Article pubs.acs.org/bc
Photosensitizing Carrier Proteins for Photoinducible RNA Interference Yuka Matsushita-Ishiodori, Rina Kuwabara, Hiroyuki Sakakoshi, Tamaki Endoh, † and Takashi Ohtsuki* Department of Bioscience and Biotechnology, Okayama University, 3-1-1 Tsushimanaka, Okayama 700-8530, Japan S Supporting Information *
ABSTRACT: RNA interference (RNAi) is being widely explored as a tool in functional genomics and tissue engineering, and in the therapy of intractable diseases, including cancer and neurodegenerative diseases. Recently, we developed a photoinducible RNAi method using photosensitizing carrier proteins, named CLIP-RNAi (CPP-linked RBP-mediated RNA internalization and photoinduced RNAi). Novel carrier proteins were designed for this study to establish a highly efficient delivery system for small interfering RNA (siRNA) or short hairpin RNA (shRNA) and to demonstrate light-dependent gene silencing. In addition, the results suggested that the dissociation of the siRNA (or shRNA) from carrier proteins in the cytoplasm is a critical event in CLIPRNAi-mediated gene silencing.
■
released into the cytosol where they mediated gene silencing. This delivery system was named “CLIP-RNAi (CPP-linked RBP-mediated RNA internalization and photoinduced RNAi)”, and in this study, its use is demonstrated with newly designed carrier proteins (CPP-RBPs).
INTRODUCTION
RNA interference (RNAi)-mediated gene silencing is a valuable method for investigating gene function and for use in clinical applications.1,2 To deliver small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) efficiently into the cytosol, many RNA carriers, including lipids, nanoparticles, polymers, and viral vectors, have been developed.3 However, there is much room for improvement with respect to target gene specificity and the ability to regulate gene expression. In this regard, Shah et al. recently developed caged siRNAs, which enabled a spatially and temporally controlled RNAi.4 In this method, the attachment of photolabile protecting groups (caging groups) to siRNA blocks gene silencing activity in the absence of light, while the removal of the caging groups from the siRNA with an external light trigger results in the induction of the RNAi. A great variety of photolytic compounds capable of attaching themselves to RNAs have been identified, although their widespread use is limited by the optical wavelength for deprotection, which must be around 350 nm.5 Previously, we reported that the utilization of a fluorescent dye attached to an RNA carrier protein enabled lightdependent gene silencing.6−8 We designed a cell-permeable RNA-binding protein (TatU1A) labeled with a fluorescent dye (TatU1A-dye) as an RNA carrier. TatU1A is a fusion protein between a TAT-derived cell-penetrating peptide (CPP)9 and the U1A RNA-binding protein (RBP).10 The TatU1A-dye could undertake the specific delivery of an shRNA containing a U1A binding sequence in its loop region.6,7 The complexes formed between the TatU1A-dye and shRNA (TatU1A-dye/ shRNA) were internalized by cells via an endocytotic pathway. TatU1A-dye/shRNA complexes were entrapped in endosomes before photoirradiation, while after irradiation they were © 2011 American Chemical Society
■
EXPERIMENTAL PROCEDURES
