Photoactivable Antibody Binding Protein: Site-Selective and Covalent

Jan 9, 2009 - antibody binding proteins, which enable irreversible and site- selective (Fc-region specific) antibody conjugation on solid surfaces as ...
18 downloads 3 Views 284KB Size
Download PDF
Anal. Chem. 2009, 81, 936–942

Photoactivable Antibody Binding Protein: Site-Selective and Covalent Coupling of Antibody Yongwon Jung, Jeong Min Lee, Jung-won Kim, Jeongwon Yoon, Hyunmin Cho, and Bong Hyun Chung* BioNanotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, P.O. Box 115, Yuseong, Daejeon 305-600, Korea, and Nanobiotechnology, School of Engineering, Korea University of Science and Technology (UST), P.O. Box 115, Yuseong, Daejeon 305-333, Korea Here we report new photoactivable antibody binding proteins, which site-selectively capture antibodies and form covalent conjugates with captured antibodies upon irradiation. The proteins allow the site-selective tagging and/or immobilization of antibodies with a highly preferred orientation and omit the need for prior antibody modifications. The minimal Fc-binding domain of protein G, a widely used antibody binding protein, was genetically and chemically engineered to contain a site-specific photo cross-linker, benzophenone. In addition, the domain was further mutated to have an enhanced Fc-targeting ability. This small engineered protein was successfully crosslinked only to the Fc region of the antibody without any nonspecific reactivity. SPR analysis indicated that antibodies can be site-selectively biotinylated through the present photoactivable protein. Furthermore, the system enabled light-induced covalent immobilization of antibodies directly on various solid surfaces, such as those of glass slides, gold chips, and small particles. Antibody coupling via photoactivable antibody binding proteins overcomes several limitations of conventional approaches, such as random chemical reactions or reversible protein binding, and offers a versatile tool for the field of immunosensors. Covalent coupling of antibodies to solid surfaces or other biological/chemical molecules is a key step in the development of immune-based assays, such as biosensors and antibody arrays.1,2 The coupling method of choice significantly affects subsequent antibody-antigen interactions.3,4 To fully maintain the antigen-binding abilities of modified antibodies, modifications must be site-selective and distant from antigen-binding sites. Recently, several strategies have been reported for site-selective and

* To whom correspondence should be addressed. Dr. Bong Hyun Chung, BioNanotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, P.O. Box 115, Yuseong, Daejeon 305-600, Korea. E-mail: [email protected].. Fax: +82-42-879-8594. (1) Filpula, D. Biomol. Eng. 2007, 24, 201–215. (2) Jung, Y.; Jeong, J. Y.; Chung, B. H. Analyst 2008, 133, 697–701. (3) Danczyk, R.; Krieder, B.; North, A.; Webster, T.; HogenEsch, H.; Rundell, A. Biotechnol. Bioeng. 2003, 84, 215–223. (4) Franco, E. J.; Hofstetter, H.; Hofstetter, O. J. Sep. Sci. 2006, 29, 1458– 1469.

