Photolyase Impairs DNA Repair Activity in ... - ACS Publications

Subscriber access provided by UNIVERSITY OF WISCONSIN-MILWAUKEE

Article

Loss of fourth electron-transferring tryptophan in animal (6– 4) photolyase impairs DNA repair activity in bacterial cells Junpei Yamamoto, Kohei Shimizu, Takahiro Kanda, Yuhei Hosokawa, Shigenori Iwai, Pascal Plaza, and Pavel Müller Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b00366 • Publication Date (Web): 07 Sep 2017 Downloaded from http://pubs.acs.org on September 11, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Loss of fourth electron-transferring tryptophan in animal (6–4) photolyase impairs DNA repair activity in bacterial cells

Junpei Yamamoto,*,† Kohei Shimizu,† Takahiro Kanda,† Yuhei Hosokawa,† Shigenori Iwai,† Pascal Plaza,*,‡,§ and Pavel Müller*,¶

†

Graduate School of Engineering Science, Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka

560-8531, Japan ‡

PASTEUR, Département de chimie, École normale supérieure, UPMC Univ. Paris 06, CNRS, PSL

Research University, 75005 Paris, France §

Sorbonne Universités, UPMC Univ. Paris 06, École normale supérieure, CNRS, PASTEUR, 75005

Paris, France ¶

Institute for Integrative Biology of the Cell (I2BC), CEA, CNRS, Univ. Paris-Sud, Université

Paris-Saclay, 91198, Gif-sur-Yvette cedex, France

*To whom correspondence should be addressed; Tel.: +81-6-6850-6219, Fax: +81-6-6850-6240, E-mail: [email protected] (J.Y.); E-mail: [email protected] (P.P.); E-mail: [email protected] (P.M.).

Keywords: DNA repair, DNA damage, photolyase, photoreduction, radical pair formation

1

ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT (6–4) photolyases ((6–4)PLs) are flavoproteins that use blue light to repair the UV-induced pyrimidine(6–4)pyrimidone photoproduct in DNA. Their FAD cofactor can be reduced to its repair-active FADH– form by a photoinduced electron transfer reaction. In animal (6–4)PLs, a chain of four Trp residues was suggested to be involved in a step-wise transfer of an oxidation hole from the flavin to the surface of the protein. Here, we investigated the effect of mutation of the fourth Trp on the DNA photorepair activity of Xenopus laevis (6–4)PL (Xl64) in bacterial cells. The photoreduction and photorepair properties of this mutant protein were independently characterized in vitro. Our results demonstrate that the mutation of the fourth Trp in Xl64 drastically impairs the DNA repair activity in cells, and that this effect is due to the inhibition of the photoreduction process. We thereby show that the photoreductive formation of FADH– through the Trp tetrad is essential for the biological function of the animal (6–4)PL. The role of the Trp cascade, and of the fourth Trp in particular, are discussed.

2


Page 2 of 31

Page 3 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Introduction Photolyases (PLs) are flavoproteins able to perform light-dependent repair of UV-damaged DNA, namely cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6–4)pyrimidone photoproducts ((6– 4) photoproducts, (6–4)PPs). Evolution gave rise to specialized photolyases, namely CPD photolyase (CPD-PL) and (6–4) photolyase ((6–4)PL), which selectively repair the respective lesions.1 In both PLs, flavin adenine dinucleotide (FAD), in its fully-reduced form FADH–, plays a central role in the repair process.1,2 Upon photoexcitation of FADH–, an electron is transferred from FADH– to the UV lesions within a few hundreds of picoseconds,3-6 thereby eliciting a spontaneous bond breakage and/or rearrangement. Repair was shown to be completed within ~1 ns in the particular case of CPD-PL.4,6,7 A more complex behavior is still under debate for (6–4)PL.5,8-10 PLs are closely related to cryptochromes (Crys), which are blue-light receptors responsible for biological responses to light such as photomorphogenesis of plants, entrainment of the circadian clock in both plants and animals, and likely also photo-magnetoreception.1,11,12 PLs and Crys share high homology in sequences, chromophores, and tertiary structures, although most Crys possess an additional extension of the C-terminal domain. PLs and Crys also share a secondary photoreaction, often called photoactivation, in which the functionally-inactive oxidized or semi-reduced form of FAD (FADox and FADH•) are reduced to the functionally-active FAD•– and/or FADH– by a photoinduced electron transfer involving intrinsic electron donors.12 As initially demonstrated in the case of the CPD-PL of E. coli (EcCPD) in semi-reduced form, excitation of the flavin triggers an ultrafast electron abstraction (30 ps) from a neighboring tryptophan residue (referred to as Trp1).13,14 The oxidation hole sitting on Trp1 then quickly migrates (ps timescale) via the second tryptophan (Trp2) to the third one (Trp3), situated at the protein surface and exposed to the environment.13-16 3


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The oxidized Trp3 radical may finally react with an extrinsic reductant, which completes the overall reduction process.2 This picture was somewhat enriched for EcCPD in oxidized form, by the involvement of auxiliary tryptophans, but the main photoreduction chain remained identical.17 Similar schemes were proposed for other photolyases and cryptochromes.18-20 It may be mentioned that alternative reduction pathways involving modified, truncated, branched, or secondary electron transfer chains, were reported for a few photolyases and cryptochromes.21-26 Noteworthy, the flavin photoreduction mechanism has been suggested to be at the heart of signal transduction by plant Crys.27,28 Recently, Müller et al. discovered in the (6–4)PL of Xenopus laevis (Xl64) a fourth tryptophan (W370, Figure 1; generically noted as Trp4), predicted to be the final electron donor of an extended, four-membered photoreduction chain (tetrad).29 Such a fourth Trp was found to be conserved only within animal (6–4)PLs and animal Crys,29 while plant (6–4)PLs and plant Crys utilize the canonical Trp triad (Figure 1b). Transient absorption measurements revealed that the charge recombination rate between FAD•– (produced upon photoreduction of the initial FADox form) and Trp• (formed after deprotonation of the initial TrpH•+ oxidized species) is largely accelerated (4,000-fold) in a point mutant inactivating Trp4 (W370F), as compared to the wild type (WT),29 in the absence of an extrinsic reductant. This acceleration showed that the final electron donor in W370F is Trp3 (situated at a shorter distance from the flavin than Trp4), while in the WT this role falls to Trp4. A recent theoretical study indicated that the electron transfer from Trp4 to Trp3H•+ in Xl64 is an energetically downhill reaction,30 supporting the idea that Trp4 is the final electron donor. The results of Müller et al. suggest that photoproduced FADH– might be formed with a lower yield in cells carrying the W370F mutant than in cells carrying the WT. The shorter lifetime of the FAD•– 4