Plasmid Construction. Double-stranded DNA encoding the flock house virus (FHV) coat peptide (residues 35 to 49) (RRRRNRTRRNRRRVR) was prepared by primer extension using the following primers, 5′- CCGCCCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCGCCGTCGCCGCAACCGCACCCGCCG-3′ (sense, NcoI site underlined) and 5′-CGCCGCTAGCGTAATCCGGAACATCGTATGGGTAGCCGCGCACGCGACGGCGGTTGCGGCGGGTGCGGTTGCG-3′ (antisense, NheI site underlined), and cloned into the NcoI-NheI site of the previously constructed pET-TatU1A-C plasmid,6 yielding pET-FHVU1A-C. The DNA segment encoding the Tat peptide (YGRKKRRQRRR) of pETTatU1A-C was converted to the cytoplasmic transduction peptide 512 (CTP512) (YGRARRRRRRR) using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) with the following primers: 5′-GCAGCGGCTACGGCCGCGCGCGTCGCCGCCGTCGCCGTCGCGGCTACCC-3′ (sense) and 5′-GGGTAGCCGCGACGGCGACGGCGGCGACGCGCGCGGCCGTAGCCGCTGC-3′ (antisense). The coding sequence for the RNA-binding domain of Drosophila Sex lethal protein (Sxl), was amplified with the Received: February 21, 2011 Revised: October 6, 2011 Published: October 11, 2011 2222
dx.doi.org/10.1021/bc200095a | BioconjugateChem. 2011, 22, 2222−2226
Bioconjugate Chemistry
Article
primers 5′-CCGCTCGAGTTAGGATCCCTTGCCATGCTCCTCAG-3′ (sense, XhoI site underlined) and 5′CGCGCTAGCGGCGCAAGCAACACCAACCTG-3′ (antisense, NheI site underlined) from the Drosophila Sxl cDNA clone, EDM1133−6921617 (Open Biosystems). Doublestranded DNA encoding the bacteriophage λ N peptide (λN) was amplified using the following primers: 5′-CCGCTCGAGTTAGGATCCAGGGCGGTTAACTGGTTTTGCGCTTACCCCAACCAACAGGGGATTTGCTGCTTCCATTG-3′ (sense, XhoI site underlined) and 5′-CGCGCTAGCGGCCTGGATGCACAAACACGCCGCCGCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGCAAATCC-3′ (antisense, NheI site underlined). The coding sequences for Sxl or λN were cloned into the XhoI-NheI site of pET-TatU1A-C,6 yielding pET-TatSxl-C, and pET-TatλN-C, respectively. Double-stranded DNA encoding the degradation signal peptide CL1 (ACKNWFSSLSHFVIHL) was prepared by primer extension using the following primers: 5′-CCGCGGATCCGCTTGCAAGAACTGGTTCAGTAGCTTAAGCCACTTTGTGA-3′ (sense, BamHI site underlined) and 5′CGGCCTCGAGTTAGCAGCTGTTAAGGTGGATCACAAAGTGGCTTAAGCTA-3′ (antisense, XhoI site underlined), and cloned into the BamHI-XhoI site of pET-TatU1A-C,6 yielding pET-TatU1A-CL1-C. All of the constructs contained a C-terminal Cys residue for later modification with Alexa Fluor 546 (Alexa546) C5 maleimide (Molecular Probes). The coding sequences of the above-mentioned plasmid vectors were confirmed by sequencing analysis with an ABI PRISM 310 genetic analyzer. Purification and Fluorescent Labeling of Proteins. The CPP-RBP plasmids described above were introduced into Escherichia coli BL21(DE3). Transformants were grown at 37 °C, and expression of CPP-RBPs was induced by the addition of isopropyl-β-D-thiogalactopyranoside (1 mM), followed by growth at 30 °C for 16 h. CPP-RBP proteins were purified as described previously,6 except for the TatU1A-CL1 protein, which was purified from the insoluble fraction. The carrier proteins were labeled with Alexa546 as previously described.6,7 Protein concentration was determined using a Protein Assay Kit (Bio-Rad), and the labeling efficiencies were calculated by measuring the absorbance of Alexa546 with a NanoDrop 1000 Spectrophotometer (Thermo Scientific). In all experiments, the labeling efficiencies were adjusted to 30% using separately prepared unlabeled carrier proteins. Preparation of siRNAs and shRNAs. The shRNA sequence used was as follows: 5′-GGCUACGUCCAGGAGCGCACAUUGCACUCCGUCGCGUCCUGGACGUAGCCUU-3′ (U1A