936

Analytical Chemistry, Vol. 81, No. 3, February 1, 2009

covalent immobilization of proteins.5-9 These methods, however, require genetic engineering of target proteins, which is not suitable for most intact antibodies. While antibodies can be coupled via carbohydrate chains or disulfide bridges, chemical treatments, such as carbohydrate oxidation and disulfide bond reduction, are inevitable.4,10 Antibody binding proteins, such as protein G, A, or L, have also been widely used for antibody immobilization in a defined orientation. Immunoassays employing antibody binding proteins for antibody immobilization regularly exhibit higher sensing abilities compared to those using conventional methods such as random covalent immobilization.2 A critical limitation, however, is that the interactions are reversible and therefore can be unstable during subsequent assays.11 Creating a universal tool for siteselective and covalent antibody coupling with minimum antibody modifications remains a significant challenge. In the present work, we developed novel photoactivable antibody binding proteins, which enable irreversible and siteselective (Fc-region specific) antibody conjugation on solid surfaces as well as in solution. Specific residues of the Fc-binding domain of protein G were mutated to cysteine, and the resulting sulfhydryl groups were modified by maleimide-functionalized benzophenone molecules via a flexible chemical linker (Figure 1A). Perspective residues for benzophenone modification were rationally selected, and final target residues were experimentally decided. These engineered small proteins specifically capture intact antibodies and form covalent conjugates upon UV irradiation, therefore allowing not only covalent antibody immobilization on solid surfaces but also site-selective tagging of antibodies in solution by genetically adding various tags on photoactivable proteins. Design, construction, and characterization of photoac(5) Kwon, Y.; Coleman, M. A.; Camarero, J. A. Angew. Chem., Int. Ed. 2006, 45, 1726–1729. (6) Watzke, A.; Ko ¨hn, M.; Gutierrez-Rodriguez, M.; Wacker, R.; Schro¨der, H.; Breinbauer, R.; Kuhlmann, J.; Alexandrov, K.; Niemeyer, C. M.; Goody, R. S.; Waldmann, H. Angew. Chem., Int. Ed. 2006, 45, 1408–1412. (7) Lin, P. C.; Ueng, S. H.; Tseng, M. C.; Ko, J. L.; Huang, K. T.; Yu, S. C.; Adak, A. K.; Chen, Y. J.; Lin, C. C. Angew. Chem., Int. Ed. 2006, 45, 4286– 4290. (8) Kindermann, M.; George, N.; Johnsson, N.; Johnsson, K. J. Am. Chem. Soc. 2003, 125, 7810–7811. (9) Camarero, J. A.; Kwon, Y.; Coleman, M. A. J. Am. Chem. Soc. 2004, 126, 14730–14731. (10) Sun, M. M.; Beam, K. S.; Cerveny, C. G.; Hamblett, K. J.; Blackmore, R. S.; Torgov, M. Y.; Handley, F. G.; Ihle, N. C.; Senter, P. D.; Alley, S. C. Bioconjugate Chem. 2005, 16, 1282–1290. (11) Saleemuddin, M. Adv. Biochem. Eng. Biotechnol. 1999, 64, 203–226. 10.1021/ac8014565 CCC: $40.75  2009 American Chemical Society Published on Web 01/09/2009

Figure 1. Photoactivable antibody binding protein and photo crosslinking to antibody: (A) construction of a benzophenone-modified Fcbinding domain and a (B) schematic representation of site-selective photo cross-linking between the antibody and the photoactivable antibody binding protein with a genetically and/or chemically added linker.

Figure 2. Fc-binding proteins employed in this study with abbreviations. Fc-binding domain peptide sequence is shown with the biotinylation peptide sequence (BPS), mutation sites, and 6XHis fusion peptide (His).

tivable antibody binding proteins and their applications for siteselective tagging/immobilization of antibodies are investigated in this work. EXPERIMENTAL SECTION Materials. Bovine serum albumin (BSA) and human immunoglobulin G (IgG) were all purchased from Sigma. C-reactive protein (CRP), anti-CRP antibody, and separated/purified human Fab and Fc fragments were purchased from Calbiochem. BiotinLS-NHS and neutral avidin (NeutrAvidin) were obtained from Pierce (Thermoscientific). CM5 sensor chips for SPR measurement were supplied by Biacore AB (Uppsala, Sweden). Preparation of Mutated Fc-Binding Domain (FcBD) Proteins. Figure 2 shows Fc-binding proteins employed in this study. An expression vector, encoding the Streptococcal protein G Fcbinding domain and an N-terminal 6XHis fusion peptide, was prepared as described previously.12 Indicated amino acid residues were mutated to cysteine using multiple polymerase chain reactions (PCR). For instance, to mutate 21Val and 29Ala, the sequence encoding residues 1-27 of the Fc binding domain was first amplified by the forward primer 5′-GGGAATTCCATATGACTTA(12) Lee, J. M.; Park, H. K.; Jung, Y.; Kim, J. K.; Jung, S. O.; Chung, B. H. Anal. Chem. 2007, 79, 2680–2687.

