stored for several days at -20° C prior to digestion with trypsin.


Rauch 2015

Page 9 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Samples to be alkylated without prior reduction of disulfides and persulfides were supplemented with 1 µl of a 50 mM solution of iodoacetic acid and incubated for 30 minutes in the dark at room temperature. These reactions were not quenched and were stored for several days at -20° C prior to digestion with trypsin. For proteolytic digestion, all alkylated protein samples were supplemented with water and trypsin to yield 40 µl reaction mixtures, in which proteins to be cleaved were present in 25fold mass excess over trypsin (mass/mass). Reactions were incubated at 37° C overnight and subsequently quenched by the addition of 2 µl of 88% formic acid. Digested samples were analyzed by LC-MS/MS. These conditions yield full tryptic digests. Tryptic digests were analyzed by LC-MS using an Agilent 1100 series capillary LC system (Agilent Technologies Inc, Santa Clara, CA) and an LTQ Velos Pro linear ion trap mass spectrometer (Thermo Scientific, San Jose, CA). Electrospray ionization was performed with an ion max source fitted with a 34 gauge metal needle (Thermo Scientific, cat. no. 9714420040) and 2.7 kV source voltage. Samples were applied at 20 µL/min for 5 min onto a 1 mm diameter peptide Opti-Trap cartridge (Optimize Technologies, Oregon City, OR), and then switched onto a 0.5 x 250 µm Zorbax SB-C18 column with 5 µm particles (Agilent Technologies) using a mobile phase containing 0.1% formic acid, 7-30% acetonitrile gradient over 35 min, and 10 µL/min flow rate. Data-dependent collection of MS/MS spectra used the dynamic exclusion feature of the instrument’s control software (repeat count equal to 1, exclusion list size of 100, exclusion duration of 30 sec, and exclusion mass width of -1 to +4) to obtain MS/MS spectra of the five most abundant parent ions (minimum signal of 10,000) following each survey scan from m/z 350-2000. The tune file was configured with no averaging of microscans, a maximum MS1 inject time of 200 msec, a maximum MS2 inject time of 100 msec, and automatic gain control targets of 3 x 104 in MS1 mode and 1 x 104 in MS2 mode. 9 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 41

Sequest (version 28, revision 12, Thermo Scientific) was used to search MS2 Spectra against an April 2013 version of the Uniprot Methanosarcina acetivorans FASTA protein database, with concatenated sequence-reversed entries to estimate error thresholds and 179 common contaminant sequences and their reversed forms.19 The database processing was performed with python scripts available at http://www.ProteomicAnalysisWorkbench.com. SEQUEST searches for all samples were performed with trypsin enzyme specificity. Average parent ion mass tolerance was 2.5 Da. Monoisotopic fragment ion mass tolerance was 1.0 Da. Several variable modifications were specified for cysteine residues including: +58 Da to account for alkylation with iodoacetic acid, +90 Da for an alkylated cysteine persulfide, -2 Da for a disulfide, and +30 for a Cys-SSS-Cys trisulfide, with a maximum of 3 modifications allowed per peptide. We used a linear discriminant transformation to improve the identification sensitivity from the SEQUEST analysis.20, 21 Histograms of discriminant scores were created separately for each peptide charge state (1+, 2+, and 3+). Separate histograms were also created for matches to both forward and reversed sequences (PAW_convert_3.1.py, version 3.1) for all peptides of seven amino acids or longer. The score histograms for reversed matches were used to estimate peptide false discovery rates (FDR) and set score thresholds for each peptide class that achieved the desired peptide FDR (approximately 5%) for each sample. Peptide to protein mapping and protein filtering were performed using PAW results_6.py (version 6.1). The in-house Python scripts have been described previously.21 Using a minimum requirement for two unique peptide assignments per protein, the number of identified proteins was 302, with eight matches to decoy proteins (2.6% FDR). Under these criteria, there were no peptides identified containing persulfide modifications that matched to sequence reversed database entries. Scaffold (version Scaffold_4.3.4, Proteome Software Inc., Portland, OR) was


Rauch 2015

Page 11 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

used to manually validate MS/MS spectra belonging to peptides with confidently identified persulfide modifications and generate figures for publication.

Measuring SepCysS activity in vitro. Unmodified tRNACys was prepared in accordance with established methods for duplex DNA template synthesis (primers 7-8, Table S1) and in vitro transcription with T7 RNA polymerase.22 The sequence of the tRNACys isoacceptor sequence

used

is

(GCA

anticodon

is

underlined)

5’-

GCCAAGAUGGCGGAGCGGCUACGCAAUCGCCUGCAGAGCGAUUCCAUUCCGGUUCGAAUC CGGAUCUUGGCUCCA. Prior to use in SepCysS activity assays, tRNACys was radiolabeled with 32P

at the 3'-internucleotide linkage. Incorporation of

32P

was catalyzed by tRNA

nucleotidyltransferase and [α-32P]ATP as described.23, 24 Sep-tRNACys was prepared by in vitro aminoacylation of [32P]-tRNACys with phosphoserine (Sep) by SepRS. Reactions were performed at 37° C in SepRS/SepCysS reaction buffer (50 mM NaOAc, 10 mM MgCl2, 20 mM KCl (pH 6.0)), supplemented with 2 mM ATP and 0.8 mM Sep, under aerobic conditions.25 Typically, 2 µM SepRS monomer was used in 10 minute reactions to aminoacylate either 0.5 µM or 10 µM tRNACys. SepRS was separated from the Sep-tRNACys reaction product by extraction with phenol:chloroform:isoamyl alcohol (25:24:1, pH 4.3). Sep-tRNACys was then precipitated by supplementing the aqueous layer with 625 mM ammonium acetate (pH 5.0) and 50% isopropanol and incubating the resulting mixture on ice for 1 hour. A Sep-tRNACys pellet was recovered by centrifugation (30 minutes, 16,000 rcf, 4° C), washed with 70% ethanol and dried under vacuum. Prior to SepCysS reactions, Sep-tRNACys pellets were resuspended in anaerobic TE5 buffer (10 mM NaOAc, 1 mM EDTA, pH 5.0). To control for de-acylation and RNA loss, the recovered Sep-tRNACys was