binding sequences underlined).6,7 This shRNA and the 3′-FAM-labeled shRNA were from JBioS (Japan). To construct siRNA-type cargo RNAs, antisense and sense strands were dissolved in distilled water at final concentrations of 20 μM and were annealed by incubation at 90 °C for 1 min followed by a 60 min incubation at 37 °C. The target sequence in the enhanced green fluorescent protein (EGFP) mRNA was 5′-UGCGCUCCUGGACGUAGCCUU-3′. The sense strands contained 5′ short extensions, which bound to their respective RBPs, to make U1A-siRNA (5′-GGGCAUUGCACUCCGCCCUCUGGCUACGUCCAGGAGCGCAUU-3′), Sxl-siRNA (5′-GGUUGUUUUUUUUCUGGCUACGUCCAGGAGCGCAUU-3′), and λN-siRNA (5′-GGCCCUGAAAAAGGGCCUCUGGCUACGUCCAGGAGCGCAUU-3′). The RBP binding sequences are underlined. The 3′-FAM-labeled antisense strand
was purchased from JBioS and annealed with the sense strands to make FAM-labeled siRNAs. Cell Culture. Chinese hamster ovary (CHO) cells and destabilized EGFP stably expressing CHO (EGFP-CHO) cells 6 were cultured in Ham’s F-12 medium (Sigma) supplemented with 10% fetal bovine serum (Biowest), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco, Invitrogen, US). Cellular RNA Delivery by Carrier Proteins. The FAMlabeled RNA (200 nM) and carrier protein (2 μM) were mixed in T buffer [20 mM HEPES-KOH (pH 7.4), 115 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 0.8 mM MgCl2, and 13.8 mM glucose] and incubated at 37 °C for 10 min. CHO cells were grown on a 96-well plate to 70% confluence and were treated for 2 h with the carrier/ RNA complex mentioned above. After washing, the cells were visualized using a fluorescence microscope (Olympus, Japan). For endosomal escape of the carrier/RNA complex, cells were irradiated at 540 ± 10 nm for 11 s with a 100 W halogen lamp (Olympus USH-1030 L) passed through the 40× objective lens as described previously.6,7 Induction of RNAi-Mediated EGFP Gene Silencing and Analysis of EGFP Gene Expression. EGFP-CHO cells were grown on a 96-well plate to 70% confluence and treated for 2 h with the unlabeled RNA/carrier protein complex. The RNA was delivered to the cells by the carrier protein, and photoaccelerated endosomal escape was induced by irradiation at 540 ± 10 nm for 64 s with a 100 W halogen lamp passed through the 4× objective lens as described above. After 20 h of irradiation, cells were recovered from dishes and resuspended in PBS. The EGFP mean fluorescence intensities (MFIs) were analyzed by flow cytometry using FACSCalibur and CellQuest software (BD Biosciences). Data were acquired from 10 000 cells in all experiments.
■
RESULTS AND DISCUSSION Design of Carrier Proteins (CPP-RBPs). We previously demonstrated CLIP-RNAi-mediated EGFP silencing using CPPRBP protein (TatU1A) as an RNA carrier, and the silencing efficiency was 60−70%.6,7 The insufficient RNAi efficacy may be due to insufficient RNA delivery efficiency that relates to the cell-targeting activity of the CPP moiety of CPP-RBP or the size and RNA binding efficiency of the RBP moiety, or may be due to inhibition of the activity of the RNA with tightly bound CPP-RBP. To establish a highly efficient siRNA or shRNA delivery system, a series of CPPRBP proteins was constructed and purified (Figure 1).
Figure 1. RNA carrier protein design. Schematic diagram of the RNA carrier proteins used in this study. CPP, cell-penetrating peptide; RBP, RNA-binding protein. The C-terminal cysteine was labeled with Alexa546 as a photosensitizer.