CAAACTTGTTATT-3′, containing an NdeI restriction enzyme site and reverse primer 5′-TTC TGC AGT TTC TGC GTC GCA TGC3, which altered 21Val to Cys. The second PCR reaction involved amplification of the sequence coding for amino acids 23-55 with the forward primer 5′-GCA GAA ACT GCA GAA AAA TGC TTC3′, (converting 29Ala to Cys) and the reverse primer 5′- GAGCTCGAGTTCAGTTACCGTAAAGGTCTTAGTC-3′, containing an XhoI restriction enzyme site. Both PCR products were used together as the template for the final PCR reaction with the same forward (5′-GGGAATTCCATATGACTTACAAACTTGTTATT-3′) and reverse (5′- GAGCTCGAGTTCAGTTACCGTAAAGGTCTTAGTC3′) primers to generate a Fc-binding domain with mutations at 21Val and 29Ala. The final PCR product was cloned into the pET21a vector (Novagen) and designated pET-FcBD (Figure S3 in the Supporting Information). A N37Y single mutation was carried out by using Quick change site-directed mutagenesis (Stratagene). To construct pET-2XFcBD for surface antibody cross-linking (Figure 2), the gene encoding a 21Val mutated Fc-binding domain was prepared in two different forms. Following the mutation of 21Val to cysteine as described above, the first reaction produced the PCR product encoding a 21Val mutated domain with an N-terminal NdeI site and an extra seven amino acids at the C-terminus (forward primer 5′-GGGAATTCCATATGACTTACAAACTTGTTATT-3′ and reverse primer 5′- CGC ATC GAT CAC TTC TGG TTT TTC AGT TAC CGT AAA GGT CTT-3′). The next PCR product contained eight extra amino acids at the N-terminus and a C-terminal XhoI site (forward primer 5′-TCT GAA TTA ACA CCA GCC GTG ACA ACT TAC AAA CTT GTT ATT AAT GG-3′ and reverse primer 5′-GAGCTCGAGTTCAGTTACCGTAAAGGTCTTAGTC-3′). Each PCR product was digested with NdeI or XhoI. Digested products were phosphorylated by T4 DNA kinase, ligated through their blunt ends, and cloned into pET21a (pET2XFcBD). The 15 amino acids added between two Fc-binding domains were derived from the native Streptococcal protein G. To achieve site-specific biotinylation, the biotinylation peptide sequence (GLNDIFEAQKIEWHE; BPS in Figure 2) was added to the N-termini of FcBD and 2XFcBD proteins. The lysine of the peptide is specifically biotinylated by biotin ligase coexpressed in the same strain. Genes for these proteins were cloned into pProExHTa (Invitrogen), which provides N-terminal 6XHis peptide. Fc-binding proteins were expressed in Escherichia coli BL21(DE3) as described previously.12 Biotinylated proteins were expressed in AVB101 (Avidity), an E. coli B strain (hsdR, lon11, sulA1) containing a pACYC184 plasmid, which produces biotin ligase BirA upon isopropyl-β-D-thiogalactopyranoside (IPTG) induction. Transformed AVB101 cells were grown in the presence of 50 µM biotin, and protein expressions were induced by adding IPTG at a final concentration of 1 mM. All proteins were purified by a His-tag affinity column and, subsequently, anion exchange chromatography on a Q Exellose column (Bioprogen Co., Korea) with a continuous sodium chloride gradient from 0 to 1 M. The N-terminal 6XHis peptides on biotinylated proteins were cleaved by rTEV protease. Purified proteins were dialyzed against PBS buffer containing 2 mM DTT and stored at -80 °C before use. Synthesis of Maleimido-EG-Benzophenone Compound 2 (Scheme 1). Unless otherwise noted, all chemicals were obtained from commercial sources and used without further purification. Analytical Chemistry, Vol. 81, No. 3, February 1, 2009