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 41

analyzed by polyacrylamide gel electrophoresis and thin layer chromatography as described below. SepCysS reactions were carried out in SepRS/SepCysS reaction buffer at 37° C under anaerobic conditions. Reactions were initiated by the addition of Sep-tRNACys and performed in SepRS reaction buffer. Some reactions were further augmented with compounds (DTT, sulfide, thiophosphate, or polysulfide) serving as sources for sulfur and/or reducing equivalents, as specified. The source of heterogeneous polysulfide (K2Sn) was the potassium salt (CAS 37199-66-9, Acros Organics catalog number AC389590010, purchased from Fisher Scientific); an estimated average molecular weight corresponding to the S8 species was used for quantitation. Prior to initiation, reaction components were pre-incubated at 37° C for 10 minutes. Reaction time points (2 µl each) were mixed with 4 µl quench solution (200 mM NaOAc, 0.1 mM Zn(OAc)2 (pH 5.3), 0.0125 U/µl Penicillium citrinum P1 nuclease; Sigma). Quenched time points were digested for 10 minutes at ambient temperature. Liberated nucleotides were separated by thin layer chromatography across 10 cm PEI cellulose sheets (Sigma) in a solvent system consisting of 1 M acetic acid, with pH titrated to 3.5 with NH4OH, and supplemented with 100 mM DTT.

RESULTS

To gain insight into the mechanisms of sulfur trafficking in methanogens, we expressed and purified His-tagged MA1821/MA1822 and SepCysS proteins in M. acetivorans cells, in each case with an expression vector containing the tetracycline-dependent PmcrB(tetO1) promoter derived from the mcrB promoter of Methanosarcina barkeri.7, 26 After purification under anaerobic conditions, we obtained approximately 0.4 milligrams of SepCysS and 1.2 12 ACS Paragon Plus Environment

Rauch 2015

Page 13 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

milligrams of MA1821 per liter of cell culture, sufficient for mass spectrometry and other experiments. MA1821 was expressed together with the companion ferredoxin protein NIL-Fer (MA1822) in an engineered strain lacking the MA1821, MA1822 and OAHS genes (∆ma182122∆oahs) and hence auxotrophic for Hcy in the absence of the expression plasmid,7 while SepCysS was purified from the pseudo wild-type strain WWM75.26 The estimated purity of each preparation based on SDS gel electrophoresis is 60-80% (data not shown). We were unable to express a His-tagged version of MA1715 to significant levels in M. acetivorans cells using the same expression vectors.

Persulfide-dependent mechanism for homocysteine biosynthesis. Bioinformatics analyses coupled with gene knockout experiments in M. acetivorans have established that the ma1821 and ma1822 genes encode proteins that together rescue Hcy auxotrophy in an M. acetivorans strain that also lacks the redundant bacterial OAHS gene for Hcy biosynthesis from sulfide and O-acetylhomoserine (the ∆ma1821-22∆oahs strain).7 Biochemical labeling studies in M. acetivorans cell extracts from wild-type and mutant strains further showed that MA1821 and MA1822 together catalyze the sulfide-dependent conversion of aspartate semialdehyde to Hcy, a previously undescribed catalytic transformation.8 The COG1900a portion of MA1821 and the iron-cluster binding Fer domain of MA1822 are each essential to activity,7 while the regulatory CBS domain (which likely binds S-adenosylmethionine)27 and the NIL domain of NIL-Fer are dispensable. MA1821 also possesses Cys residues at positions 54 and 131 that are conserved among nearly all of its homologs. We used mass spectrometry to identify persulfide groups present on MA1821 expressed in native M. acetivorans. Purified MA1821 was denatured in 8M urea, and sulfhydryl and persulfide groups were alkylated by treatment with iodoacetic acid, which introduces a +58 13 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 41

mass shift. Alkylation eliminates confusion in peptide assignments arising from oxidation,28 while also suppressing artifactual conversions of thiols to disulfides and persulfides to trisulfides. Samples were processed in parallel in either the presence or absence of dithiothreitol (DTT), which provides a key control by reducing persulfides to sulfhydryls. MS/MS fragmentation of a tryptic peptide spanning amino acids 119-134 of MA1821 revealed the +90 mass shift indicative of a cysteine persulfide at Cys131 (Figure 2A; Table 1). The persulfide at Cys131 was observed in 10 of the 23 assigned MS/MS spectra containing this residue, while only one of 24 assigned MS/MS spectra in the sample treated with DTT contained persulfide at this position (Table 1). We also obtained strong evidence for a persulfide group on Cys453 within the C-terminal CBS domain of MA1821 (10 of 28 assigned MS/MS spectra in the absence of DTT possess the +90 mass shift, while only one assigned MS/MS spectrum showed the +90 mass shift with DTT present; Table 1). The regulatory CBS domain is not essential for MA1821 function in Hcy biosynthesis,7 but it is known that these domains can bind S-adenosylmethionine (SAM) and 5’-methylthioadenosine.27 Thus, persulfidation of Cys453 may plausibly modulate the regulatory function. Mass shifts indicative of persulfidation at Cys54 and of disulfide and trisulfide formation at Cys131 and Cys453 were also recorded, but the number of detected peptides exhibiting these features is comparatively very small (Table 1). In a proposed mechanism for the catalytic function of MA1821-MA1822, a sulfane sulfur attacks the aldehyde carbon of aspartate semialdehyde, while the sulfyhydryl group of another active-site cysteine resolves the covalent intermediate by disulfide bond formation on the enzyme, releasing water and a thioaldehyde intermediate. Electron donation by the iron cluster centers of NIL-Fer then reduces the disulfide bond, generating enzyme thiol and thiolate groups. The negatively charged thiolate then attacks the sulfur of the thioaldehyde, resulting in 14 ACS Paragon Plus Environment

