PKM2

Dec 5, 2016 - Resveratrol (Res), a natural phytoalexin found in a variety of plants, has significant antitumor activity. Pyruvate kinase M2 (PKM2) has...
0 downloads 0 Views 8MB Size
Download PDF
Article pubs.acs.org/JAFC

Resveratrol Induces Cancer Cell Apoptosis through MiR-326/PKM2Mediated ER Stress and Mitochondrial Fission Haili Wu,† Yingying Wang,† Changxin Wu,‡ Peng Yang,† Hanqing Li,§ and Zhuoyu Li*,†,‡ †

Institute of Biotechnology, Key Laboratory of Chemical Biology and Molecular Engineering of National Ministry of Education, Shanxi University, Taiyuan 030006, China ‡ Institutes of Biomedical Sciences, Shanxi University, Taiyuan 030006, China § School of Life Science, Shanxi University, Taiyuan 030006, China ABSTRACT: Resveratrol (Res), a natural phytoalexin found in a variety of plants, has significant antitumor activity. Pyruvate kinase M2 (PKM2) has abnormally high expression in various tumor cells, and it has been implicated in the survival of tumors. However, whether and how Res inhibits PKM2 expression is poorly understood. In the present study, we found that treatment with Res inhibited cell proliferation and induced cell apoptosis. The IC50 values of Res against DLD1, HeLa, and MCF-7 cells were 75 ± 4.54, 50 ± 3.65, and 50 ± 3.32 μM, respectively. To elucidate mechanisms underlying its antitumor activities, serial experiments were performed. Results showed that reduction of PKM2 expression in tumor cells by Res treatment increased the expression of ER stress and mitochondrial fission proteins but reduced cell viability and the levels of fusion proteins. These phenomena were reversed by artificial overexpression of PKM2. Quantitative analyses showed that the expression of microRNA-326 (miR-326) was increased upon Res treatment. Treatment with the miR-326 mimic reduced PKM2 expression, promoting recovery from ER stress and mitochondrial fission. Overall, these results demonstrate that miR-326/PKM2-mediated ER stress and mitochondrial dysfunction participate in apoptosis induced by Res. These results provide novel insight into the molecular mechanisms by which Res suppresses tumors and further support for the use of Res as an antitumor drug. KEYWORDS: resveratrol, miR-326, PKM2, ER stress, mitochondrial fission

■

known as the unfolded protein response (UPR).16 It is noteworthy that moderate ER stress is protective for cell survival, but prolonged or severe ER stress may lead to apoptosis.17 Mitochondria are also essential organelles that play crucial roles in cellular metabolism.18 Mitochondria are dynamic organelles that engage in continuous fission and fusion processes governed by a series of large dynamin-related GTPases. Fusion is controlled by the mitochondrial outer membrane proteins mitofusin 1 and 2 (Mfn1, Mfn2) and the inner mitochondrial membrane protein optic atrophy 1 (OPA1). Fission is regulated by the fission 1 protein (Fis1) and the dynamin-related protein 1 (Drp1).19,20 Importantly, alteration of mitochondrial dynamics has been implicated in numerous human pathologies, including neurodegenerative disorders and cancers.21,22 It has been reported that increased fission, decreased fusion, or both result in the formation of fragmented mitochondria that act upstream of caspase-mediated apoptosis. These results imply a close relationship between mitochondrial morphology and apoptosis.23 In the present study, we investigated the mechanisms underlying the antitumor activity of Res by targeting PKM2 in DLD1, HeLa, and MCF-7 cell lines. The results indicate that Res inhibits PKM2 expression through up-regulation of microRNA326 (miR-326), subsequently triggering ER stress, mitochondrial fission, and ultimately apoptosis.