Page 4 of 31

Page 5 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

/Trp• pair would indeed hamper an efficient scavenging of the Trp• radical by the naturally present extrinsic reductants and thereby restrain the stabilization of the reduced flavin. Supposing additionally that FADH– would not be the prevailing redox state of the flavin in living cells, in the dark, it might be expected that W370F mutation would affect the photoactivation reaction (i.e. the photoinduced formation of FADH–) and, consequently, the photorepair activity in cells – in spite of the fact that the Trp chain is not directly involved in the photorepair reaction.

Figure 1. Electron-transferring tryptophan residues in the (6–4)PL from Xenopus laevis. (a) A model structure29 of Xl64. FAD in the active site and the four Trp residues are highlighted. (b) Partial sequence alignment focused on the Trp triad/tetrad among different PLs. Note that the amino acid residue corresponding to the Trp4 position in EcCPD and At64 is L356 and F380, respectively. Abbreviations: Ec = Escherichia coli; At = Arabidopsis thaliana; Dm = Drosophila melanogaster; Xl = Xenopus laevis.

In the present work, our first objective was to investigate the role of Trp4 in the DNA photorepair reaction of an animal (6–4)PL, namely Xl64, in living (bacterial) cells. For this purpose, a phenotypic UV survival assay of E. coli was performed on strains carrying either WT Xl64 or its 5


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

W370F mutant. For the sake of comparison, we have also studied photorepair in cells with strains carrying the (6–4)PL of a plant, Arabidopsis thaliana (At64). In that case, since the photoreduction chain of At64 is the standard Trp triad (Figure 1b), the effect of the mutation of the terminal Trp3 (W329) was examined. In order to further characterize the intrinsic photoreduction and photorepair processes of WT and W370F Xl64, these reactions were independently investigated in vitro.

Materials and Methods Site-directed mutagenesis Site-directed mutagenesis of Xl64 for E. coli UV survival assay was performed with either a QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies, La Jolla, CA) for W370F or a PrimeSTAR Mutagenesis Basal kit (Takara-Bio, Inc., Shiga, Japan) for the H354A control, using a pGEX4T-2 plasmid encoding WT-Xl649 as a template. The following sets of PCR primers were used: - d(CCCGAGGGGACCTCTTCATATCGTGGGAAG) and d(CTTCCCACGATATGAAGAGGTCCCCTCGGG) for W370F, - d(ATCCACGCTTTAGCTCGACATGCTGTC) and d(AGCTAAAGCGTGGATCCATCCTTCTGT) for H354A. Site-directed mutagenesis of Arabidopsis thaliana (6–4)PL (At64) was also performed with the QuickChange II Site-Directed Mutagenesis kit, using a pGEX4T-1 plasmid encoding WT-At64 (which was kindly offered by Dr. Takeshi Todo, Osaka University, Japan) as a template. The set of PCR primers for the W329F mutant was as follows: - d(TAGATTCCATTCAACGAGGATCATGCTATG) and 6


Page 6 of 31

Page 7 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

d(CATAGCATGATCCTCGTTGAATGGAATCTA). After PCR amplification according to the manufacture instructions, E. coli DH5α competent cells were transfected with the products. The purified plasmids were sequenced and used for the survival assay.

Cell culture The Escherichia coli SY32 strain lacking phr, recA, and uvrA genes, but transfected with a pACYC184 plasmid encoding E. coli CPD-PL to ensure specific photorepair of CPD lesions, was kindly gifted by Dr. Takeshi Todo (Osaka University, Japan). After colony selection by Luria-Broth (LB) agar plates containing tetracycline (10 µg mL–1) and chloramphenicol (10 µg mL–1), the cells were further transfected with a pGEX4T-2 plasmid, either vacant or encoding wild-type Xl64, or its H354A or W370F mutants. Further colony selection by LB agar plates containing tetracycline (10 µg mL–1) and ampicillin (80 µg mL–1) yielded transfectants able to repair UV-damaged DNA only by exogenous photoreactivating enzymes. The same procedure was applied for preparation of the SY32 strain producing wild-type At64 or its W329F mutant, to investigate the mutation effect of the terminal electron donor in the Trp triad of At64. The co-transfected bacteria were cultured in a Terrific Broth medium (1.5 mL) at 37°C overnight, and the culture was diluted by one third with a LB medium. To this diluted culture (1 mL), 2.4 µL of 10 mg mL–1 isopropyl

β-D-1-thiogalactopyranoside was added, and the resultant mixture was shaken at 37°C for 1 h. The expression level of Xl64 was confirmed by western blotting (see Supporting Information (SI) §1 and discussion therein). We in particular checked that the mutants of Xl64 (H354A and W370F) are distributed in the soluble part of the cell as much as the WT form, and are therefore equally 7


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

available for potential photorepair activity.

UV survival assay The above-described culture was appropriately diluted, and aliquots (150 µL) were spread onto LB agar plates containing tetracycline, chloramphenicol, and ampicillin. The plates were irradiated by a 20 W UV germicidal lamp (UVL20PH-6, Sen Lights Co. Ltd., Osaka, Japan) through metal mesh filters (2.0 µW cm–2, calibrated with a UVX radiometer equipped with a 254 nm probe, UVP, LLC, Upland, CA) for 15 s or 30 s, to yield the total irradiance of 0.3 or 0.6 J m–2. Subsequently, the plates were illuminated with fluorescent lamps (18W×4, FL20SSD/18, Toshiba, Tokyo, Japan) for 30 min, and then were incubated at 37°C overnight. The formed colonies were counted, and the numbers were corrected taking into account the dilution percentage. All survival rates were normalized to that measured without UV irradiation (set thus to 1). The experiments were independently performed in triplicate (n =3), and the data were analyzed by student’s t-test. Statistic significance was set to P < 0.05.