937

Scheme 1. Synthesis of Maleimido-EG-benzophenone 2

Compound 1 was purchased from Sigma, and compound 3 was synthesized according to a previous report.13 N-Boc-2,2′-(ethylene-l,2-dioxy)bisethylamine (6). To a mixture of 1 g (6.7 mmol) of 2,2′-(ethylene-l,2-dioxy)bis(ethylamine) and 0.736 g (3.4 mmol) of ditert-butyl dicarbonate in 50 mL of methanol were added triethylamine (0.75 g, 7.4 mmol) under nitrogen atmosphere. The reaction mixture was stirred for 10 h. After removal of the solvent in vacuo, the residue was dissolved in 50 mL of chloroform and washed twice with aqueous sodium bicarbonate solution. The organic layer was dried over anhydrous MgSO4 and concentrated to give 1.03 g (62% yield) of 6. 1H NMR (300 MHz, CDCl3): δ 1.4 (s, 9H), 2.86 (t, J ) 5.1 Hz, 2H), 3.27∼3.32 (m, 2H), 3.48∼3.58 (m, 8H), 5.16 (broad s, 1H). N-Boc-N′-maleyl-2,2′-(ethylene-l,2-dioxy)bisethylamide (5). A catalytic amount of dimethylaminopyridine (DMAP) was added to a mixture of 1 g (4.0 mmol) of 6 and 0.39 g (4.0 mmol) of maleic anhydride in 20 mL of methylene chloride under nitrogen atmosphere. The reaction mixture was stirred for 2 h. After removal of the solvent in vacuo, the residue was dissolved in 50 mL of methylene chloride, extracted with 30 mL of aqueous sodium solution bicarbonate, and the aqueous layer was acidified to pH 3 with dilute hydrochloric acid. The aqueous solution was extracted again with methylene chloride, and the organic layer was dried over anhydrous MgSO4. The resulting solvent was evaporated in vacuo to give 0.65 g (47% yield) of 5. 1H NMR (300 MHz, CDCl3): δ 1.47 (s, 9H), 3.32 (t, J ) 5.1 Hz, 2H), 3.55∼3.68 (m, 10H), 4.89 (broad s, 1H), 6.26∼6.44 (dd, J ) 13.1 Hz, 2H), 5.76 (broad s, 1H), 9.78 (broad s, 1H). N,N-Maleimidoyl-N′-Boc-2,2′-(ethylene-1,2-dioxy)bisethylamide (4). To 0.5 g of the intermediate 5 (1.4 mmol) in 30 mL of acetic anhydride, 0.59 g (7.2 mmol) of sodium acetate was added, and the reaction mixture was stirred at 120 °C for 45 min. The solvent was removed under reduced pressure, and the residue was dissolved in methylene chloride and washed three times with water and phosphate buffer (pH 7.2). The organic layer was dried over anhydrous MgSO4, and the solvent was evaporated in vacuo to give 0.38 g (81% yield) of 4. 1H NMR (300 MHz, CDCl3): δ 1.44 (s, 9H), 3.25∼3.31 (m, 2H), 3.47∼3.75 (m, 10H), 5.02 (broad s), 6.7 (s, 2H). (13) Thiele, C.; Fahrenholz, F. Biochemistry 1993, 32, 2741–2746.

938

Analytical Chemistry, Vol. 81, No. 3, February 1, 2009

4-Benzoyl-N-(2-(2-(2-(2,5-dioxo-2,5-dihydro-1H-pyrrol1-yl)ethoxy)ethoxy) ethyl)benzamide (2). Compound 4 (0.3 g) was dissolved in a mixture of 10 mL of trifluoroacetic acid and methylene chloride (1:1), and the solution was stirred at room temperature for 2 h. The solvent was removed under reduced pressure, and the process of dissolving the remaining material in methylene chloride and removing the solvent under reduced pressure was repeated three times to completely remove trifluoroacetic acid. The residue was dried in vacuo to generate 0.14 g of deprotected compound 4. To a mixture of 0.1 g (0.4 mmol) of deprotected 4 and 0.15 g (0.46 mmol) of benzoylbenzoic acid NHS ester 3 in 20 mL of methylene chloride were added triethylamine (0.08 g, 0.8 mmol) and a catalytic amount of dimethylaminopyridine (DMAP) under nitrogen atmosphere. The reaction mixture was stirred for 10 h. After the removal of solvent in vacuo, the residue was dissolved in 20 mL of methylene chloride and washed twice with distilled water. The organic layer was dried over anhydrous MgSO4, and the solvent was evaporated in vacuo. The resulting residue was purified through silica gel chromatography (acetone/methylene chloride ) 1:3) to give a final 90 mg (47% yield) of 2. 1H NMR (300 MHz, CDCl3): 3.62∼3.74 (m, 12H), 6.65 (s, 2H), 6.96 (broad s, 1H), 7.50 (t, J ) 8.1 Hz, 2H), 7.62 (t, 1H), 7.79∼7.87 (m, 4H), 7.95 (d, 2H). 13C NMR (300 MHz, CDCl3): 195.99, 170.63, 166.59, 139.95, 137.83, 137.08, 134.12, 132.78, 130.05, 128.39, 127.09, 70.22, 69.89, 69.68, 67.86, 39.87, 37.05. ESI-MS calcd for C24H24N2O6 437.1713 [M + H]+, found 437.1715. Benzophenone Modification of Mutated Fc-Binding Domain (FcBD) Proteins and Photo Cross-Linking. Cysteine mutated FcBD proteins were stored in buffer containing 2 mM DTT to maintain their reduced forms. Prior to benzophenone modification, DTT was removed by a desalting column. The resulting FcBD proteins were immediately mixed with maleimidoEG-benzophenone 2 and incubated for 1 h. Excess 2 was again removed by a desalting column. For photo cross-linking, following incubation of antibodies with FcBD-BP proteins for 30 min at room temperature, mixtures were irradiated with a hand-held UV light on ice for the indicated time. Site-Selective Biotin Tagging and Surface Plasmon Resonance (SPR) Analysis. Anti-CRP antibody (0.2 mg/mL) was incubated with 3-fold excess FcBD-BP modified with a single

