Article Cite This: Chem. Res. Toxicol. 2019, 32, 1441−1448
pubs.acs.org/crt
Pesticide Exposure Modifies DNA Methylation of Coding Region of WRAP53α, an Antisense Sequence of p53, in a Mexican Population Diana M. Paredes-Ceś pedes,†,‡ Jose ́ F. Herrera-Moreno,†,‡ Yael Y. Bernal-Hernań dez,† Irma M. Medina-Díaz,† Ana M. Salazar,§ Patricia Ostrosky-Wegman,§ Briscia S. Barroń -Vivanco,† and Aurora E. Rojas-García*,†
Downloaded via BUFFALO STATE on July 24, 2019 at 14:56:15 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
†
Laboratorio de Contaminación y Toxicología Ambiental, Secretaría de Investigación y Posgrado, Universidad Autónoma de Nayarit, 63155, Ciudad de la Cultura s/n. Col. Centro, C.P. 63000, Tepic, Nayarit, México ‡ Posgrado en Ciencias Biológico Agropecuarias, Unidad Académica de Agricultura, Km. 9 Carretera Tepic-Compostela, Xalisco, Nayarit, México § Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México (UNAM), P.O. Box 70228, Ciudad Universitaria, México DF 04510, México ABSTRACT: The influence of pesticide exposure in alteration of DNA methylation patterns of specific genes is still limited, specifically in natural antisense transcripts (NAT), such as the WRAP53α gene. The aim of this study was to determine the methylation of the WRAP53α gene in mestizo and indigenous populations as well as its relationship with internal (age, sex, and body mass index) and external factors (pesticide exposure and micronutrient intake). A crosssectional study was conducted including 91 mestizo individuals without occupational exposure to pesticides, 164 mestizo urban sprayers and 189 indigenous persons without occupational exposure to pesticides. Acute pesticide exposure was evaluated by measurement of urinary dialkylphosphate (DAP) concentration by gas chromatograph coupled to a mass spectrometer. Anthropometric characteristics, unhealthy habits, and chronic pesticide exposure were assessed using a structured questionnaire. The frequency of macro- and micronutrient intake was determined using SNUT software. DNA methylation of the WRAP53α gene was determined by pyrosequencing of bisulfite-modified DNA. The mestizo sprayers group had the higher values of %5mC. In addition, this group had the most DAP urinary concentration with respect to the indigenous and reference groups. Bivariate analysis showed an association between %5mC of the WRAP53α gene with micronutrient intake and pesticide exposure in mestizo sprayers, whereas changes in %5mC of the WRAP53α gene was associated with body mass index in the indigenous group. These data suggest that the %5mC of the WRAP53α gene can be influenced by pesticide exposure and ethnicity in the study population, and changes in the WRAP53α gene might cause an important cell process disturbance.
■
INTRODUCTION
whereas hypermethylation is associated with repression of gene transcription and loss of cycle cellular control.2,7 Previously, some studies have linked epigenetic changes with exposure to different pollutants.8−10 Several in vitro and in vivo studies suggest that environmental contaminants, such as polycyclic aromatic hydrocarbons, persistent organic compounds, metals and pesticides, among others, cause epigenetic modifications, which may explain, in part, specific mechanisms of toxicity of these compounds, because the modifications persist even in the absence of the original factors that generated them.10,11 However, few studies have investigated the methylation patterns of genes involved in suppressor gene modulation, such
DNA methylation in mammals occurs by a modification of covalent type in carbon 5 of the cytosine in dinucleotide cytosine guanine (CpG) that is distributed throughout the human genome (approximately 1 kb), concentrated mainly in sites known as CpG islands.1 These islands are usually located in the promoter region of genes and permit generation of a particular pattern of methylation for each tissue and are genespecific. Furthermore, changes in methylation in these regions are related to the transcriptional silencing and alteration in gene activity.2,3 Changes in gene-specific methylation (hypo- and hypermethylation) could have consequences on the expression or repression of genes.4,5 Hypomethylation is associated with genomic instability and an increased number of mutations,6 © 2019 American Chemical Society
Received: April 9, 2019 Published: June 22, 2019 1441
DOI: 10.1021/acs.chemrestox.9b00153 Chem. Res. Toxicol. 2019, 32, 1441−1448
Article
Chemical Research in Toxicology