Photoreduction assay The recombinant W370F mutant and wild-type of Xl64 were prepared as described previously,29 and the FAD content of the obtained proteins was determined by UV/Vis absorption spectroscopy (see SI §2 and Fig. S2). Their anaerobic samples were also prepared as described previously.9 Briefly, the stock solution of the mutant or wild-type (typically 50–100 µM, dissolved in a buffer consisting of 50 mM Tris-HCl (pH 8.0), 50 mM NaCl, and 5% glycerol) was diluted with a reaction buffer consisting of 10 mM phosphate, 100 mM NaCl, and 5% glycerol (pH 7.1), and the mixture 8


Page 8 of 31

Page 9 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(65 µL) was passed through a gel-filtration column (Micro Bio-spin 6, BioRad), equilibrated with the reaction buffer. The eluate (60 µL) was transferred to an anaerobic 10×2×8 mm (length×width×height) inner volume quartz cuvette (Starna, 16.160-F/4/Q/10 GL 14/2/Z15). The solution was purged with argon through a septum, and the samples for measurement (240 µL with cysteine) were prepared in a glove box, in which the oxygen level was kept below 5 ppm. Finally, anaerobic samples containing the enzyme and 1 and 6 mM cysteine in the reaction buffer were prepared. The anaerobic samples were illuminated through the 10×8 mm window with continuous light (~ 430–800 nm) from a LQX1800 xenon lamp (Linos), through an optical fiber and colored glass filters (2 mm GG435 and 2 mm KG3, Schott). The illumination period was controlled by a mechanical shutter integrated in the lamp, which was connected to a DG535 function generator (Stanford Research). After light illumination for a certain period, the sample solution was mixed well by gently shaking the cuvette, and an absorption spectrum (240–700 nm) was measured through the 10 mm path with a Uvikon XS spectrophotometer (Secoman), in which the sample holder was cooled to 10°C. Detailed analysis using the recorded spectra were carried out by a homemade Mathematica (Wolfram) routine (see SI §5).

DNA photorepair assay Steady-state spectrophotometric DNA repair assay with the W370F mutant Xl64 was performed as described previously for the WT.9 A sample (240 µL) containing about 2.5 µM W370F Xl64, 10 mM phosphate, 100 mM NaCl, 5% glycerol, and 20 mM cysteine (pH 6.7) was anaerobically prepared as mentioned above, and this solution was subjected to 16 min illumination. The sample 9


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 31

containing ∼80% FADH– (Figure S3b) was transferred into the glove box, and 10 µL of 1 mM (6– 4)PP-containing 10-mer oligonucleotide, d(HHHHT(6–4)TTHHH), where H and T(6–4)T represent 5,6-dihydrothymidine and the (6–4)PP, respectively, were added to the solution. The prepared sample was illuminated with monochromatic continuous light centered at 384 nm (with a bandwidth of 10 nm) as described previously.9 After illumination, the sample was mixed and an absorption spectrum was measured in a spectral range of 240–500 nm. With the same setup configuration, an actinometry

experiment

was

then

performed

using

p-dimethylaminobenzenediazonium

tetrafluoroborate to determine the excitation rate per absorbing center (Figure S5).

Results Effect of W370F mutation on the DNA repair activity in bacterial cells To detect the DNA repair activity of the Xl64 in living cells, we used a bacterial model lacking any DNA repair activities for UV-damaged DNA (E. coli SY32 strain lacking phr, uvrA, and recA genes). The strain was co-transfected with two plasmids, one for constitutive expression of EcCPD gene and another for overexpression of WT or mutants of Xl64 gene (see Figure 2a and Figure S1), and thus repair of the UV lesions entirely depends on exogenously added photolyase genes.31 DNA repair was detected by the phenotypic survival of bacteria upon successive irradiation by UV light, which causes formation of UV lesions, and by white light for recovery of the cells by photorepair of the damaged DNA (Figure 2a). To verify that the model system works properly, survival of bacteria in the presence or absence of WT of Xl64 was investigated with or without white light illumination (Figure 2b). Without white light illumination, survival of bacteria in the presence and absence of Xl64 were very low (in a range between 10–6 and 10–7 upon 0.6 J m–2 UV irradiation), because the 10


Page 11 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

formed UV lesions could not be repaired. With white light illumination, the survival of Xl64-producing bacteria recovered to 26 ± 3.2%, suggesting that the UV lesions formed upon UV irradiation were repaired by photolyases in cells. Although the survival of bacteria in the absence of Xl64 also partially recovered (to 0.7 ± 0.2%) upon the white light illumination (because of the repair of the CPD lesions by constitutively-produced EcCPD), the survival in the absence of Xl64 was much lower than that in the presence of Xl64. The difference reflects the successful activation of (6–4)PP photorepair in the Xl64-producing strain.

11


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Analysis of DNA repair by (6–4)PLs in bacterial cells. (a) Experimental procedure. (b) Survival of E. coli producing wild-type Xl64 upon 0 (open bar), 0.3 (shaded bar), and 0.6 (gray bar) J m–2 UV irradiation, with or without following white-light illumination. The presence or absence of enzyme is indicated by + and – signs, respectively. (c) Survival of E. coli producing WT or mutants of Xl64 or At64. As a control, a vacant vector (pGEX4T-2 for Xl64 or pGEX4T-1 for At64) was transfected into cells (shown as “–”), and its survival was also measured. The experiment was 12


Page 12 of 31

Page 13 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

performed in triplicate (n =3); each point and error bar represents mean ± SD. The significance of the effects of the presence of Xl64 and of the mutation (W370F for Xl64 and W329F for At64) were statistically analyzed by t-test. The statistic significance cutoff was set to 0.05. P-values of 0.0005 (*), 0.0002 (**), and 0.0089 (***), associated to relevant pairs of measurements, indicate high significance of the observed differences.