Figure 3. Residue selection for benzophenone modification of the Fc-binding domain. X-ray crystal structure of the Fc-binding domain and Fc fragment complex is shown with the three selected residues indicated.

biotin moiety at the N-terminus (biotin-FcBD-BP, Figure 2) and cross-linked with 365 nm UV light. Excess biotin-FcBD-BP (∼8 kDa) was removed by dialysis with a 50 kDa cutoff membrane (SPECTRUMLAB Cellulose Ester membrane) or short-column gel filtration with Sephacryl S100 (GE Healthcare). In case further removal of noncovalently bound biotin-FcBD-BP from the antibodies was required, the mixtures were briefly dialyzed with 10 mM NaOH (10 min) or separated by gel filtration in 10 mM NaOH and 150 mM NaCl buffer, followed by neutralization in 50 mM phosphate buffer, pH 7.5. Anti-CRP was also biotinylated by conventional chemical reagent biotin-LS-NHS. Approximately a 20fold excess of NHS reagent was reacted with the antibody, as suggested in the manufacturer’s protocol. SPR measurements were performed with CM5 gold chips on a Biacore 3000 device (Biacore AB, Sweden) at 25 °C using PBS buffer as the running solution. NeutrAvidin was simultaneously immobilized on two flow cells of the CM5 chip. Approximately 4000-6000 RU levels of NeutrAvidin were immobilized. Differently biotinylated anti-CRP antibodies (50 µg/mL) were introduced into these channels for 10 min at a rate of 10 µL/min. Noncovalently biotinylated antibodies were removed by a 1 min injection of 10 mM NaOH solution. The CRP antigen (25 µg/mL) was subsequently introduced into both flow cells for 5 min. Light-Induced Direct Immobilization of Antibodies on Solid Surfaces. Gold chips and bare slide glasses were cleaned with concentrated “piranha” solution (70% (v/v) H2SO4, 30% (v/ v) H2O2) and thoroughly rinsed with ethanol and deionized water. Precleaned gold substrate was immersed in 11-mercaptoundecanoic acid (11-MUA) solution for 12 h to produce a carboxylated gold surface. The slide glass was immersed in ethanol containing 1.0% 3-(aminopropyl)trimethoxy silane (APTMS) for 1 h at room temperature. The resulting amine slide was then carboxylated by reacting with 1 M succinic anhydride in DMF at 37 °C for 4 h. The carboxyl glass or gold surfaces were activated by a mixture of 0.1 M EDC and 0.025 M NHS for 15 min. Proteins, including antibody binding proteins, BSA, and NeutrAvidin, were subsequently immobilized onto these activated surfaces. Antibodies were applied onto the modified surfaces at a concentration of 50 µg/mL in PBS buffer supplemented with 0.01% Tween 20 (PBST) and 0.5 mg/mL BSA. After 30 min incubation, the surfaces were irradiated with 365 nm UV light for 1 h on ice. After sequential washes with PBST and PBS, the surfaces were briefly washed with 10 mM NaOH for 1 min. The slides were dried with nitrogen, and

fluorescence images were obtained using a GenPix 4200 (Axon) camera. For antibody immobilization of gold surfaces, SPR imaging analysis was performed by using the house-customized SPR imaging system as described previously.12 Small magnetic particles containing carboxyl groups on the surface (Dynabeads MyOne Carboxylic Acid, DYNAL) were covered with the photoactivable antibody binding protein 2XFcBDBP, following the manufacturer’s instructions. Modified particles were incubated with 50 µg/mL antibody in PBST buffer supplemented with 0.5 mg/mL BSA. The mixture was irradiated with 365 nm UV light while gently shaking for 1 h. The particles were washed twice with PBST by collecting the beads on a magnet and removing the supernatant. RESULTS AND DISCUSSION Design and Construction of Photoactivable Antibody Binding Proteins. To construct photoactivable antibody binding proteins, specific residues of FcBD were mutated to cysteine, and the resulting sulfhydryl groups were modified by maleimidefunctionalized benzophenone molecules (Figure 1). These residues should not be involved in protein folding or Fc binding, ensuring interactions between the BP-modified FcBD and the antibody. Upon binding, however, modified residues must be in close proximity to the bound antibody, enabling successfully crosslinking of modified FcBD to the Fc region of the bound antibody by UV light. On the basis of the crystal structure of an Fc-binding domain and Fc fragment complex,14 three residues (21Val, 29Ala, and 47Asp) of the Fc-binding domain were initially selected for modification by benzophenone (BP) (Figure 3). Different sets of these three residues were mutated and modified with the photo cross-linker. Modified proteins were mixed with Fc fragments and irradiated with 365 nm UV. Benzophenone modification on one of these three residues yielded successful photo cross-linking between the modified Fc-binding domain and Fc fragment while 47Asp modification resulted in slightly less effective cross-linking (Figure S1 in the Supporting Information). The BP molecule was also introduced into 6Val of the Fc-binding domain. Since 6Val is located away from the bound antibody, photo cross-linking via BP on 6Val to the Fc fragment was highly inefficient. The Fcbinding domain engineered to contain two BP molecules at 21Val and 29Ala displayed the highest level of photo cross-linking to (14) Sauer-Eriksson, A. E.; Kleywegt, G. J.; Uhle´n, M.; Jones, T. A. Structure 1995, 3, 265–278.