Sample Collection. Blood samples were collected by Vacutainer blood collection tubes with EDTA disodium salt, and the samples were stored at −20 °C until analysis. In the case of the urine samples, for mestizo population, a compound sample was made for each one. The first urine sample was collected for 7 consecutive days from each participant in sterile widemouth plastic bottles and transported to the laboratory at 4 °C, where these were stored at −20 °C for dialkylphosphate determination analysis. In total, 98 samples were analyzed. On the other hand, due to the distance and storage conditions, it was only possible to collect a urine sample from the indigenous population. The urine sample was collected as a one morning spot urine sample for dialkylphosphate determination. Collected spot urine samples were transported to the laboratory, and then stored at −20 °C until analysis. In total, 96 samples were analyzed. Dialkylphosphate (DAP) Metabolite Measurement. The preparation samples and extraction process were carried out according to Valcke et al.,21 with some modifications.22 Six metabolites were identified: dimethylphosphate (DMP), dimethylthiophosphate (DMTP), dimethyldithiophosphate (DMDTP), diethylphosphate (DEP), diethylthiophosphate (DETP), and diethyldithiophosphate (DEDTP). The quantification was performed in a gas chromatograph (GC System, model 7820A; Agilent Technologies) coupled to a mass spectrometer (Agilent model 5975 MSD), through selective ion monitoring (SIM). The results are expressed in ng/mL, and DAP concentrations were corrected by urinary specific gravity according to the method of Sokoloff et al.23 Extraction of DNA and Bisulfite Modification. DNA extraction was performed from whole blood using the PureLink Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, U.S.A.), following the company’s instructions. The concentration and purity were evaluated by spectrophotometry in a Thermo Scientific NanoDrop 2000c. Subsequently, for the bisulfite modification, 500 ng of DNA was processed using the EZ DNA Methylation- Lightning kit (Zymo Research, USA) following the manufacturer’s protocol, and immediately modified DNA was stored at −20 °C until analysis. PCR Amplification and Pyrosequencing of WRAP53α Gene. PCR was carried out mixing 15 μL of GoTaq Green Master mix (Promega, Wisconsin, U.S.A.), 1 μL forward primer (0.3 μM), 1 μL reverse primer (0.3 μM), 1 μL modified DNA, and 12 μL PCR water for a complete final volume of 30 μL. PCR conditions were 95 °C for 3 min, 40 cycles (95 °C for 45 s, 56 °C for 45 s, and 72 °C for 1 min), and 72 °C for 3 min. Confirmation of the quality of the PCR products was evaluated by electrophoresis using agarose gels (2%) with ethidium bromide staining. The primers and sequence analyzed for WRAP53α methylation analysis are shown in Table 1.
as the WRAP53 gene, in populations exposed to pesticides or in indigenous populations. The WRAP53 gene is located on chromosome 17p13 and is referred to as an “antisense” gene of the p53 tumor suppressor gene. This name was approved by the Human Genome Organization (HUGO) Gene Nomenclature Committee as the official name and is also denoted as TCAB1 or WDR79.12,13 WRAP53 can generate 17 variants by alternative splicing and has three alternative start exons (1α, 1β, and 1γ). However, only exon 1α directly overlaps the first exon of the p53 gene in an antisense manner.12 The WRAP53α gene gives rise to the p53 antisense transcript that regulates endogenous p53 mRNA levels, whereas its protein product interacts with the survival motor neuron (SMN) protein. In addition, it recruits the SMN complex of the cytoplasm to the Cajal bodies of the nucleus.14,15 Other functions described for WRAP53 are related to the apoptosis process, regulation of the cell cycle, proteasomal degradation, and RNA metabolism.13−15 Likewise, WRAP53 is implicated in different types of cancer, such as breast, ovarian, primary nasopharyngeal carcinoma, esophageal squamous cell carcinoma, and congenital dyskeratosis disorder.16 Although WRAP53 is involved in an important cell process, no studies have reported its methylation pattern in populations exposed to pesticides or in genetically conserved populations (indigenous). In this regard, some studies had demonstrated the influence of environmental exposures and the contribution of race and ethnicity in the DNA methylation pattern changes, as well as in the disease development.17−20 The aim of this study was to analyze the methylation WRAP53α gene in mestizo and indigenous populations as well as its relationship with internal (age, sex, and body mass index) and external factors (pesticide exposure and micronutrient intake).