First, CPP-U1A variants were prepared to examine whether changing the CPP moiety of TatU1A significantly improved the RNA delivery efficiency. An FHV coat peptide and a CTP512 peptide were selected as the CPP moiety. Recently, it was reported that the cellular uptake of the FHV peptide was higher than that of the 2223
dx.doi.org/10.1021/bc200095a | BioconjugateChem. 2011, 22, 2222−2226
Bioconjugate Chemistry
Article
Tat peptide.11 The FHV peptide was internalized by various cell types about 15- to 21-fold more efficiently than the Tat peptide. Cytoplasmic transduction peptides (CTPs) were designed to ensure efficient cytoplasmic delivery using computer-based molecular modeling.12 The CTP512 peptide was evaluated as the leading CTP as it possessed a transduction capacity approximately 5-fold that of the Tat peptide. Next, Tat-RBP variants were prepared. A partial sequence of the Drosophila Sex lethal protein and the bacteriophage λ N protein were used for the RBP moiety. Sex-lethal protein has two RNAbinding domains (RBDs), which are required for specific RNA binding.13−15 In this study, the protein region (173 amino acids), which included the two RBDs, was used and is hereafter referred to as Sxl. The dissociation constant (Kd) of the Sxl/RNA complex (∼5 pM) is lower than that of the U1A/RNA complex (20 pM);16,17 therefore, high RNAi efficiency due to increased RNA delivery efficiency might be expected from the Sxl/RNA interaction. In addition, the N-terminal region (36 amino acids) of the bacteriophage λ N protein, which included a relatively small RNA binding motif, was employed, and is hereafter referred to as λN. The high specificity and affinity of the complex between λN and the target RNA (Kd = 5 nM) have been demonstrated previously.18,19 The small size of λN may offer advantages over the internalization of other carrier proteins. Furthermore, to investigate whether the dissociation of the carrier protein from shRNA or siRNA in the cytoplasm accelerated RNAi-mediated gene silencing, a C-terminally extended TatU1A bearing the degradation signal peptide CL1 (TatU1A-CL1) was designed. The CL1 peptide is known to act as a degradation signal peptide via the ubiquitin−proteasome pathway,20,21 and the degradation of carrier proteins is thought to promote the release of free shRNA or siRNA into the cytoplasm. Effects of CPPs on RNAi Efficiency. To examine the effects of CPPs on RNAi efficiency, three CPP-U1A variants (TatU1A, FHVU1A, and CTP512U1A) were constructed and purified. The CPP-U1As were labeled with Alexa546 and were tested to determine whether they carried the shRNA into cells and whether the carrier/shRNA complexes were released from the endosome by photostimulation. FAM-labeled shRNAs were used to visualize RNA localization. As shown in Figure 2, in all cases, the Alexa546 and FAM fluorescence signals showed punctuate distributions before irradiation, indicating that the carrier/shRNA complexes were trapped in endosomes, as reported previously.6,7 After irradiation at 540 ± 10 nm, the Alexa546 and FAM signals for all three variants were dispersed throughout the cytosol. Moreover, there was no significant difference in FAM fluorescence intensity between TatU1A and FHVU1A, suggesting that they had almost equal transfection efficiencies. Quantitative fluorescence image analysis of microscopic images in Figure 2 using cellSens Dimension software (Olympus) indicated that mean FAM intensity with CTP512U1A was about 45% lower than that with TatU1A. Next, the RNAi efficiencies with the CPP-U1A carriers were examined by evaluating the knockdown of EGFP expression in EGFP-CHO cells. EGFP silencing at 20 h after photostimulation was assessed by flow cytometry. As is clearly shown in Figure 3A, a dramatic light-dependent reduction in EGFP MFI was observed with TatU1A-Alexa. The treatment of cells with the TatU1AAlexa/shRNA(anti-EGFP) complex followed by photostimulation induced a 70% decrease in MFI when compared with the control cells treated with T-buffer only, while without irradiation, no decrease in MFI was observed in cells treated with the carrier/ shRNA complex (Figure 3A). Similarly, treatment with the
Figure 2. Translocation of the CPP-U1A/shRNA complexes via endocytosis. CHO cells were treated with CPP-U1A-Alexa546/ shRNA-FAM complexes for 2 h at 37 °C and irradiated (540 ± 10 nm light passed through a 40× objective lens for 11s) as described in Experimental Procedures. Images were taken before and 2 min after irradiation.