INTRODUCTION Resveratrol (3,5,4′-truhydroxystilbene; Res) belongs to the polyphenol family of compounds that have many therapeutic functions.1 Res is found in many foods, including grapes,2 berries,3 peanuts,4,5 and red wine.6 Over the years, Res has received extensive attention because of its significant antitumor activity.7 Res has been shown to inhibit cell proliferation, induce apoptosis, and inhibit metastasis and invasion; therefore, Res is considered a potential antitumor drug.8−10 Cancer cells mainly engage in glycolysis even in the presence of oxygen. This phenomenon is known as the Warburg effect, which is characterized by increased glucose uptake and lactate production, providing cancer cells a growth advantage.11 Pyruvate kinase M2 (PKM2), which dephosphorylates phosphoenolpyruvate (PEP) into pyruvate, catalyzes the last step in glycolysis and plays an important role in the process of glycolysis.12 It is well-known that PKM2 has aberrantly high expression in tumor cells and is important for cancer metabolism and tumor growth.13 Because PKM2 influences cancer growth, drugs that effectively inhibit PKM2 expression and prevent metabolic transformation should be identified. Res has been shown to inhibit metabolism of tumor cells by inhibiting activation of the mammalian target of rapamycin, which is able to down-regulate the activity of PKM2.14 However, it remains unknown whether Res can induce apoptosis by targeting PKM2. The endoplasmic reticulum (ER) is a complex intracellular membranous network that plays important roles in protein synthesis, folding, modification, and trafficking.15 It is wellknown that nutrient deprivation, metabolic stress, and antitumor drugs can induce ER stress and trigger an adaptive response © XXXX American Chemical Society

Received: October 12, 2016 Revised: November 23, 2016 Accepted: November 24, 2016

A

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

■

RNA Isolation and qPCR. Total RNA was isolated from cells with the Trizol reagent (Takara, Shiga, Japan). Using EasyScript First-Strand cDNA Synthesis SuperMix, 500 ng of RNA was reverse transcribed into cDNA. miRNA and mRNA levels were quantified using qPCR using SYBR Green. U6 and GAPDH mRNAs served as loading controls. The primers used are listed in Table 1. Western Blotting Analysis. The Western blotting was performed as previously described.24 A total of 50 μg of protein were loaded and GAPDH was used as a loading control. Intracellular Ca2+ Detection. The intracellular Ca2+ concentration was quantified using two methods. On one hand, we measured the intracellular free calcium concentration using a calcium test kit (Beyotime, MN, USA) by following the manufacturer’s instructions. Briefly, Ca2+ was allowed to combine with methyl thymol blue to form a blue complex in alkaline solution, and then the absorbance at 610 nm was measured using a Bio-Tek MQX200 plate reader. The intracellular Ca2+ concentration was calculated according to the formula:

MATERIALS AND METHODS

Chemicals and Reagents. The RPMI 1640 medium and heatinactivated fetal bovine serum (FBS) were purchased from GIBCO (Gaithersburg, MD, USA). The MitoTracker Red CMXRos was purchased from Invitrogen (Shanghai, China). The annexin V-FITC apoptosis detection kit was purchased from KeyGEN BioTECH (Nanjing, China). The RNAiso Plus was purchased from Takara (Shiga, Japan). TransScript First-Strand cDNA Synthesis SuperMix and TransStart Top Green qPCR SuperMix were purchased from TransGen (Beijing, China). The PKM2 antibody was obtained from Cell Signaling Technology (Danvers, MA, USA). Antibodies against glucose-regulated protein 78 (GRP78), caspase 12, C/EBP homologous protein (CHOP), Drp1, and Fis were obtained from Proteintech (Chicago, USA). The GAPDH antibody was purchased from Bioworld Technology (MN, USA). Res was purchased from Solarbio (Beijing, China), and the Res stock solution was dissolved in DMSO at 50 mM. Cell Lines and Cell Viability Assays. Human cervical (HeLa), colon (DLD1), breast (MCF-7), and liver (HepG2) cancer cell lines were purchased from American Type Culture Collection (Manassas, VA) and cultured in RPMI 1640 supplemented with 10% FBS and incubated at 37 °C in an incubator with 5% CO2. To obtain a stable knockdown of PKM2, DLD1 cells were transfected with PKM2 shRNAs (shPKM2-1 or shPKM2-2) or control (shcont) lentiviral vectors as previously described.24 The PKM2 shRNA sequences are as follows: shPKM2-1 (sense, 5′-CCGGCGGGTGAACTTTGCCATGAATCTCGAGATTCATGGCAAAGTTCACCCGTTTTTG-3′; antisense, 5′-AATTCAAAAACGGGTGAACTTTGCCATGAATCTCGAGATTCATGGCAAAGTTCACCCG-3′), shPKM2-2 (sense, 5′-CCGGCGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGCCCATCATCCACGTTTTTG-3′; antisense, 5′-AATTCAAAAACGTGGATGATGGGCTTATTTCCTCGAGGAAATAAGCCCATCATCCACG-3′). These oligos were generated by GenePharma Co. Ltd. (Shanghai, China). The stable knockdown of PKM2 in DLD1 cells was confirmed using Western blotting. For the viability assays, cells were seeded in a 96-well plate and treated for 24 h with 25, 50, 100, or 200 μM Res. Then, 20 μL of MTT was added to each well. At 4 h post-treatment with MTT, 150 μL of DMSO was added and the absorbance at 570 nm was measured with the Bio-Tek MQX200 microplate reader (Bio-Tek Instruments Inc., Winooski, VT, USA). Transfection. PKM2 (GFP-PKM2) or control (GFP) vectors were constructed in our laboratory as previously described.25 Transfection of GFP or GFP-PKM2 vectors was performed using Turbofect (Thermo Scientific, MA, USA) according to the manufacturer’s instructions. The miR-326 mimic and inhibitor were purchased from GenePharma (Shanghai, China). miRNA transfection was performed using the HiPerFect transfection reagent (QIAGEN, Shanghai, China). Colony Formation Assays. Colony formation assays were performed as previously described.14 Annexin V/PI Staining Assay For Apoptosis. At 24 h posttransfection, cells were treated with Res for another 24 h. Cells were resuspended at a density of 1 × 105 cells/mL, and 500 μL of binding buffer containing 5 μL of Annexin V-FITC and 5 μL of propidium iodide (PI) was added. Cells were incubated for 15 min in the dark. Following this, the samples were analyzed using flow cytometry (BD, San Diego, CA, USA).

intracellular free calcium concentration (mmol/L) tested OD value − control OD value = standard OD value − control OD value × concentration of standard (1mmol/L) × sample dilution multiple In the second technique, intracellular Ca2+ was measured with a confocal microscope and the fluorescent Fluo-3/AM probe. At 24 h post treatment with Res, cells were washed twice with phosphate buffer saline (PBS) and then incubated in PBS containing 5 mM Fluo-3/AM (Beyotime, MN, USA) and 0.5 μM ER-Tracker Red (Beyotime, MN, USA) for 30 min at 37 °C in darkness. Cells were washed once more, followed by incubation in 3.7% formaldehyde for 15 min. Then, the nucleus was stained with DAPI. The fluorescence intensity was determined by confocal microscopy. Observation of Mitochondrial Morphology. After the indicated treatment, mitochondria were stained with 100 nM MitoTracker Red CMXRos, and the mitochondrial morphology was observed using confocal microscopy (Olympus, Japan). The details were previously described.26 Luciferase Assays. For the luciferase analysis, the PKM2 3′-UTR was subcloned into the psicheck2 vector (Promega, Madison, WI) to generate the psicheck2-PKM2-3′UTR vector. HeLa cells were cotransfected with psicheck2-PKM2-3′UTR or control (psicheck2) vectors and either 50 nM of the miR-326 or negative control (NC mimic) mimics, or miR-326 or negative control (NC inhibitor) inhibitors using the HiPerFect transfection reagent. At 48 h post-transfection, cells were lysed and the luciferase activity was measured according to the manufacturer’s instructions. The results were normalized to the activity of the Renilla luciferase gene. Statistical Analysis. All results are displayed as the mean values ± standard deviations (SDs). The statistical software SPSS16.0 was used for analysis. Student’s t test was employed for statistical analysis, and p < 0.05 was considered significant.