Rauch 2015

Page 15 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

reduction of the thioaldehyde to Hcy with addition of an additional proton from water (see Figure 2 of Allen et al.).8 This mechanism accounts for formal hydride transfer to aspartate semialdehyde. The participation of two catalytic cysteines in sulfur transfer reactions – one carrying persulfide and functioning as a nucleophile to form a covalent adduct with substrate, and the second promoting sulfur transfer by generating an enzyme disulfide– is a general feature of these enzymes.6 However, add-back experiments in which rescue of Hcy auxotrophy was examined by introducing plasmid-borne wild-type and mutant genes showed that only Cys54 of MA1821, not Cys131, is essential for rescue in strains lacking chromosomal copies of the ma1821, ma1822 and oahs genes.7 To address this apparent ambiguity, we performed native gel electrophoresis of purified MA1821 under non-reducing aerobic conditions (Figure 2B). This revealed a discrete dimer band, suggesting the possibility of a two-cysteine mechanism involving Cys54 from each monomer (see Discussion). Persulfide groups were also detected in contaminant proteins present in the MA1821 (and SepCysS) preparations (see Table S2 for a list of contaminant peptides bearing Cys residues from preparations of MA1821 and SepCysS). Of 198 Cys-containing peptides that were identified from contaminants, 98 were modified with persulfide (Table S2). This suggests the possibility of a specific role for persulfidation in diverse aspects of M. acetivorans physiology. As observed for MA1821, greatly reduced levels of persulfidation were found for the contaminant proteins when samples were treated with DTT. Interestingly, persulfides were detected at two cysteines of NIL-Fer (MA1822). Since both MA1821 and MA1822 are essential for Hcy biosynthesis, the copurification may indicate that the two proteins form a specific complex in vivo (Fig. 2B). One persulfide in MA1822 is found at Cys8 in the dispensable Nterminal NIL domain of the protein, while the other modifies Cys121 in the essential iron-


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 41

sulfur cluster binding domain (Table 1).7 The functional roles of these persulfide groups, if any, are not known (see Discussion).

M. acetivorans SepCysS carries persulfide in native cells. SepCysS is a PLPdependent enzyme that converts Sep-tRNACys to Cys-tRNACys for protein synthesis, and also provides the only source of free Cys in methanogens lacking OASS (Figure 1).9 Initial studies showed that sodium sulfide could function as the sulfur donor in vitro,9 but under these conditions the enzyme functions weakly, with an estimated catalytic efficiency several hundred-fold lower than SepRS.29 A mechanism involving persulfide and disulfide moieties at the three well-conserved active-site Cys residues was proposed by analogy to the PLPdependent bacterial selenocysteine synthase,29 and drew support from the identification of a persulfide at Cys64 and a disulfide between Cys64 and Cys67 in the M. jannaschii enzyme when expressed in E. coli.16 Remarkably, the E. coli CD IscS is able to transfer sulfur to M. jannaschii SepCysS in an anaerobic in vitro reaction, suggesting that this enzyme functions as the heterologous sulfur donor in E. coli cells.16 However, the identity of the sulfur donor for Cys-tRNACys biosynthesis in methanogens remained unknown, and it is uncertain whether the Cys residues found as disulfide and persulfide groups in E. coli-expressed protein reflect modifications present in native methanogen cells. Mass spectrometry of tryptic peptides from SepCysS expressed and purified from native cells under anaerobic conditions now offers strong evidence for persulfide formation at Cys260 of M. acetivorans SepCysS, one of the three conserved Cys residues located in the active site (Figure 3; Table 1).30 Fourteen of 29 assigned MS/MS spectra containing Cys260 exhibited the +90 mass shift diagnostic of persulfidation, while only one persulfide at Cys260 was observed under reducing conditions. We also detected persulfide formation in five of 14 SepCysS 16 ACS Paragon Plus Environment

Rauch 2015

Page 17 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

assigned MS/MS spectra containing Cys80 and two of six spectra containing Cys186/Cys200, although none of these cysteines is conserved or found in the active site (Table 1). Finally, we detected a disulfide bond bridging Cys51 and Cys54 and an adduct possessing a +30 mass shift, which may correspond to a trisulfide moiety (Figure S1 and Table 1). The equivalent Cys64Cys67 disulfide was also detected in bacterially expressed M. jannaschii SepCysS, but a persulfide modification at the Cys272 (equivalent to Cys260 of M. acetivorans SepCysS) was not reported.16 All three cysteines are important for activity, based on an assay detecting the insertion of Cys (formed by SepCysS) at an active-site selenocysteine codon of formate dehydrogenase expressed in E. coli.31, 32

Catalytic activity of SepCysS. The finding that SepCysS expressed in M. acetivorans carries a persulfide group at Cys260 suggests that the sulfane sulfur at this position could be transferred to Sep-tRNACys. To examine this possibility, we synthesized an M. acetivorans tRNACys isoacceptor in vitro using T7 RNA polymerase, phosphoserylated the tRNA with Sep using purified SepRS, and employed the Sep-tRNACys product as a substrate in assays of SepCysS function without any exogenously added sulfur. Single-turnover reactions were conducted with SepCysS dimer in 15-fold molar excess over tRNA (750 nM SepCysS dimer; 50 nM

32P-labeled

Sep-tRNACys). Reactions were quenched, processed to 5’-monophosphorylated

nucleotides with RNase P1, and subjected to TLC for separation of

32P-Sep-Ap*

from

32P-Cys-

Ap* (where Ap* is derived from the 3’-aminoacylated A76 of tRNA) (Figures 4, S2). The observation of Cys-tRNACys formation in this assay, without addition of exogenous sulfur, strongly suggests that the sulfane sulfur at Cys260 of M. acetivorans SepCysS is transferred to tRNACys for incorporation into proteins in this organism. Cys-tRNACys formation reaches a maximum 23% conversion at 160 seconds (Figure 4B). Decreasing levels of Cys-tRNACys at 17 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 41

later timepoints reflect RNase A contamination in the SepCysS protein preparation (Figure S2). Proposed mechanisms for SepCysS catalysis require both exogenous reductant and a source of sulfur, each of which is necessary to observe multiple turnover reactions.16 To examine whether inclusion of reductants and sulfur sources influences catalysis in our experiments, we assayed SepCysS after pre-incubating the enzyme with 5 mM DTT. With DTT present, Cys-tRNACys formation is accelerated by roughly five-fold, and reaches an increased maximum of 35-40% conversion at 160 seconds (Figures 4, 5). Further addition of 1 mM sodium sulfide, 1 mM polysulfide (supplied as a heterogeneous mixture with an assumed average molecular weight corresponding to S8), or 1 mM thiophosphate each resulted in slightly increased product yields under single-turnover conditions, although maximum conversions remained substoichiometric (Figure 4). Both polysulfide and thiophosphate can plausibly provide electrons for disulfide cleavage.33 Since comparable enhancement was observed for all three compounds, we suggest that the common ability of each reagent to reduce a disulfide bond may account for the observations (see Discussion). Because M. jannaschii SepCysS is known to form a binary complex with SepRS,25, 34 we also tested whether addition of purified M. acetivorans SepRS affected reaction rates, perhaps by stabilizing the substrate complex with Sep-tRNACys. However, addition of SepRS in stoichiometric quantities to SepCysS did not influence the rate or extent of conversion (data not shown). Under all conditions we also performed multiple-turnover reactions in which Cys-tRNASep was provided in molar excess over enzyme. However, while activity is readily observed under conditions where the concentration of Sep-tRNACys is about two-fold above SepCysS (Figure 5), we have not been able to measure significant activities under the higher substrate concentrations necessary to derive steady-state kinetic parameters. In part, this limitation arises from 18 ACS Paragon Plus Environment