Figure 3. EGFP silencing by CPP-U1A-Alexa/shRNA complexes. The shRNA has an anti-GFP sequence and a U1A-binding sequence. (A) Flow cytometric analysis of EGFP-expressing cells treated with TatU1A-Alexa546/shRNA complexes and irradiated (540 ± 10 nm light passed through a 4× objective lens for 64 s). Cells were collected for flow cytometric analysis at 20 h after irradiation. The silencing effect was assessed by measuring EGFP mean fluorescence intensity (MFI). (B) Comparison of CPP-U1A proteins in EGFP silencing. EGFP MFIs of cells treated with different CPP-U1A-Alexa546/shRNA complexes are compared to control cells treated with T-buffer only. 2224
dx.doi.org/10.1021/bc200095a | BioconjugateChem. 2011, 22, 2222−2226
Bioconjugate Chemistry
Article
of Figure 4A indicated that the cellular uptake of siRNA with TatSxl-Alexa was higher than that with TatU1A (data not shown). Given that the dissociation constant of the Sxl/RNA complex is reportedly one order lower than that of the U1A/ RNA complex,16,17 these results suggested that the dissociation of carrier proteins from shRNA or siRNA in the cytoplasm might be important for RNAi efficiency. Importance of RBP/RNA Dissociation on RNAi Efficiency. To investigate this possibility further, the influence of the CL1 peptide on the RNAi efficiency was examined using CHO cells. As shown in Figure 5 and Supporting Information
FHVU1A-Alexa/shRNA or CTP512U1A-Alexa/shRNA complexes induced a 74% and 59% decrease in MFI, respectively (Figure 3B). These data indicate that the three CPP-U1A variants had a similar effect on EGFP silencing, although the RNAi efficiency of the CTP512U1A-Alexa/shRNA complex was slightly lower than the other two. We suggest that the low RNAi efficiency with CTP512U1A was due to the lower delivery efficiency of CTP512U1A compared to that of the other two variants. Effects of RBPs on RNAi Efficiency. Next, the RNAi efficiencies of the Tat-RBP variants (TatU1A, TatSxl, and TatλN) were compared to investigate the effects of the RBPs. As shown in Figure 4A, the siRNAs carried by TatU1A-Alexa
Figure 5. Influence of the CL1 peptide on cellular delivery and EGFP silencing. (A) Translocation of the TatU1A-CL1-Alexa546/shRNA. Transfection and fluorescence microscopy were carried out as described in the legend to Figure 2. (B) Comparison of TatU1ACL1 with TatU1A in EGFP silencing. The silencing effects were calculated as described in the legend to Figure 3.
Figure 4. Comparison of Tat-RBP proteins with respect to cellular delivery and EGFP silencing. (A) Translocation of the Tat-RBPAlexa546/siRNA. The sense strand of the siRNA contained 5′ short extensions for the binding to U1A, Sxl, or λN. Transfection and fluorescence microscopy were carried out as described in the legend to Figure 2. (B) Comparison of Tat-RBP proteins with respect to EGFP silencing. The silencing effects were calculated as described in the legend to Figure 3.