The survival of bacteria producing WT or W370F mutant of Xl64 were measured and compared to control experiments performed with strains producing an established repair-defective Xl64 mutant (H354A)31,32 (Figure 2c). The H354A mutation caused the survival (1.3 ± 0.1%) to be lowered to nearly the same level as the (6–4)PL-lacking strain, demonstrating that the H354A mutant has indeed impaired DNA repair ability, as expected. The W370F-mutated bacteria also displayed only a limited survival (0.4 ± 0.2% at 0.6 J m–2), i.e., similar to the photorepair-lacking strains. Prolonged white light illumination up to 90 min did not increase the survival of the W370F-mutated bacteria. These observations suggest that the W370F mutation significantly alters DNA repair activity of Xl64 in bacterial cells. Our tentative explanation is that this could be due to an alteration of the photoactivation process, inhibiting the formation of repair-active FADH–. To confirm the involvement of the photoactivation reaction in the DNA repair in cells, the survival of bacteria producing WT or W329F mutant of At64 were examined in the same way. In contrast to Xl64, At64 possesses the canonical Trp triad (see Figure 1b). In the mutant, Trp3 (W329, the final electron donor in the photoactivation process of At64) was replaced with non-reducible phenylalanine, and therefore photoreduction of FAD is expected to be inhibited due to accelerated charge recombination. The results (Figure 2c) clearly show that survival of bacteria producing 13


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

W329F mutant is strikingly reduced (0.1 ± 0.01% at 0.6 J m–2) and about as low as that lacking At64 (0.05 ± 0.02%). These results strongly suggest that, in our model system, DNA repair by (6– 4)PLs requires a preceding photoactivation reaction, and also indicate that not only the terminal Trp residues (4th Trp in Xl64 and 3rd Trp in At64) but the whole Trp chains are essential for the photoactivation in cells.

DNA repair activity of W370F in vitro To draw definitive conclusions from the results of the survival assay, one however needs to make sure that the intrinsic DNA repair ability of Xl64 is conserved in the W370F mutant. To check this, we performed a spectrophotometric DNA repair assay in vitro, on the purified W370F mutant, bearing the flavin cofactor in its repair-active FADH– state. A solution of W370F in the presence of 20 mM cysteine, acting as an extrinsic reductant, was prepared under anaerobic conditions, to avoid re-oxidation by molecular oxygen.33 It was then illuminated for 16 min with white light in order to photoreduce the flavin. Global analysis of the absorption spectrum (fit with a weighted sum of reference spectra associated to be the pure redox species; see SI, §3) revealed that this sample contained ∼4% FADox, ∼16% FADH•, and ∼80% FADH– (Figure S3b). As previously described,9 a (6–4)PP-containing substrate was added to the solution under anaerobic conditions, and the mixture was subjected to continuous irradiation at 384 nm (the excitation rate per absorbing center was estimated to 0.088 s-1; Figure S5). DNA repair was quantified by the absorption increase at 265 nm and bleaching at 325 nm (Figure 3), which correspond to the restoration of intact TT bases and depletion of the (6–4)PP, respectively. Taking into account the estimated concentration of FADH–, the slope of the absorption increase at 265 nm, and the 14


Page 14 of 31

Page 15 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

irradiation rate, the steady-state quantum yield of photorepair (ηss) by the W370F mutant was found to be 5.9% (see SI, §4). According to Yamamoto et al.,9 ηss in fact depends on the irradiation rate (because full repair requires the absorption of two subsequent photons). Using the parameters reported in the previous work and the present irradiation rate (0.088 s–1), one calculates a value of 5.5% for ηss in WT, which is very close to the one presented here for W370F. This result indicates that the local structure of the active site directly interacting with the (6–4)PP, the FAD binding site, and the non-specific DNA binding area of the W370F mutant are quite similar to those of WT. The orientation and distance between FAD and the (6–4)PP are likely as well conserved in WT and W370F. We thus exclude the possibility that the W370F mutation causes any significant alteration of the functional structure of Xl64, and conclusively prove that the W370F mutant retains the full DNA repair ability of WT once FADH– is formed.

Figure 3. DNA repair assay. The (6–4)PP-containing oligonucleotide was added to a photoreduced W370F sample (by 16 min white light illumination in the presence of 20 mM cysteine, under anaerobic conditions), and the mixture was irradiated with monochromatic light at 384 nm (at an 15


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

excitation rate per absorbing center of 0.088 s–1). The absorption spectrum was measured after given times of irradiation. The inset represents the absorbance increase at 265 nm and decrease at 325 nm.

In-vitro photoreduction of Xl64 in the presence of extrinsic reductant Given the above demonstration, we next investigated the reason why altering the photoreduction chain of W370F has such a dramatic impact on the photorepair in cells, while it has none on the in vitro photorepair. The simplest answer would be that the formation of FADH– is impaired in W370F-containing cells. In their previous study, Müller et al. demonstrated that charge recombination between FAD•– and Trp• in W370F is 4,000 times faster than that in the WT protein.29 This observation does not imply that FAD cannot be reduced at all by photoexcitation in W370F cells; it merely suggests that the reduction of the distal tryptophanyl radical (Trp3•) by an extrinsic reductant would likely be much less efficient, and so would also be the stabilization of the reduced flavin. To clarify this point, we have measured the kinetics of photoreduction of purified Xl64 in solution (both in WT and W370F) under steady-state irradiation by white light (>430 nm), in the presence of a mild reductant, cysteine (under anaerobic conditions). In the case of WT, in the presence of 1 mM cysteine, photoreduction from FADox to FADH– was observed to occur on the timescale of a few seconds (Figure 4a). The formation and decay of the intermediate FADH• form, with characteristic absorption bands in the 500-650 nm region, was clearly detected. By contrast, in the W370F mutant under identical conditions, the same process was observed but on a much slower timescale, of the order of several minutes (Figure 4b).