Rauch 2015

Page 19 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

difficulties in accurately monitoring Cys-tRNACys by this assay when the amounts formed are low relative to Sep-tRNACys substrate levels (Figure S2). To examine what proportion of SepCysS is catalytically active under single-turnover conditions, we preincubated 800 nM SepCysS dimer with 5 mM DTT and carried out reactions with increasing amounts of Sep-tRNACys from 50 nM to 1.65 µM. In this experiment the CystRNACys yield increased linearly up to 700 nM substrate (Figure 5). The plateau Cys-tRNACys yield in the 1.1 µM to 1.65 uM Sep-tRNACys substrate range is approximately 400 nM, about 25% of the monomeric SepCysS concentration. The binding stoichiometry of tRNA to SepCysS dimer is not known. However, since roughly half the MS/MS spectra for peptides that contain Cys260 showed modification with persulfide (Table 1), the plateau yield is consistent with full activity if half of the SepCysS active sites are catalytically competent. While the existence of half-of-the-sites reactivity has not been studied for SepCysS, it has been established in the case of phosphoseryl-AMP formation by the SepRS homotetramer, which binds two tRNAs.17 This is relevant since SepRS and SepCysS are known to form a complex.25, 34

DISCUSSION The data presented here support and extend our understanding of the novel pathways by which sulfur is assimilated and distributed in methanogens. We have previously shown that the highly conserved MA1715 protein is essential for efficient sulfide uptake in a variety of genetic backgrounds in M. acetivorans, permitting growth at ambient concentrations as low as 50 µM.10 Importantly, the impaired growth of MA1715 deletion strains at these low sulfide concentrations can be reconstituted to wild-type levels upon supplementation of the growth media with either Cys or Hcy. This suggests that MA1715 supports efficient biosynthesis of both Cys and Hcy, especially at low ambient sulfide concentrations.10 Our present finding that 19 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 41

persulfides are found on active-site cysteine residues of SepCysS and MA1821 thus supports the hypothesis that MA1715 binds ambient sulfide, facilitates its oxidation to sulfane, and transfers sulfane sulfur to both of these proteins for Cys and Hcy biosynthesis, respectively.10 This appears to represent a new CD-independent biochemical process, found in all organisms that also encode SepCysS and/or MA1821/MA1822,7 by which an initial persulfide group can be generated and potentially feed a variety of downstream pathways.1,

6

In methanogens

lacking CDs, the MA1715 homolog is presently the only known candidate protein that may promote persulfide formation. Because CDs are present in M. acetivorans, however, the origins of the sulfane sulfur detected here on SepCysS and MA1821 are uncertain. Mass spectrometry of these proteins purified from M. acetivorans strains with different genetic backgrounds, or of SepCysS and MA1821 isolated from methanogens lacking CDs, could clarify this important issue. SepCysS and MA1821 in methanogens that lack CDs are homologs of the M. acetivorans enzymes, and thus likely also function through persulfide intermediates. Nevertheless, it is plausible that enzymes functioning optimally through persulfide intermediates may also possess alternative catalytic pathways that bypass the persulfide formation and resolution steps by allowing bisulfide to react directly (see the discussion of the MA1821-22 mechanism below).8 It may also be likely that fewer persulfides populate cellular proteins in methanogens, such as M. maripaludis, that lack CDs (here, 98 Cys persulfides were detected on peptides derived solely from the contaminants in two protein preparations each purified to 60-80% homogeneity; Table S2). In general, little is yet known of the sulfur assimilation pathways in microorganisms that either do or do not possess CDs, and the complex phylogenetic history of the CD enzyme family complicates efforts to gain a clear understanding of how sulfur


Rauch 2015

Page 21 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

trafficking systems evolved.12 Further and more comprehensive examinations of persulfide modifications in the proteomes of other microorganisms are clearly of interest.

Enzymatic mechanism of Hcy formation from aspartate semi-aldehyde by MA1821-22. As described above, the presence of two conserved cysteines (Cys54 and Cys131) in the catalytic domain of MA1821 suggested a mechanism consistent with general principles of sulfur reactivity in enzymes, by which a sulfane sulfur present on one of the cysteines attacks the aldehyde carbon of aspartate semi-aldehyde to yield a disulfide hemiacetal adduct. The thiolate of the other Cys then reacts with the disulfide to yield an enzyme-bound thioaldehyde intermediate with release of water.8 Mass spectrometry of purified MA1821 produced in the native cells clearly supports this mechanism by providing strong evidence for a persulfide group at Cys131 (Figure 2A). These data also provide evidence against an alternative proposed mechanism by which bisulfide (HS-) reacts directly with aspartate semialdehyde, to generate the thioaldehyde in one step without passing through the persulfide intermediate.8 Homocysteine auxotrophy in the engineered M. acetivorans strain carrying chromosomal deletions of the ma1821, ma1822 and oahs genes (∆ma1821-22∆oahs) is fully relieved when a plasmid coexpressing the MA1821 and MA1822 proteins is present.7 Further add-back experiments in this system showed that introducing the C54A mutation into MA1821 no longer relieves auxotrophy, demonstrating that Cys54 is essential for Hcy biosynthesis. However, Cys131 was nonessential by this approach.7 The finding here that Cys131 carries the persulfide group can be understood by recognizing that in M. acetivorans both MA1715 and CDs are potential sources of persulfide, and these proteins may modify different Cys residues in the same target. Figure 6 offers a plausible explanation that reconciles the nonessentiality of Cys131, the capacity of MA1821 to dimerize (Figure 2B), and the finding that Cys131 carries the 21 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 41