Figures S1 and S2, although the internalization efficiency and the light-dependent diffusion of TatU1A-CL1-Alexa with the shRNA to the cytoplasm was equivalent to that of TatU1AAlexa, the use of TatU1A-CL1-Alexa increased the RNAi efficiency (78% decrease in MFI) compared to TatU1A-Alexa (69% decrease in MFI). This tendency was also confirmed in other cell types (Figure S3). EGFP-silencing using the TatU1ACL1-Alexa/shRNA complex was also confirmed by analyzing the EGFP level on a SDS-PAGE gel (Figure S4A). The EGFP silencing level was dependent on the size of the area irradiated (Figure S4A and B), and the cells treated with the complex were not damaged by photostimulation (Figure S4C). These results suggest that the dissociation of the shRNA from the carrier protein in the cytoplasm is a critical event in CLIPRNAi-mediated gene silencing.
and TatSxl-Alexa diffused into the cytoplasm in a photodependent manner. However, in the case of TatλN, cellular uptake of the carrier protein and the siRNA was not observed, irrespective of irradiation. Hence, only the effects of the two carrier proteins, TatU1A-Alexa and TatSxl-Alexa, on RNAi efficiency were investigated. Unexpectedly, TatSxl-Alexa exhibited a lower RNAi efficiency (47% decrease in MFI compared to the control) than TatU1A-Alexa (59% decrease in MFI compared to the control) (Figure 4B), although quantitative fluorescence image analysis of microscopic images 2225
dx.doi.org/10.1021/bc200095a | BioconjugateChem. 2011, 22, 2222−2226
Bioconjugate Chemistry
Article
■
(10) Oubridge, C., Ito, N., Evans, P. R., Teo, C. H., and Nagai, K. (1994) Crystal structure at 1.92 A resolution of the RNA-binding domain of the U1A spliceosomal protein complexed with an RNA hairpin. Nature 372, 432−438. (11) Nakase, I., Hirose, H., Tanaka, G., Tadokoro, A., Kobayashi, S., Takeuchi, T., and Futaki, S. (2009) Cell-surface accumulation of flock house virus-derived peptide leads to efficient internalization via macropinocytosis. Mol. Ther. 17, 1868−1876. (12) Kim, D., Jeon, C., Kim, J. H., Kim, M. S., Yoon, C. H., Choi, I. S., Kim, S. H., and Bae, Y. S. (2006) Cytoplasmic transduction peptide (CTP): new approach for the delivery of biomolecules into cytoplasm in vitro and in vivo. Exp. Cell Res. 312, 1277−1288. (13) Bell, L. R., Maine, E. M., Schedl, P., and Cline, T. W. (1988) Sex-lethal, a Drosophila sex determination switch gene, exhibits sexspecific RNA splicing and sequence similarity to RNA binding proteins. Cell 55, 1037−1046. (14) Kanaar, R., Lee, A. L., Rudner, D. Z., Wemmer, D. E., and Rio, D. C. (1995) Interaction of the sex-lethal RNA binding domains with RNA. EMBO J. 14, 4530−4539. (15) Handa, N., Nureki, O., Kurimoto, K., Kim, I., Sakamoto, H., Shimura, Y., Muto, Y., and Yokoyama, S. (1999) Structural basis for recognition of the tra mRNA precursor by the Sex-lethal protein. Nature 398, 579−585. (16) Hall, K. B., and Stump, W. T. (1992) Interaction of N-terminal domain of U1A protein with an RNA stem/loop. Nucleic Acids Res. 20, 4283−4290. (17) Lee, A. L., Volkman, B. F., Robertson, S. A., Rudner, D. Z., Barbash, D. A., Cline, T. W., Kanaar, R., Rio, D. C., and Wemmer, D. E. (1997) Chemical shift mapping of the RNA-binding interface of the multiple-RBD protein sex-lethal. Biochemistry 36, 14306−14317. (18) Tan, R., and Frankel, A. D. (1995) Structural variety of argininerich RNA-binding peptides. Proc. Natl. Acad. Sci. U. S. A. 92, 5282− 5286. (19) Scharpf, M., Sticht, H., Schweimer, K., Boehm, M., Hoffmann, S., and Rosch, P. (2000) Antitermination in bacteriophage λ. The structure of the N36 peptide-boxB RNA complex. Eur. J. Biochem. 267, 2397−2408. (20) Gilon, T., Chomsky, O., and Kulka, R. G. (1998) Degradation signals for ubiquitin system proteolysis in Saccharomyces cerevisiae. EMBO J. 17, 2759−2766. (21) Bodner, R. A., Outeiro, T. F., Altmann, S., Maxwell, M. M., Cho, S. H., Hyman, B. T., McLean, P. J., Young, A. B., Housman, D. E., and Kazantsev, A. G. (2006) Pharmacological promotion of inclusion formation: a therapeutic approach for Huntington’s and Parkinson’s diseases. Proc. Natl. Acad. Sci. U. S. A. 103, 4246−4251.