16


Page 16 of 31

Page 17 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 4. Photoreduction of (a) wild-type Xl64 or (b) its W370F mutant in the presence of 1 mM cysteine. Xl64 in a buffer containing 10 mM phosphate (pH 7.1), 100 mM NaCl, 5% glycerol, and 1 mM cysteine were prepared anaerobically and illuminated with λ >430 nm light. Steady-state absorption spectra were measured after given times of illumination. (c) Kinetics of FADox photoreduction in WT (black line) or W370F mutant (colored lines) of Xl64 for 1 and 6 mM of cysteine, calculated from the actual concentration profiles of the FAD species upon light illumination (see Figure S7 and SI §5). An inset represents the expanded view of the kinetics up to 0.1 min.

To analyze the photoreduction data, a global fit of the full set of time-dependent absorption spectra was performed. In this fit, the spectra of the pure redox species were imposed and the parameters of a kinetic model were adjusted (see SI §5 for details). The following cascading model was used for all the data: FADox

k1

FADH•

k2

FADH–

Here, k1 and k2 stand for effective photoreduction rates of FADox and FADH•, respectively. It should be mentioned that, in the case of WT, it was found necessary to add a constant (time-independent) 17


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 31

spectrum to obtain a good fit (see SI §5). This additional spectrum, which was adjusted during the fitting procedure, resembles that of a FADox species. The characteristic vibrational structures of its 450-nm band are however much less pronounced than in the standard spectrum of PL-bound FADox, without reaching the unstructured shape of free FADox in solution.34 This suggests that this constant spectrum could correspond to FADox bound either to a damaged protein, the photoreduction chain of which is not functional, or bound to a different site (hypothetically the vacant antenna-binding site), where efficient photoreduction is not possible. The obtained rate constants are summarized in Table 1.

Table 1. Rate constants obtained by global analysis.

WT W370F

[Cys]

k1 (s–1)

k2 (s–1)

1 mM 1 mM 6 mM

2.68 ± 0.03 2.39×10-3 ± 3×10-5 3.55×10-3 ± 3×10-5

2.36 ± 0.04 6.6×10-3 ± 2×10-4 6.1×10-3 ± 1×10-4

It appears that k1 and k2 are much larger for WT than for W370F. In the presence of 1 mM cysteine, and under the same irradiation conditions, k1 was found to be more than a thousand times larger for WT than for W370F. This should be related to the reported fact that charge recombination following photoinduced charge separation is much slower in WT than in W370F (4,000 times in the absence of extrinsic reductant29). This suggests that charge recombination is so fast in W370F that it very efficiently hinders the external reduction process while, in WT, charge recombination is slow enough to allow external reduction to proceed with a high yield (Figure 4c). To qualitatively illustrate the competition between charge recombination and extrinsic reduction, we

18


Page 19 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

performed an additional measurement on W370F in the presence of a higher concentration of cysteine, namely 6 mM. We found that k1 increased by a factor of 1.5 and that no acceleration was observed for k2 (results in Table 1, Figure S6 and Table S1). The acceleration of k1 is compatible with an increase of extrinsic reduction rate due to the higher reductant concentration and validates the competition picture sketched above. As far as k2 is concerned, it is difficult to discuss its apparent independence on the cysteine concentration. More information should be gathered, in particular the recombination rate between FADH– and the Trp radicals in both proteins when FADH• is excited, but doing such an experiment is not straightforward because Xl64 (both WT and W370F) is purified with FADox. We would therefore like to stress that the main result of this in vitro photoreduction assay is that k1 is 1,000-fold slower in W370F than in the WT at the same cysteine concentration.

Discussion Origin of the photorepair inhibition of W370F in cells Our results clearly show that the Trp4-lacking W370F mutant of Xl64 retains its DNA repair ability in vitro but displays impaired repair activity in cells. The simplest explanation for this apparent discrepancy is provided by our demonstration that the photoreduction of FAD, in the presence of extrinsic reductant, is greatly inhibited by the W370F mutation. Altogether, these elements strongly suggest that photorepair in bacterial cells requires photoreduction of the flavin as a first step. If this step is hindered, photorepair cannot proceed even if the protein is intrinsically capable of performing it.

19


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Potential role of the antenna cofactor Although FADH– is the central chromophore for the DNA repair by PLs, PLs are known to possess a secondary chromophore in vivo, a photoantenna that harvests light and transfers the excitation energy to FADH– via a Förster mechanism. Thus far, several antenna chromophores were found in PLs/Crys, such as methenyltetrahydrofolate and flavin derivatives,23,35-38 but the antenna chromophore for Xl64 is not identified yet. The (6–4)PL from Drosophila melanogaster (Dm64) reportedly binds 7,8-didemethyl-8-hydroxy-5-deazaflavin (8-HDF) as the antenna cofactor.36 However, recombinant (6–4)PLs obtained from overexpression in bacteria typically lack the antenna.32,39 Taking into account the sequence similarity to Dm64, Xl64 probably also binds 8-HDF. Since bacteria cannot produce 8-HDF due to the lack of deazaflavin synthase, Xl64 produced in bacteria in our survival assay would likely be antenna-free. If present (which is the likely situation in the native organisms), the antenna should enhance the capacity of (6–4)PLs to capture and use more light for photorepair1 once the FAD cofactor is fully reduced. It should also enhance the efficiency of the photoactivation process, for the same reason. The fact that the photoactivation of the (6–4)PLs is a physiologically relevant and vital process is however not expected to depend on the presence of antenna.

Comparison with EcCPD In previous studies, survival assays using E. coli strains, which express an EcCPD mutant lacking its terminal electron donor Trp3 (W306), were performed.40,41 These reports showed that the W306F mutation of EcCPD inhibited its in vitro photoreduction process but did not cause decrease in the survival rate, thereby suggesting that flavin was already present in its fully reduced state (FADH–) 20