■

RESULTS Res Inhibits the Viability of Cancer Cells in a PKM2dependent Manner. The MTT assay was employed to study

Table 1. Primers Used for qPCR gene

forward primer (5′-3′)

reverse primer (5′-3′)

GRP78 caspase12 CHOP Mfn1 Mfn2 OPA1 Fis Drp1 U6 GAPDH

CTGTGCAGCAGGACATCAAGTTC TGGCCCATGAATCACATCTA GGAAACAGAGTGGTCATTCCC GATGCACCGATGAAGTAAACGC AGGTGCTCAACGCCAGGATTC GTTTGTTGTCTTATTTGTGGTGGCA CAGACAGAGCCCCAGAACAACC GGTGGGGTTGGAGATGGTGTT CTCGCTTCGGCAGCACA GCACCGTCAAGGCTGAGAAC

TGTTTGCCCACCTCCAATATCA TGTTGCAGATGATGAGAGCC CTGCTTGAGCCGTTCATTCTC TGGTAGGAGCAGTGGGAGTAGAAG AGTCGGTCTTGCCGCTCTTCA CGCTGGCTATGAAGGGTTGAA AGGGAAAGGACAGCGAGGATG CGCTGTTCCCGAGCAGATAGTT AACGCTTCACGAATTTGCGT TGGTGAAGAACGCCAGTGGA

B

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 1. Res inhibits the viability of tumor cells by targeting PKM2. (A) HeLa, MCF-7, DLD1, and HepG2 cells were treated with or without Res at the indicated concentrations (0, 25, 50, 100, 150, and 200 μM) for 24 h. The cell viability was then measured by MTT assays. The data are presented as the mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01. (B) (a) The expression of PKM2 in DLD1, MCF-7, HeLa, HepG2, and HL-7702 cells was determined by Western blot. A representative result from three independent experiments is shown. (b) Densitometry analysis of relative protein expression. *p < 0.05, **p < 0.01. (C) HeLa, MCF-7, and DLD1 cells were transfected with GFP or GFP-PKM2 for 24 h. The expression of endogenous and exogenous PKM2 was determined by Western blot. A representative result from three independent experiments is shown. (D) HeLa, MCF-7, and DLD1 cells were transfected with GFP or GFP-PKM2 for 24 h. Cells were treated with the indicated concentrations of Res for another 24 h. Then, the cell viability was measured by MTT assays. Data are presented as the mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01.

cell viability following Res treatment. Four cancer cell lines (HeLa, MCF-7, DLD1, and HepG2) were examined in our

experiments. Following 24 h of treatment, the proliferation of HeLa, MCF-7, and DLD1 cells was dose dependently inhibited C

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry by 25, 50, 100, 150, and 200 μM Res. This effect was not observed in HepG2 cells (Figure 1A). Note that the IC50 values for the Res responses of DLD1, HeLa, and MCF-7 cells were 75 ± 4.54, 50 ± 3.65, and 50 ± 3.32 μM, respectively. Therefore, we used 50 μM or 100 μM Res for HeLa/MCF-7 cells and 75 μM or 150 μM Res for DLD1 cells to conduct the subsequent experiments. Given that PKM2 has aberrantly high expression in tumor cells and has been proposed to regulate their survival, we measured the expression of PKM2 in the four cancer cell lines and a human liver cell line (HL-7702). PKM2 expression was significantly higher in DLD1, MCF-7, and HeLa cells and slightly higher in HepG2 cells relative to its expression in HL-7702 cells (Figure 1B). To test the role of PKM2 in the Res response, PKM2 was overexpressed in the three cancer cell lines. The expression of endogenous PKM2 and exogenous GFP-PKM2 was first verified by Western blot, as shown in Figure 1C. GFP-PKM2 was effectively expressed in the three cancer cell lines. MTT assays showed that PKM2 overexpression significantly increased cell viability compared to viability in the GFP control group (Figure 1D). These data indicate that Res inhibits the proliferation of cancer cells and PKM2 overexpression rescues this inhibitory effect.