persulfide group in a context where both Cys131 and Cys54 are present. Cys54 must be capable of accepting the sulfane sulfur when Cys131 is mutated to alanine (Figure 6, left). Subsequently, the two-cysteine mechanism consistent with principles of sulfur reactivity in other persulfidedependent enzymes can then be satisfied via disulfide formation with Cys54 from each subunit. Conservation of Cys131 despite its nonessentiality can be explained if it is the obligate target of persulfidation with a sulfane sulfur derived from MA1715, which is co-conserved with MA1821 in all methanogens (Figure 6, right). In this case, an intradomain persulfide transfer to Cys54 might occur to facilitate the same intersubunit mechanism; alternatively, the enzyme may be active as a monomer. Further insights into the possible functional roles of persulfidation at Cys131, Cys54, and Cys453 will likely require X-ray structure analysis of the MA1821 and MA1822 proteins. No structural information is presently available for any protein in the COG1900 family. The catalytic or regulatory roles of the persulfides found on MA1822 (Table 1), if any, are also unknown.

Enzymatic mechanism of Cys-tRNACys biosynthesis by SepCysS. The identification of Cys260 as a persulfide carrier in SepCysS expressed in native methanogen cells (Figure 3) helps to clarify proposed mechanisms for the enzyme. Earlier experiments in which M. jannaschii SepCysS was expressed in E. coli revealed that a sulfane sulfur is carried by Cys64 and Cys67 of the enzyme (equivalent to Cys51 and Cys54 of the M. acetivorans enzyme).16 These experiments did not identify either persulfide or disulfide modification of Cys272 (corresponding to Cys260 of M. acetivorans SepCysS), despite other findings that this residue is essential to function.31 The mass spectrometry data for E. coli-expressed SepCysS, of course, does not necessarily capture all elements of the native cellular milieu. Here, we repeatedly identified persulfide on Cys260 (14 observations of sulfane sulfur at this position; Table 1), and 22 ACS Paragon Plus Environment

Rauch 2015

Page 23 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

confirmed its functional relevance in assays monitoring the conversion of Sep-tRNACys to CystRNACys without exogenously added sulfur (Figures 4, 5). Together, these data offer strong evidence that native SepCysS carries sulfane sulfur on conserved Cys260, and that this sulfur is the source of the Cys sulfhydryl group on ribosomally synthesized proteins. Our findings also support the proposal that the two active sites in the SepCysS dimer work together to promote a single reaction, as the crystal structure of the Archaeoglobus fulgidus enzyme showed that the homolog of Cys260 is positioned near the PLP binding site of the opposing subunit.30 We also identified a disulfide between Cys51 and Cys54 of M. acetivorans SepCysS. In this case our data on the native enzyme are equivalent to the earlier findings on E. coli-expressed M. jannaschii SepCysS.16 In that study, several chemical tests performed on wild-type and mutant enzymes also suggested that a disulfide could be formed between the equivalent Cys64 and Cys67 of the M. jannaschii enzyme. Combining these data then suggests a three-cysteine mechanism in which the Cys260 sulfane sulfur attacks the unsaturated electrophilic carbon center of a PLP-based intermediate (Figure 7). This forms a covalent persulfide adduct which is resolved by attack from the sulfhydryl of either Cys51 or Cys54, to release Cys-tRNACys while forming a disulfide with Cys260. The proposed steps to regenerate the enzyme for the next catalytic turnover produce the detected Cys51-Cys54 disulfide, which then requires an exogenous source of electrons to reduce this linkage. Transfer of sulfane sulfur from a sulfur donor, either a native CD or the MA1715 protein, completes the catalytic cycle (Figure 7). Challenges associated with elucidation of the SepCysS mechanism arise in part because measurements under multiple turnover conditions require a regeneration system that includes both a reductant and a source of sulfur for persulfidation of Cys260 in subsequent rounds of catalysis. Although the identities of these components in the native cell are not known, we reasoned that inclusion of reduced, sulfur-containing reagents could provide a means of 23 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 41

gaining further mechanistic insights. Interestingly, we found that addition of DTT increased both Cys-tRNACys formation rates and plateau levels (Figures 4, 5). This observation can be rationalized if our SepCysS preparations consist of a mixed population possessing either the Cys51-Cys54 disulfide, or reduced thiols at these positions. The presence of reduced thiols, as shown in Fig. 7, can explain the significant level of activity in the absence of added DTT (Fig. 4B, open squares). Enhancement of that activity when DTT is supplemented then occurs via activation of another subpopulation of the enzyme that possesses the Cys51-Cys54 disulfide instead. Electron transfer from DTT generates a greater fraction of total enzyme that is present in a functional form in the single-turnover reactions (Fig. 4B). The further addition of sulfide, polysulfide or thiophosphate may improve plateau levels and rates of product formation by the same general mechanism. Alternatively, it is also possible that these reagents may exert an unanticipated effect on the structure of the tRNA substrate, to enable higher levels of conversion. Although lower concentrations of Sep-tRNACys (50 – 700 nM) allow for about 35-40% conversion to product when DTT alone is supplemented (Figures 4, 5), at higher concentrations plateau levels of product formation reach only about 25% of the concentration of SepCysS active sites. The proportion of MS/MS spectra showing the existence of a persulfide at SepCysS Cys260 is about 50% (Table 1), and this provides the best guidance for estimating the fraction of active enzyme. Although there is no direct experimental information, it is plausible that SepCysS may exhibit half-of-the-sites activity, given that this phenomenon is observed in SepRS and that the two proteins form a complex.34 Moreover, one of two independent crystal structures of the SepCysS dimer revealed PLP binding in only one of the two subunits, and both X-ray structures suggested that the conserved cysteine residues could contribute to catalysis in the opposing subunit.30 If half-of-the-sites activity indeed is present, 24 ACS Paragon Plus Environment