Page 20 of 31

Page 21 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

in EcCPD in bacteria42 and that the photoactivation reaction was not necessary. Nevertheless, our results show that this is not the case for the animal and plant (6–4)PLs: FADH– is clearly not the prevailing redox state of FAD in the dark and the photoreduction (photoactivation) through the Trp chain is crucial to DNA photorepair in our model system. Searching for an explanation of this major difference, it is worth recalling that while the isolated EcCPD typically contains FAD in its FADH• form,13 the isolated Xl64 in aerated solutions contains virtually pure FADox.43,44 These redox states are in fact very stable: oxidation of FADH• to FADox by O2 in EcCPD requires harsh and long (24h) incubation at high pH,17 while photoreduced FADH• and FADH– in Xl64 are readily (in a few minutes) reoxidized back to FADox by O2 even at pH 8, under aerobic conditions.39 Since reduction/oxidation of the FADox/FADH• pair requires protonation/deprotonation, these observations suggest that the proton transfer to and from the N5 atom of the isoalloxazine is very hard under physiological pH in EcCPD (sterically/kinetically hindered access of the proton acceptor to N5). It may further be noted that the dark chemical reduction of FADox is thermodynamically more difficult than that of FADH• (symmetrically, oxidation of FADH• is easier than that of FADH–). The one-electron redox potentials of the FADox/FADH• pair in solution (at pH 7) is indeed lower (-0.314 V) than that of FADH•/FADH– (-0.124 V),45 although these potentials can of course be modified by the protein environment.46

Redox state of Xl64 in bacterial cells Given the above elements, the following hypothetical model could tentatively be proposed. Since the cell is known to provide a slightly reducing environment, one can first imagine that the FAD cofactor is initially incorporated in semi or fully reduced form into both proteins, upon their 21


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

synthesis. For EcCPD, the potential for the FADH•/FADH– transition is known to be increased to -0.05 to +0.02 V,46,47 which further shifts the redox equilibrium in favor of FADH–. Assuming the same were true for Xl64, the difference between the two proteins might be that the minor pool of the FADH• species would be continuously drained by a thermodynamically favorable oxidation, leading to a dominant fraction of FADox in Xl64, while the hindered deprotonation of FADH• in EcCPD would block this very oxidation and maintain FADH–. Note that, in the UV survival assay, white-light illumination prolonged up to 90 min did not cause recovery of the survival of the W370F-producing cells (Figure 2c). This observation would also be in line with a favorable reversion of reduced flavin to FADox in Xl64. We indeed believe that, for the W370 mutant, in which the FAD photoreduction is very inefficient, reoxidation to FADox in the aerobic environment of the bacterial cell effectively inhibits the accumulation of FADH–, thereby explaining the lack of effect of the illumination time. Since our experimental results (excluding the presence of significant amounts of FADH– in Xl64 in our model system) are compatible with the above framework, we propose that the prevailing dark redox state of antenna-free Xl64 in its native organism is probably the same as in vitro, i.e., FADox. Given structural similarities and our comparative results for At64, this is likely to be the case for all (6–4) PLs and probably also for animal Crys.

Conclusions We experimentally demonstrated that mutation of the fourth Trp involved in the photoactivation process of an animal (6–4)PL impairs DNA repair activity in bacterial cells, while the recombinant mutant retains full DNA repair ability once FADH– is formed. An in vitro photoreduction 22


Page 22 of 31

Page 23 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

experiment in the presence of external reductant additionally showed that the rate constant for FADox photoreduction is decreased by a factor of ~1,000 in the W370F mutant as compared to WT. From the preserved DNA repair activity of the W370F mutant in vitro, we deduce that WT and W370F proteins likely share the same general protein fold, FAD incorporation, FAD orientation, FAD pocket and DNA binding properties. This conclusion is further supported by the fact that WT and W370F are purified with the same FAD content. We therefore assume that WT and W370F are equally available, in amount and localization, for DNA photorepair in E. coli cells. We next argue that the impaired DNA repair activity of W370F mutant of Xl64 in bacterial cells is caused by the inhibition of the photoactivation process due to the absence of the fourth Trp. This conclusion is consistent with the results of the in vitro photoreduction assay, showing much slower photoreduction rate of W370F in the presence of external reductant. Our results strongly indicate that the prevailing dark state of FAD in both animal and plant (6–4)PLs in living bacterial cells is not FADH–. We cannot be completely sure that this is also the case in the native organisms (plants and animals), but we would like to speculate that the conservation of the FAD-reducing Trp chain and its further gradual enhancements by branching and/or elongation in the course of more than three billions of years of evolution are probably not merely coincidental. Our results suggest that the Trp chain indeed has a functional role and that, at least in the case of (6–4)PLs, an efficient DNA photorepair in living cells is likely conditioned by a preceding photoactivation of the enzymes. The rationale explaining the huge impact of the W370F mutation on photorepair in cells is that the FAD•–/Trp• recombination rate massively increases in W370F, making the extrinsic reduction an inefficient process. FADH– failing to be produced in cells in turn inhibits DNA photorepair. As Xl64 23


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

shares high homology with animal Crys, our results additionally suggest that the Trp tetrad is also likely to be relevant to their biological functions involving the photoreduction of the flavin chromophore.

Supporting Information Details of overexpression of Xl64 in E.coli (§1), FAD content of the purified enzymes (§2), spectral fitting (§3), steady-state quantum yield of photorepair (§4) and fit of the photoreduction data sets (§5), with a table and eight supporting figures.

Competing Financial Interests The authors declare no competing financial interests.

Acknowledgements The authors thank Dr. Takeshi Todo (Osaka University, Japan) and Dr. Klaus Brettel (CEA Saclay, France) for helpful discussions. This work was in part supported by the Japan Society for the Promotion of Science (25870400 and 16K07321 to J.Y.) and the French Agence Nationale de la Recherche (grant ANR-12-BSV8-0001).

References (1) Sancar, A. (2003) Structure and function of DNA photolyase and cryptochrome blue-light photoreceptors. Chem. Rev. 103, 2203–2238.