■
METHODS
Study Population. A cross-sectional, descriptive, analytical study was conducted in workers engaged in fumigation of houses, schools, and other locations as well as in an indigenous population. The study population comprised 444 individuals divided into three groups: 91 mestizo individuals without occupational exposure to pesticides (reference group), 164 mestizo urban sprayers, and 189 indigenous individuals without occupational exposure to pesticides. The samples were collected from August 2015 to December 2016. Inclusion criteria were individuals older than 18 years of age who agreed to participate voluntarily in the study. In addition, a reference group was selected that had no occupational contact with pesticides and whose socioeconomic status, health, sex, unhealthy habits, and educational level, among others, were similar to those of the pesticide applicators’ characteristics. To be selected for inclusion in the indigenous population, individuals had to have blood type O (ABO system) and the Rh+ antigen, to share the cultural traditions of the region, and to speak the indigenous dialect. The aims of the study were explained to the participants. Information related to the socio-economic, anthropometric characteristics, age, diet, clinical history, unhealthy habits (consumption of drugs, tobacco, and alcohol) and pesticide exposure (past and current) were assessed using a structured questionnaire. Additionally, another questionnaire was applied to evaluate the frequency of macroand micronutrient intake by using SNUT software from the National Institute of Public Health and National Institute of Cardiology Ignacio Chávez. All participants provided signed written consent. This study was approved by the Bioethics Commission of Nayarit State, Mexico (CEBN/01/2016 and CEBN/0112017).
Table 1. Primers and Sequence Analyzed for WRAP53α Methylation Analysis Sequence ID
Sequence (5′-3′)
Product size (bp)
WRAP53α 152 WRAP53α GGTTTTTGGTATAAAGTTGGATAGT forward WRAP53α [Btn] reverse TCCACCCCAAAATATTAATATCTAC WRAP53α sequence analyzed (38 bp) C/TGTTATGATAAGTAAGGGTAAGTAATTC/TGTTTGTC/TGGA
Then, PCR products were purified using 0.3 μM of forward primer (Table 1). The pyrosequencing process was performed using the PyroMark Q24 pyrosequencing system according to the manufacturer’s instructions (Qiagen, Hilden, Germany). For quality control analysis, the oligo sequence with 50% methylation was determined in one well for each sequencing plate evaluated. Additionally, bisulfite modification control was included in the PyroMark Q24 software. 1442
DOI: 10.1021/acs.chemrestox.9b00153 Chem. Res. Toxicol. 2019, 32, 1441−1448
Article
Chemical Research in Toxicology
Figure 1. Analyzed sequence of the WRAP53α gene with CpG sites. TSS: transcription start site; PSQ: pyrosequencing. Data were obtained from ENCODE and genome browser UCSC & NCBI; NCBI reference sequence (NM_001143991.1).
Table 2. General Characteristics of the Study Population Parameter
Reference groupa n = 91
Mestizo sprayersb n = 164
Indigenous groupc n = 189
Female [n (%)] Male [n (%)] Age (years) (95% CI) **BMI (kg/m2) (95% CI) Low and normal weight [n (%)] Overweight [n (%)] Obesity [n (%)] Educational level (years) (95% CI) Intake of folic acid supplement [n (%)] Dietary folate intake (μg) (95% CI) Alcohol consumer [n (%)] Active smokers [n (%)] No-smokers Number of cigarettes per day (95% CI) Passive smokers [n (%)]
p value