CONCLUSION The results presented here demonstrated that the three CPPU1A variants, TatU1A, FHVU1A, and CTP512U1A, possessed similar carrier qualities and suggested that U1A was superior to Sxl as the RBD moiety of the Tat-RBP. Attachment of the degradation signal peptide, CL1, accelerated RNAi-mediated gene silencing, suggesting that the dissociation of the carrier protein and RNA due to the degradation of the carrier in the cytosol is important for mediating RNAi activity. TatU1A-CL1, which showed almost 80% RNAi efficiency, is an excellent candidate RNA carrier protein for the CLIP-RNAi method. CLIP-RNAi performed with the new carrier protein designed for this study would be available for clinical and cell-engineering applications.
■
ASSOCIATED CONTENT
S Supporting Information *
Additional information (Figures S1−S4) as described in the text. This material is available free of charge via the Internet at http://pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Author *Tel: 81-86-251-8218; Fax: 81-86-251-8219; E-mail: ohtsuk@ cc.okayama-u.ac.jp. Present Address † Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, 7−1−20 minatojimaminamimachi, Chuo-ku, Kobe 650−0047, Japan
■
ACKNOWLEDGMENTS We thank Prof. H. Ohmori and Dr. M. Magari (Okayama University) for their introduction to flow cytometric analysis techniques. This work was supported by a Grant-in-Aid for Young Scientists (A) to T. O.
■
REFERENCES
(1) Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806−811. (2) Pecot, C. V., Calin, G. A., Coleman, R. L., Lopez-Berestein, G., and Sood, A. K. (2011) RNA interference in the clinic: challenges and future directions. Nat. Rev. Cancer 11, 59−67. (3) Monaghan, M., Pandit, A. (2011) RNA interference therapy via functionalized scaffolds. Adv. Drug Delivery Rev. in press [Epub ahead of print]. (4) Shah, S., Rangarajan, S., and Friedman, S. H. (2005) Lightactivated RNA interference. Angew. Chem., Int. Ed. 44, 1328−1332. (5) Casey, J. P., Blidner, R. A., and Monroe, W. T. (2009) Caged siRNAs for spatiotemporal control of gene silencing. Mol. Pharmaceutics 6, 669−685. (6) Endoh, T., Sisido, M., and Ohtsuki, T. (2008) Cellular siRNA delivery mediated by a cell-permeant RNA-binding protein and photoinduced RNA interference. Bioconjugate Chem. 19, 1017−1024. (7) Endoh, T., Sisido, M., and Ohtsuki, T. (2009) Spatial regulation of specific gene expression through photoactivation of RNAi. J. Controlled Release 137, 241−245. (8) Endoh, T., and Ohtsuki, T. (2009) Cellular siRNA delivery using cell-penetrating peptides modified for endosomal escape. Adv. Drug Delivery Rev. 61, 704−709. (9) Gump, J. M., and Dowdy, S. F. (2007) TAT transduction: the molecular mechanism and therapeutic prospects. Trends Mol. Med. 13, 443−448. 2226
dx.doi.org/10.1021/bc200095a | BioconjugateChem. 2011, 22, 2222−2226