Rauch 2015

Page 25 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

then 25% plateau levels suggest that all of the SepCysS that carries persulfide may be active. At low substrate concentrations in the presence of polysulfide or thiophosphate, plateau levels reach as high as 60% (Figure 4B), but we do not know if this observed activity might arise in part from limited multiple-turnover reactions. Further work to identify the sulfane sulfur donor to Cys260 and the source of exogenous reductant is clearly needed to advance understanding of the SepCysS mechanism. Very recently, it was reported that, when expressed in E. coli, M. jannaschii SepCysS binds a 3Fe-4S cluster through its three conserved active-site cysteines (Cys 64, Cys67 and Cys272).35 Although we have not observed a brownish color in our SepCysS preparation nor UV-visible spectra consistent with the presence of a 3Fe-4S cluster, it is possible that this or a related ironsulfur cluster could serve as the reductant in native methanogen cells. The finding that persulfide intermediates are crucial to both Cys and Hcy biosynthesis in M. acetivorans offers important additional insight into the nature of the unusual sulfur assimilation pathways in methanogens. Unique mechanisms for tRNA-mediated Cys biosynthesis,9 and Hcy biosynthesis via reductive thiolation of aspartate semialdehyde,7, 8 are now established. The most important missing insight may emerge from elucidating the precise biochemical activity associated with MA1715. This protein functions in vivo as a highly efficient sulfide biosensor, is implicated in efficient biosynthesis of both Cys and Hcy, and is almost universally conserved in methanogens together with MA1821/MA1822 and SepCysS.10 Understanding of the persulfide-based mechanisms of SepCysS and MA1821/MA1822 will remain incomplete until the nature of the sulfur relay chain is fully appreciated at the biochemical level.

Acknowledgments 25 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 41

Funding for this work was provided by NASA grant NNX15AP59G (to J.J.P.) and NIH P30 grants EY10572 and CA069533, and S10 grant RR025571 (to L.D.).

Figure legends

Figure 1. A. Canonical sulfur assimilation pathways found in many aerobic organisms. The four-step conversion of sulfate to sulfide requires energy in the form of ATP. Multiple persulfide transfer pathways for distribution of sulfur are depicted by the dotted line. CysRS; cysteinyl-tRNA synthetase; MS, methionine synthase; CD, cysteine desulfurase; OASS, Oacetylserine sulfhydrylase; OAHS, O-acetylhomoserine sulfhydrylase; CGS, cystathione γsynthase; CBL, cystathionine β-lyase; CBS, cystathione β-synthase; CGL, cystathionine γ-lyase. CGS, CBL, CBS and CGL comprise the “transsulfuration” enzymes. B. Sulfur assimilation pathways

in

the

ancestral

hydrogenotrophic

methanogens,

exemplified

by

Methanocaldococcus jannaschii. Other contemporary methanogens, such as Methanosarcina acetivorans, also possess some of the enzymes found in contemporary aerobes, shown in panel A. SepRS, phosphoseryl-tRNA synthetase; SepCysS, Sep-tRNA:Cys-tRNA synthase.

Figure 2. A. Sample MS/MS fragmentation spectra detecting persulfide on MA1821. The depicted spectra for the tryptic peptide 119-ELDVHATSTGTDCTPR-134 are consistent with +58 (top spectrum) and +90 (lower spectrum) mass shifts at cysteine, which are to be expected


Rauch 2015

Page 27 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

for cysteine (+0) and cysteine persulfide (+32), alkylated with iodoacetate (+58). Parent (green), b-series (red) and y-series (blue) ions are labeled on each spectrum.

B. MA1821 exhibits DTT-dependent dimerization. SDS PAGE of MA1821-His8 and MA1822His6 copurified by expression from a plasmid in M. acetivorans. The proteins were purified anaerobically by affinity chromatography using an immobilized-nickel resin (see Methods). Protein samples were analyzed by SDS PAGE under aerobic conditions with (1) or without (2) dithiothreitol present as a reducing agent in the loading dye. The dye also contained SDS as a denaturant. The predicted molecular weights of MA1821-H8 and MA1822-H6 are 55.4 kDa and 15.3 kDa, respectively.

Figure 3. Sample MS/MS fragmentation spectra detecting persulfide on SepCysS. The depicted spectra for the tryptic peptide 252-VKEVELLGCTAR-263 from M. acetivorans SepCysS is consistent with +58 (above) and +90 (below) mass shifts at cysteine, which is to be expected for persulfide (+32) that is alkylated with iodoacetate (+58). The detected parent (green), bseries (red) and y-series (blue) ions are labeled on each spectrum.

Figure 4. Conversion of Sep-tRNACys to Cys-tRNACys by SepCysS. (A) TLC sheets, visualized by phosphorimaging, depict the enzymatic activity of SepCysS. Reactions contain 1.5 µM monomeric units of SepCysS and approximately 50 nM Sep-tRNACys. Prior to each reaction, SepCysS was pre-incubated with DTT (5 mM), sodium sulfide (1 mM), polysulfide (1 mM) and/or thiophosphate (1 mM). Control experiments established the identity of the Cys-Ap* migrating spot and demonstrated that activities are not due to nuclease contamination (see Figure S2 for details). The P1 label at bottom denotes P1 nuclease; the spot at the origin in 27 ACS Paragon Plus Environment

Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 41

lanes lacking P1 indicates undigested tRNA. (B) Plot depicting the percent conversion of SeptRNACys to Cys-tRNACys without additives (□), or supplemented with 5 mM DTT alone (■), 5 mm DTT and 1 mM sulfide (▲), 5 mM DTT and 1 mM polysulfide (●) or 5 mM DTT and 1 mM thiophosphate (▼). Data were derived from TLC experiments using ImageJ software. Individual data points reflect the mean of three independent trials. Error bars reflect standard deviations at each timepoint. The data were fit to a one-phase association equation: Y=Y0 + (Plateau-Y0)*(1-exp(-k*x)), where k is the rate of product formation. These rates of product formation were derived: k=0.008 ± 0.003 (no additives); k=0.039 ± 0.006 (+DTT); k=0.056 ± 0.004 (+DTT and sulfide); k=0.074 ± 0.015 (+DTT and polysulfide); k=0.065 ± 0.018 (+DTT and thiophosphate). Error values correspond to 95% confidence intervals and provide a rough estimate of the rate enhancements, but do not reflect bona fide rate constants corresponding to particular events on the enzyme.