24


Page 24 of 31

Page 25 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(2) Brettel, K., and Byrdin, M. (2010) Reaction mechanisms of DNA photolyase. Curr. Opin. Struct. Biol. 20, 693–701. (3) MacFarlene, A. W. IV, and Stanley, R. J. (2003) Cis-syn thymidine dimer repair by DNA photolyase in real time. Biochemistry 42, 8558–8568. (4) Kao, Y.-T., Saxena, C., Wang, L., Sancar, A., and Zhong, D. (2005) Direct observation of thymine dimer repair in DNA by photolyase. Proc. Natl. Acad. Sci. U.S.A. 102, 16128–16132. (5) Li, J., Liu, Z., Tan, C., Guo, X., Wang, L., Sancar, A., and Zhong, D. (2010) Dynamics and mechanism of repair of ultraviolet-induced (6-4) photoproduct by photolyase. Nature 466, 887–890. (6) Liu, Z., Tan, C., Guo, X., Kao, Y.-T., Li, J., Wang, L., Sancar, A., and Zhong, D. (2011) Dynamics and mechanism of cyclobutane pyrimidine dimer repair by DNA photolyase. Proc. Natl. Acad. Sci. U.S.A. 108, 14831–14836. (7) Thiagarajan, V., Byrdin, M., Eker, A. P. M., Müller, P., and Brettel, K. (2011) Kinetics of cyclobutane thymine dimer splitting by DNA photolyase directly monitored in the UV. Proc. Natl. Acad. Sci. U.S.A. 108, 9402–9407. (8) Sadeghian, K., Bocola, M., Merz, T., and Schütz, M. (2010) Theoretical study on the repair mechanism of the (6-4) photolesion by the (6-4) photolyase. J. Am. Chem. Soc. 132, 16285–16295. (9) Yamamoto, J., Martin, R., Iwai, S., Plaza, P., and Brettel, K. (2013) Repair of the (6–4) photoproduct by DNA photolyase requires two photons. Angew. Chem. Int. Ed. 52, 7432–7436. (10) Faraji, S., and Dreuw, A. (2014) Physicochemical mechanism of light-driven DNA repair by (6-4) photolyases. Annu Rev Phys Chem 65, 275–292. (11) Lin, C., and Shalitin, D. (2003) Cryptochrome structure and signal transduction. Annu. Rev. Plant Biol. 54, 469–496. 25


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(12) Chaves, I., Pokorny, R., Byrdin, M., Hoang, N., Ritz, T., Brettel, K., Essen, L.-O., van der Horst, G. T. J., Batschauer, A., and Ahmad, M. (2011) The cryptochromes: blue light photoreceptors in plants and animals. Annu. Rev. Plant Biol. 62, 335–364. (13) Aubert, C., Vos, M. H., Mathis, P., Eker, A. P. M., and Brettel, K. (2000) Intraprotein radical transfer during photoactivation of DNA photolyase. Nature 405, 586–590. (14) Byrdin, M., Eker, A. P. M., Vos, M. H., and Brettel, K. (2003) Dissection of the triple tryptophan electron transfer chain in Escherichia coli DNA photolyase: Trp382 is the primary donor in photoactivation. Proc. Natl. Acad. Sci. U.S.A. 100, 8676–8681. (15) Byrdin, M., Lukacs, A., Thiagarajan, V., Eker, A. P. M., Brettel, K., and Vos, M. H. (2010) Quantum yield measurements of short-lived photoactivation intermediates in DNA photolyase: toward a detailed understanding of the triple tryptophan electron transfer chain. J. Phys. Chem. A 114, 3207–3214. (16) Liu, Z., Tan, C., Guo, X., Li, J., Wang, L., and Zhong, D. (2014) Dynamic determination of active-site reactivity in semiquinone photolyase by the cofactor photoreduction. J. Phys. Chem. Lett. 5, 820–825. (17) Liu, Z., Tan, C., Guo, X., Li, J., Wang, L., Sancar, A., and Zhong, D. (2013) Determining complete electron flow in the cofactor photoreduction of oxidized photolyase. Proc. Natl. Acad. Sci. U.S.A. 110, 12966–12971. (18) Kao, Y.-T., Tan, C., Song, S.-H., Oztürk, N., Li, J., Wang, L., Sancar, A., and Zhong, D. (2008) Ultrafast dynamics and anionic active states of the flavin cofactor in cryptochrome and photolyase. J. Am. Chem. Soc. 130, 7695–7701.

26


Page 26 of 31

Page 27 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(19) Brazard, J., Usman, A., Lacombat, F., Ley, C., Martin, M. M., Plaza, P., Mony, L., Heijde, M., Zabulon, G., and Bowler, C. (2010) Spectro-temporal characterization of the photoactivation mechanism of two new oxidized cryptochrome/photolyase photoreceptors. J. Am. Chem. Soc. 132, 4935–4945. (20) Immeln, D., Weigel, A., Kottke, T., and Pérez Lustres, J. L. (2012) Primary events in the blue light sensor plant cryptochrome: intraprotein electron and proton transfer revealed by femtosecond spectroscopy. J. Am. Chem. Soc. 134, 12536–12546. (21) Kiontke, S., Geisselbrecht, Y., Pokorny, R., Carell, T., Batschauer, A., and Essen, L.-O. (2011) Crystal structures of an archaeal class II DNA photolyase and its complex with UV-damaged duplex DNA. EMBO J. 30, 4437–4449. (22) Biskup, T., Hitomi, K., Getzoff, E. D., Krapf, S., Koslowski, T., Schleicher, E., and Weber, S. (2011) Unexpected electron transfer in cryptochrome identified by time-resolved EPR spectroscopy. Angew. Chem. Int. Ed. 50, 12647–12651. (23) Geisselbrecht, Y., Frühwirth, S., Schroeder, C., Pierik, A. J., Klug, G., and Essen, L.-O. (2012) CryB from Rhodobacter sphaeroides: a unique class of cryptochromes with new cofactors. EMBO Rep. 13, 223–229. (24) Biskup, T., Paulus, B., Okafuji, A., Hitomi, K., Getzoff, E. D., Weber, S., and Schleicher, E. (2013) Variable electron transfer pathways in an amphibian cryptochrome: tryptophan versus tyrosine-based radical pairs. J. Biol. Chem. 288, 9249–9260. (25) Müller, P., Bouly, J.-P., Hitomi, K., Balland, V., Getzoff, E. D., Ritz, T., and Brettel, K. (2014) ATP binding turns plant cryptochrome into an efficient natural photoswitch. Sci Rep 4, 5175.