Analytical Chemistry, Vol. 81, No. 3, February 1, 2009

939

antibodies. On the other hand, introducing more BP molecules on the protein yielded decreased cross-linking and also low yield for protein production. In addition to tight binding to the Fc region, protein G also interacts weakly with the Fab region of the antibody, leading to aggregate formation between protein G and antibodies in solution.15 We recently discovered that the single N37Y mutation of FcBD abolishes the Fab-binding ability of protein G.16 The mutation not only prevents aggregate formation but also offers better Fc-targeting by protein G. In the present study, the small Fc-binding protein with two BP molecules and superior Fcspecificity (FcBD-BP) was employed as a building block for photoactivable antibody binding proteins. Successful BP modification of cysteine mutated FcBD proteins was confirmed by SDS-PAGE, in which BP-modified proteins migrate differently from free proteins, and MALDI analyses (Figures S2 and Table S1 in the Supporting Information, respectively) In addition, FcBD binding to an antibody was not affected by BP modification, as intended (Figure S3 in the Supporting Information). Photo Cross-Linking to Antibodies. Photo cross-linking between FcBD-BP and antibodies was examined by SDS-PAGE analysis. Antibodies were incubated with FcBD-BP for 30 min before photoactivation. Photo cross-linking reached saturated levels following 1 h irradiation with light at 365 nm. While UV irradiation with 264 nm light produced faster cross-linking, irradiated antibodies were severely damaged, often showing degradation. To investigate the effects of UV irradiation on antigen binding ability of antibody, anti-CRP antibodies were irradiated with different wavelengths of UV for various time periods in solutions and also on solid surfaces. The subsequent interactions between irradiated antibodies and antigen CRP confirmed that antibodies maintain their antigen binding ability even after 2 h of exposure to UV at 365 nm, whereas antigen binding is clearly decreased within 30 min of irradiation at 254 nm (Figure S4 in the Supporting Information). Upon irradiation by 365 nm UV light, only heavy chains of antibodies were cross-linked to FcBD-BP, as expected, since FcBD-BP targets only the Fc region (Figure 4A). This Fc-specific cross-linking is a key for ideal antibody modification, yielding a favored and uniform antibody orientation. The observed siteselectivity was further confirmed by FcBD-BP cross-linking to separate Fc and Fab fragments. FcBD-BP was cross-linked only to Fc but not to the Fab fragment (Figure S5 in the Supporting Information). BP-modified FcBD protein without the N37Y mutation, however, can be cross-linked to both Fc and Fab fragments. It is likely that even weak binding of FcBD to the Fab fragment facilitates photo cross-linking between Fab and FcBD-BP. The data clearly indicate that our N37Y mutation significantly improves the Fc-selectivity of protein G. FcBD was initially modified by commercially available maleimido-benzophenone compound 1. Cross-linking between FcBDBP and antibodies via 1 was, however, highly inefficient, possibly due to limited flexibility of 1. We therefore synthesized maleimidoEG-benzophenone compound 2, which insert a flexible and hydrophilic ethylene glycol linker between FcBD and the ben(15) Akerstrom, B.; Bjorck, A. J. Biol. Chem. 1986, 261, 10240–10247. (16) Jung, Y.; Lee, J. M.; Chung, B. H. Unpublished results.