Figure 5. Approximating the persulfide load of SepCysS. (Left) Plot relating Cys-tRNACys yield to initial substrate concentration. Data for Sep-tRNACys concentrations below 1.1 µM were fit to a linear function (black dotted line). Prior to each reaction, SepCysS was pre-incubated with 5 mM DTT in reaction buffer for 10 minutes at 37° C. Data points represent the mean of four experimental replicates. Error bars reflect standard deviation. For reference, the monomeric concentration of SepCysS (1.5 µM) is shown. (Right) Re-plot of percent conversion for data exhibiting a linear relation between initial substrate concentration and product formed. For reference, the mean percent conversion for this dataset (35%) is represented (black line).


Rauch 2015

Page 29 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 6. Alternative mechanisms for catalytic function of MA1821/MA1822 may depend on the delivery of sulfane sulfur by cysteine desulfurase (CD) to conserved Cys54 (left panel), or, in the alternative, delivery of sulfane sulfur from MA1715. MA1715 is implicated as a plausible novel persulfide delivery protein based on indirect bioinformatics and genetics data. See text for details.

Figure 7. Proposed catalytic mechanism of SepCysS based on combining the data reported here with that reported in the study of E. coli-expressed M. jannaschii SepCysS by Liu et al. (ref. 16). Several steps in the generation and resolution of the PLP intermediate with tRNA are not shown for clarity. The identity of the exogenous electron source is not known. The identifier MA1715/CD indicates that either protein may be the source of sulfane sulfur relay to Cys260. Although resolution of the persulfide adduct by attack of Cys51 is depicted (upper right), attack by Cys54 is also consistent with the experimental data.


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 41

TABLE 1

Table 1 Assigned MS/MS spectra with conserved cysteines + DTT locus protein residue -2 +30 +58 +90 -2 MA0722 SepCysS C260 0 0 26 1 0 MA0722 SepCysS C51/C54 0 0 2 0 2 MA0722 SepCysS C80 0 0 16 0 0 MA0722 SepCysS C186/C200 0 0 8 0 0 MA1821 COG1900a C131 0 0 21 1 1 MA1821 COG1900a C54 0 0 1 0 0 MA1821 COG1900a C453 0 0 33 1 1 MA1822 NIL/Fer C8 0 0 9 0 0 MA1822 NIL/Fer C121 0 0 13 0 0

aThe

a

- DTT +30 +58 0 15 1 0 0 9 0 4 0 8 0 0 2 15 0 0 0 1

+90 14 0 5 2 11 1 10 1 2

number of times a peptide was detected with each indicated mass shift is shown for all detected

Cys-containing peptides in MA0722, MA1821 and MA1822. MA1822 peptides were detected in the purified MA1821 protein sample. +90 mass shifts arise via a +58 mass shift from alkylation added to a +32 mass shift for the sulfane sulfur, and thus indicate persulfidation. Peptides with a +58 mass shift are generated from alkylation of a Cys sulfhydryl. The -2 mass shift is associated with formation of a disulfide bond from two Cys sulfhydryls. We interpret the +30 mass shift as a trisulfide group presumably formed by addition of a bridging sulfane (persulfide) sulfur to a disulfide bond.


Rauch 2015

Page 31 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 1


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 41

Figure 2A

Figure 2B


Rauch 2015

Page 33 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 3


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 41

Figure 4 A.

B.


Rauch 2015

Page 35 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 5


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 41

Figure 6


Rauch 2015

Page 37 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 7


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 41

For Table of Contents use only


Rauch 2015

Page 39 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

REFERENCES [1] Liu, Y., Beer, L. L., and Whitman, W. B. (2012) Methanogens: a window into ancient sulfur metabolism, Trends Microbiol 20, 251-258. [2] Sekowska, A., Kung, H. F., and Danchin, A. (2000) Sulfur metabolism in Escherichia coli and related bacteria: facts and fiction, J Mol Microbiol Biotechnol 2, 145-177. [3] Bult, C. J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D., Sutton, G. G., Blake, J. A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D., Kerlavage, A. R., Dougherty, B. A., Tomb, J. F., Adams, M. D., Reich, C. I., Overbeek, R., Kirkness, E. F., Weinstock, K. G., Merrick, J. M., Glodek, A., Scott, J. L., Geoghagen, N. S., and Venter, J. C. (1996) Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii, Science 273, 1058-1073. [4] White, R. H. (2003) The biosynthesis of cysteine and homocysteine in Methanococcus jannaschii, Biochim Biophys Acta 1624, 46-53. [5] Hidese, R., Mihara, H., and Esaki, N. (2011) Bacterial cysteine desulfurases: versatile key players in biosynthetic pathways of sulfur-containing biofactors, Appl Microbiol Biotechnol 91, 47-61. [6] Mueller, E. G. (2006) Trafficking in persulfides: delivering sulfur in biosynthetic pathways, Nat Chem Biol 2, 185-194. [7] Rauch, B. J., Gustafson, A., and Perona, J. J. (2014) Novel proteins for homocysteine biosynthesis in anaerobic microorganisms, Mol Microbiol 94, 1330-1342. [8] Allen, K. D., Miller, D. V., Rauch, B. J., Perona, J. J., and White, R. H. (2015) Homocysteine is biosynthesized from aspartate semialdehyde and hydrogen sulfide in methanogenic archaea, Biochemistry 54, 31293132. [9] Sauerwald, A., Zhu, W., Major, T. A., Roy, H., Palioura, S., Jahn, D., Whitman, W. B., Yates, J. R., 3rd, Ibba, M., and Soll, D. (2005) RNA-dependent cysteine biosynthesis in archaea, Science 307, 1969-1972. [10] Rauch, B. J., and Perona, J. J. (2016) Efficient Sulfide Assimilation in Methanosarcina acetivorans Is Mediated by the MA1715 Protein, J Bacteriol 198, 1974-1983. [11] O'Donoghue, P., Sethi, A., Woese, C. R., and Luthey-Schulten, Z. A. (2005) The evolutionary history of CystRNACys formation, Proc Natl Acad Sci U S A 102, 19003-19008. [12] Hidese, R., Inoue, T., Imanaka, T., and Fujiwara, S. (2014) Cysteine desulphurase plays an important role in environmental adaptation of the hyperthermophilic archaeon Thermococcus kodakarensis, Mol Microbiol 93, 331-345. [13] Liu, Y., Sieprawska-Lupa, M., Whitman, W. B., and White, R. H. (2010) Cysteine is not the sulfur source for iron-sulfur cluster and methionine biosynthesis in the methanogenic archaeon Methanococcus maripaludis, J Biol Chem 285, 31923-31929. [14] Liu, Y., Zhu, X., Nakamura, A., Orlando, R., Soll, D., and Whitman, W. B. (2012) Biosynthesis of 4-thiouridine in tRNA in the methanogenic archaeon Methanococcus maripaludis, J Biol Chem. [15] Liu, Y., Long, F., Wang, L., Soll, D., and Whitman, W. B. (2014) The putative tRNA 2-thiouridine synthetase Ncs6 is an essential sulfur carrier in Methanococcus maripaludis, FEBS Lett 588, 873-877. [16] Liu, Y., Dos Santos, P. C., Zhu, X., Orlando, R., Dean, D. R., Soll, D., and Yuan, J. (2012) Catalytic Mechanism of Sep-tRNA:Cys-tRNA Synthase: SULFUR TRANSFER IS MEDIATED BY DISULFIDE AND PERSULFIDE, J Biol Chem 287, 5426-5433. [17] Hauenstein, S. I., Hou, Y. M., and Perona, J. J. (2008) The homotetrameric phosphoseryl-tRNA synthetase from Methanosarcina mazei exhibits half-of-the-sites activity, J Biol Chem 283, 21997-22006. [18] Lessner, F. H., Jennings, M. E., Hirata, A., Duin, E. C., and Lessner, D. J. (2012) Subunit D of RNA polymerase from Methanosarcina acetivorans contains two oxygen-labile [4Fe-4S] clusters: implications for oxidant-dependent regulation of transcription, J Biol Chem 287, 18510-18523. [19] Elias, J. E., and Gygi, S. P. (2007) Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry, Nat Methods 4, 207-214. [20] Keller, A., Nesvizhskii, A. I., Kolker, E., and Aebersold, R. (2002) Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search, Anal Chem 74, 5383-5392. [21] Wilmarth, P. A., Riviere, M. A., and David, L. L. (2009) Techniques for accurate protein identification in shotgun proteomic studies of human, mouse, bovine, and chicken lenses, Journal of ocular biology, diseases, and informatics 2, 223-234.