27


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(26) Scheerer, P., Zhang, F., Kalms, J., Stetten, von, D., Krauß, N., Oberpichler, I., and Lamparter, T. (2015) The class III cyclobutane pyrimidine dimer photolyase structure reveals a new antenna chromophore binding site and alternative photoreduction pathways. J. Biol. Chem. 290, 11504– 11514. (27) Liu, H., Liu, B., Zhao, C., Pepper, M., and Lin, C. (2011) The action mechanisms of plant cryptochromes. Trends Plant Sci. 16, 684–691. (28) Müller, P., and Bouly, J.-P. (2015) Searching for the mechanism of signalling by plant photoreceptor cryptochrome. FEBS Lett. 589, 189–192. (29) Müller, P., Yamamoto, J., Martin, R., Iwai, S., and Brettel, K. (2015) Discovery and functional analysis of a 4th electron-transferring tryptophan conserved exclusively in animal cryptochromes and (6-4) photolyases. Chem. Commun. 51, 15502–15505. (30) Cailliez, F., Müller, P., Firmino, T., Pernot, P., and la Lande, de, A. (2016) Energetics of photoinduced charge migration within the tryptophan tetrad of an animal (6-4) photolyase. J. Am. Chem. Soc. 138, 1904–1915. (31) Hitomi, K., Nakamura, H., Kim, S.-T., Mizukoshi, T., Ishikawa, T., Iwai, S., and Todo, T. (2001) Role of two histidines in the (6-4) photolyase reaction. J. Biol. Chem. 276, 10103–10109. (32) Maul, M. J., Barends, T. R. M., Glas, A. F., Cryle, M. J., Domratcheva, T., Schneider, S., Schlichting, I., and Carell, T. (2008) Crystal Structure and Mechanism of a DNA (6-4) Photolyase. Angew. Chem. Int. Ed. 47, 10076–10080. (33) Müller, P., and Ahmad, M. (2011) Light-activated cryptochrome reacts with molecular oxygen to form a flavin-superoxide radical pair consistent with magnetoreception. J. Biol. Chem. 286, 21033–21040. 28


Page 28 of 31

Page 29 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(34) Brazard, J., Usman, A., Lacombat, F., Ley, C., Martin, M. M., and Plaza, P. (2011) New insights into the ultrafast photophysics of oxidized and reduced FAD in solution. J. Phys. Chem. A 115, 3251–3262. (35) Klar, T., Kaiser, G., Hennecke, U., Carell, T., Batschauer, A., and Essen, L.-O. (2006) Natural and non-natural antenna chromophores in the DNA photolyase from Thermus thermophilus. ChemBioChem 7, 1798–1806. (36) Glas, A. F., Maul, M. J., Cryle, M., Barends, T. R. M., Schneider, S., Kaya, E., Schlichting, I., and Carell, T. (2009) The archaeal cofactor F0 is a light-harvesting antenna chromophore in eukaryotes. Proc. Natl. Acad. Sci. U.S.A. 106, 11540–11545. (37) Zhang, F., Scheerer, P., Oberpichler, I., Lamparter, T., and Krauß, N. (2013) Crystal structure of a prokaryotic (6-4) photolyase with an Fe-S cluster and a 6,7-dimethyl-8-ribityllumazine antenna chromophore. Proc. Natl. Acad. Sci. U.S.A. 110, 7217–7222. (38) Kiontke, S., Gnau, P., Haselsberger, R., Batschauer, A., and Essen, L.-O. (2014) Structural and evolutionary aspects of antenna chromophore usage by class II photolyases. J. Biol. Chem. 289, 19659–19669. (39) Hitomi, K., Kim, S.-T., Iwai, S., Harima, N., Otoshi, E., Ikenaga, M., and Todo, T. (1997) Binding and catalytic properties of Xenopus (6-4) photolyase. J. Biol. Chem. 272, 32591–32598. (40) Li, Y. F., Heelis, P. F., and Sancar, A. (1991) Active site of DNA photolyase: tryptophan-306 is the intrinsic hydrogen atom donor essential for flavin radical photoreduction and DNA repair in vitro. Biochemistry 30, 6322–6329. (41) Kavakli, I. H., and Sancar, A. (2004) Analysis of the role of intraprotein electron transfer in photoreactivation by DNA photolyase in vivo. Biochemistry 43, 15103–15110. 29


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(42) Payne, G., Heelis, P. F., Rohrs, B. R., and Sancar, A. (1987) The active form of Escherichia coli DNA photolyase contains a fully reduced flavin and not a flavin radical, both in vivo and in vitro. Biochemistry 26, 7121–7127. (43) Kim, S. T., Malhotra, K., Taylor, J. S., and Sancar, A. (1996) Purification and partial characterization of (6-4) photoproduct DNA photolyase from Xenopus laevis. Photochem. Photobiol. 63, 292–295. (44) Todo, T., Kim, S.-T., Hitomi, K., Otoshi, E., Inui, T., Morioka, H., Kobayashi, H., Ohtsuka, E., Toh, H., and Ikenaga, M. (1997) Flavin adenine dinucleotide as a chromophore of the Xenopus (6– 4)photolyase. Nucleic Acids Res. 25, 764–768. (45) Anderson, R. F. (1983) Energetics of the one-electron reduction steps of riboflavin, FMN and FAD to their fully reduced forms. Biochim. Biophys. Acta 722, 158–162. (46) Balland, V., Byrdin, M., Eker, A. P. M., Ahmad, M., and Brettel, K. (2009) What makes the difference between a cryptochrome and DNA photolyase? A spectroelectrochemical comparison of the flavin redox transitions. J. Am. Chem. Soc. 131, 426–427. (47) Gindt, Y. M., Schelvis, J. P. M., Thoren, K. L., and Huang, T. H. (2005) Substrate binding modulates the reduction potential of DNA photolyase. J. Am. Chem. Soc. 127, 10472–10473.

30


Page 30 of 31

Page 31 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

For Table of Contents Use Only

Loss of fourth electron-transferring tryptophan in animal (6–4) photolyase impairs DNA repair activity in bacterial cells Junpei Yamamoto, Kohei Shimizu, Takahiro Kanda, Yuhei Hosokawa, Shigenori Iwai, Pascal Plaza, and Pavel Müller

31


Photolyase Impairs DNA Repair Activity in ... - ACS Publications

Recommend Documents