940

Analytical Chemistry, Vol. 81, No. 3, February 1, 2009

Figure 4. Characterization of photo cross-linking between antibodies and photoactivable antibody binding proteins. (A) SDS-PAGE analysis of cross-linked mixtures in the presence of reducing reagents. Mixtures of benzophenone-modified FcBD proteins and antibodies were irradiated at 365 nm for the indicated times and subjected to 12% SDS-PAGE. Two maleimide-functionalized benzophenone linkers were examined. Light chains and heavy chains with or without cross-linking are indicated. (B) A mixture of human antibody and FcBD modified by compound 2 was irradiated at 365 nm for 1 h and subjected to 6% SDS-PAGE in the absence of reducing agent.

zophenone molecule. As shown in Figure 4A, 2 vastly improved cross-linking yields and was thus employed for the construction of the present FcBD-BP. The overall cross-linking efficiency of intact antibodies to FcBD-BP was subsequently investigated. Irradiated FcBD-BP and antibody mixtures were analyzed under nonreducing conditions, where the intact form of the antibody was maintained through disulfide bonds (Figure 4B). Antibodies were treated with 5-fold excess FcBP-BP to obtain a near saturated level of cross-linking. Densitometric calculations indicate that more than 50% of antibodies are cross-linked to one or two FcBD proteins under these conditions. Site-Selective Antibody Biotinylation. To demonstrate that antibodies can be selectively tagged via FcBD-BP, a single biotin molecule was introduced into the N-terminus region of this photoactivable antibody binding protein (biotin-FcBD-BP). The 15-amino-acid biotinylation peptide sequence was genetically fused to the N-terminus of FcBD, and the lysine residue of the peptide was biotinylated. Anti-CRP antibodies were photo cross-linked with biotin-FcBD-BP. Antibodies were also biotinylated by conventional chemical reagent biotin-LC-NHS, yielding randomly biotinylated antibodies. Unconjugated biotin-FcBD-BP as well as biotin-LCNHS was easily removed from antibodies by simple dialysis or one-step gel filtration. The site-selectivities of both biotinylation methods were compared by SPR measurements. Differently biotinylated anti-CRP antibodies were applied to a NeutrAvidincoated SPR chip surface, and subsequent CRP interactions were investigated (Figure 5). Noncovalently biotinylated antibodies were removed from the surface by a short injection of 10 mM NaOH,

Figure 5. SPR sensorgrams of biotinylated anti-CRP immobilization on the neutral streptavidin surface and subsequent CRP binding. The surface was injected with differently biotinylated anti-CRP antibodies (50 µg/mL) for 10 min and washed with 10 mM NaOH for 1 min. The CRP antigen (25 µg/mL) was subsequently introduced. Anti-CRP levels measured after the NaOH wash are indicated with arrows (blue line for biotin-FcBD-BP and black line for biotin-LC-NHS). Immobilization values (RU) were obtained from three independent experiments.

in which only covalent bonding and NeutrAvidin-biotin interactions are stable. In the absence of photo cross-linking, antibodies bound on protein G surface were slowly dissociated from the surface and completely removed by the 10 mM NaOH wash. In comparison to biotinylation by biotin-LC-NHS, biotin tagging via biotin-FcBD-BP induced stable immobilization of nearly twice as many anti-CRP antibodies on the chip surface. More importantly, anti-CRP bound to biotin-FcBD captures CRP proteins over 2-fold more efficiently than randomly coupled anti-CRP. SPR signal changes upon anti-CRP bindings were greater than those by subsequent CRP bindings as previously reported.17 The results indicate that Fc-targeted antibody tagging developed in this work provides a highly preferred antibody orientation, resulting in enhanced antibody immobilization as well as antigen capture. Light-Induced Direct Immobilization of Antibodies on Solid Surfaces. Light-induced covalent immobilization of antibodies directly on various solid surfaces was also explored. The glass surface was covered with photoactivable or free antibody binding proteins and BSA as a control. To enhance the antibody capturing ability on a solid surface, two Fc-binding domains were consecutively linked,18 where each FcBD contains one benzophenone molecule (Figure 2). Photo cross-linking of 2XFcBD-BP to the antibodies was also highly efficient (Figure S6 in the Supporting Information). The modified glass surface was treated with fluorescence labeled antibodies. Following UV irradiation directly onto the glass surface, noncovalently bound proteins were removed by briefly washing with 10 mM NaOH. As shown in (17) Jung, Y.; Kang, H. J.; Lee, J. M.; Jung, S. O.; Yun, W. S.; Chung, S. J.; Chung, B. H. Anal. Biochem. 2008, 374, 99–105. (18) Ha, T. H.; Jung, S. O.; Lee, J. M.; Lee, K. Y.; Lee, Y.; Park, J. S.; Chung, B. H. Anal. Chem. 2007, 79, 546–556.