Rauch 2015

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 41

[22] Sherlin, L. D., Bullock, T. L., Nissan, T. A., Perona, J. J., Lariviere, F. J., Uhlenbeck, O. C., and Scaringe, S. A. (2001) Chemical and enzymatic synthesis of tRNAs for high-throughput crystallization, RNA 7, 16711678. [23] Wolfson, A. D., and Uhlenbeck, O. C. (2002) Modulation of tRNAAla identity by inorganic pyrophosphatase, Proc Natl Acad Sci U S A 99, 5965-5970. [24] Rauch, B. J., Porter, J. J., Mehl, R. A., and Perona, J. J. (2016) Improved Incorporation of Noncanonical Amino Acids by an Engineered tRNA(Tyr) Suppressor, Biochemistry 55, 618-628. [25] Zhang, C. M., Liu, C., Slater, S., and Hou, Y. M. (2008) Aminoacylation of tRNA with phosphoserine for synthesis of cysteinyl-tRNA(Cys), Nat Struct Mol Biol 15, 507-514. [26] Guss, A. M., Rother, M., Zhang, J. K., Kulkarni, G., and Metcalf, W. W. (2008) New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species, Archaea 2, 193-203. [27] Lucas, M., Encinar, J. A., Arribas, E. A., Oyenarte, I., Garcia, I. G., Kortazar, D., Fernandez, J. A., Mato, J. M., Martinez-Chantar, M. L., and Martinez-Cruz, L. A. (2010) Binding of S-methyl-5'-thioadenosine and Sadenosyl-L-methionine to protein MJ0100 triggers an open-to-closed conformational change in its CBS motif pair, J Mol Biol 396, 800-820. [28] Zheng, L., White, R. H., Cash, V. L., Jack, R. F., and Dean, D. R. (1993) Cysteine desulfurase activity indicates a role for NIFS in metallocluster biosynthesis, Proc Natl Acad Sci U S A 90, 2754-2758. [29] Hauenstein, S. I., and Perona, J. J. (2008) Redundant synthesis of cysteinyl-tRNACys in Methanosarcina mazei, J Biol Chem 283, 22007-22017. [30] Fukunaga, R., and Yokoyama, S. (2007) Structural insights into the second step of RNA-dependent cysteine biosynthesis in archaea: crystal structure of Sep-tRNA:Cys-tRNA synthase from Archaeoglobus fulgidus, J Mol Biol 370, 128-141. [31] Helgadottir, S., Sinapah, S., Soll, D., and Ling, J. (2012) Mutational analysis of Sep-tRNA:Cys-tRNA synthase reveals critical residues for tRNA-dependent cysteine formation, FEBS Lett 586, 60-63. [32] Yuan, J., Hohn, M. J., Sherrer, R. L., Palioura, S., Su, D., and Soll, D. (2010) A tRNA-dependent cysteine biosynthesis enzyme recognizes the selenocysteine-specific tRNA in Escherichia coli, FEBS Lett 584, 2857-2861. [33] Neumann, H., Goldberger, R. F., and Sela, M. (1964) INTERACTION OF PHOSPHOROTHIOATE WITH THE DISULFIDE BONDS OF RIBONUCLEASE AND LYSOZYME, J Biol Chem 239, 1536-1540. [34] Liu, Y., Nakamura, A., Nakazawa, Y., Asano, N., Ford, K. A., Hohn, M. J., Tanaka, I., Yao, M., and Soll, D. (2014) Ancient translation factor is essential for tRNA-dependent cysteine biosynthesis in methanogenic archaea, Proc Natl Acad Sci U S A. [35] Liu, Y., Vinyard, D. J., Reesbeck, M. E., Suzuki, T., Manakongtreecheep, K., Holland, P. L., Brudvig, G. W., and Soll, D. (2016) A [3Fe-4S] cluster is required for tRNA thiolation in archaea and eukaryotes, Proc Natl Acad Sci U S A.


Rauch 2015

Page 41 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

Biochemistry

ACS Paragon Plus Environment

Persulfide Formation Mediates Cysteine and Homocysteine

Recommend Documents