Figure 6. Direct antibody immobilization on solid surfaces by photoactivable antibody binding protein: (A) light-induced covalent binding of the Cy3-labeled antibody to immobilized benzophenonemodified FcBD and unmodified FcBD, as well as BSA as a control. (B) Controlled covalent immobilization of antibodies through a 300 µm mask on glass and gold surfaces covered with photoactivable antibody binding protein.

Figure 6A, antibodies were specifically and covalently immobilized on the solid surface coated with photoactivable antibody binding protein in the presence of UV radiation. Light-induced antibody immobilization was further investigated by using a mask with 300 µm spots. Gold as well as glass surfaces were covered with photoactivable antibody binding protein, followed by antibody treatment. The surfaces were subsequently irradiated through the mask. After a NaOH wash, SPR imaging and fluorescence measurements revealed successful covalent immobilization of antibodies on the intended areas of gold and glass surfaces, respectively (Figure 6B). Quantitative analysis confirmed that initially similar levels of antibodies and subsequent antigens were bound to the chip surfaces covered with photoactivable and unmodified antibody binding proteins (Figure S7 in the Supporting Information). All antibodies were, however, removed from the unmodified protein G surface by a short NaOH wash, while nearly 65% of bound antibodies were covalently cross-linked to photoactivable antibody binding proteins. Specific and site-selective covalent conjugation of antibodies to small particles was also achieved by using the current system. Small magnetic particles were covered with the photoactivable antibody binding protein. Modified particles were incubated with antibody, followed by UV irradiation with 365 nm UV light for 1 h. Noncovalently bound proteins were removed by a brief wash with 10 mM NaOH. Covalently bound antibodies were extracted from the particles by boiling under denaturing and reducing conditions. As shown in Figure 7, in the absence of UV irradiation, most bound antibodies were released from the particles by NaOH wash (lane 1 versus lane 3), whereas approximately 55% of bound antibodies were covalently immobilized by photo cross-linking (lane 2 versus lane 4). Since antibodies were photo cross-linked to the particles via their Fc regions, only one heavy chain can be Analytical Chemistry, Vol. 81, No. 3, February 1, 2009

941

Figure 7. Covalent antibody immobilization on the magnetic particles covered with photoactivable antibody binding protein. Magnetic particles were covered with 2XFcBD-BP and mixed with antibodies. Antibody bound particles were either incubated in dark or irradiated at 365 nm for 1 h. Excess unbound antibodies were first removed from the particles by mild washes with binding buffer. Next, noncovalently bound antibodies were washed from the particles with 10 mM NaOH and remained covalently bound antibodies were extracted from the particles in reducing conditions. Lanes 1 and 2, noncovalently bound (NaOH washed) antibodies on 2XFcBD-BP covered particles with or without irradiation, respectively; lanes 3 and 4, covalently bound (NaOH wash resistant) antibodies on 2XFcBD-BP covered particles with or without irradiation, respectively.

extracted from cross-linked antibodies along with two light chains, showing similar band intensities for both heavy and light chains (Figure 7, lane 4). Highly efficient covalent immobilization of antibodies on solid surfaces of small particles is a valuable facet for bead-based immunoassays, such as immunoprecipitation.19 CONCLUSION We have developed novel photoactivable antibody binding proteins, which offer a universal tool for site-selective and covalent coupling of antibodies. Modification and/or immobilization of antibodies via present photoactivable proteins feature (1) specificity in terms of coupling antibodies in the presence of other proteins; (2) ideal site-selectivity, targeting only the Fc regions; (3) high stability through covalent conjugation; and (4) versatility of photoinduced methods. Additional genetic or chemical modifications of photoactivable antibody binding proteins should enable further expansion of their possible applications for the design of many immunoassays. Currently, however, protein G-mediated (19) Sisson, T. H.; Castor, C. W. J. Immunol. Methods 1990, 127, 215–220.

942

Analytical Chemistry, Vol. 81, No. 3, February 1, 2009

antibody immobilization has not been actively used for sandwich type immunoassays since secondary antibodies can also bind to protein G, limiting possible applications of the present strategy for these assays. Improving cross-linking yields and widening protein G binding antibody classes will also bolster the current antibody coupling method. ACKNOWLEDGMENT This research has been supported by grants from the Fundamental R&D Program for Core Technology of Materials (MKE, Korea) and Protein Chip Technology Program (MEST, Korea). SUPPORTING INFORMATION AVAILABLE Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.

Received for review July 14, 2008. Accepted December 17, 2008. AC8014565