Additionally, we tested the colony formation ability of cancer cells after Res treatment. With increasing concentrations of Res, the number and size of the colonies gradually decreased. However, colony numbers were increased when GFP-PKM2 was overexpressed prior to Res treatment (Figure 2). Res Induces Apoptosis of Cancer Cells in a PKM2Dependent Manner. To determine the effects of Res on cancer cell apoptosis, HeLa and DLD1 cells were treated with Res for 24 h and then subjected to FACS analysis using Annexin V/ propidium iodide double staining. The proportion of early apoptotic, late apoptotic, and total apoptotic cells was evaluated (Figure 3A). Compared to the control group, the early, late, and total apoptotic cell percentages were increased in a dosedependent manner in both HeLa and DLD1 cells upon Res treatment. This response to Res was reversed upon the introduction of an artificial PKM2 overexpression vector (Figure 3B−D). Res Triggers ER Stress in Tumor Cells. Accumulating evidence indicates that ER stress plays a crucial role in the regulation of apoptosis.27 Consequently, we wondered whether PKM2 affects cell survival by modulating ER stress. We first analyzed the expression of ER stress marker proteins, including GRP78, caspase 12, and CHOP, as described in a previous study.

Figure 2. Res diminishes the clonogenic potential of tumor cells by targeting PKM2. (A) At 24 h after GFP or GFP-PKM2 transfection, HeLa, MCF-7, and DLD1 cells were treated with the indicated concentrations of Res for 24 h. Colony formation experiments were performed in triplicate and repeated three times. Representative graphs are shown. (B) The quantitative analysis of colony formation is shown in a histogram. *p < 0.05, **p < 0.01. D

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 3. Res induces apoptosis of tumor cells by targeting PKM2. (A) At 24 h post-transfection with GFP or GFP-PKM2, HeLa and DLD1 cells were treated with the indicated concentrations of Res for 24 h. The apoptosis of tumor cells was evaluated by flow cytometry. (B−D) The early, late, and total apoptotic rates were quantified. The data are presented as the mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

Res dose dependently increased the mRNA and protein expression levels of GRP78, caspase 12, and CHOP in both DLD1 and HeLa cells (Figure 4A,B). However, these changes were reversed in the presence of GFP-PKM2 overexpression. In addition, endogenous PKM2 expression was decreased along with elevated Res treatment (Figure 4B). These results suggest that Res induces apoptosis by modulation of ER stress and PKM2 is involved in this process. In general, calcium ions are mainly stored in the ER.28 When cells undergo apoptosis, calcium is released from the ER to the cytosol.29 Thus, we investigated the concentration of intracellular free calcium using a calcium test kit. The results showed that Res treatment led to an increase of intracellular calcium (Figure 4C). Additionally, cultured cells were loaded with the calcium fluorescent probe Fluo-3/AM and an ER Tracker. Co-localization of calcium and ER was determined by confocal microscopy. As shown in Figure 4D, Res treatment reduced colocalization, demonstrating that the level of calcium in the ER is decreased by Res treatment. These results further confirm that the ER stress is involved in Res-induced apoptosis. Res Induces Apoptosis through a MitochondrialDependent Pathway. To explore the relationship between

mitochondrial dynamics and apoptosis, we measured the expression levels of mitochondrial fission proteins (Drp1 and Fis) and mitochondrial fusion proteins (Mfn1, Mfn2, and OPA1) after treatment with Res. qPCR (Figure 5A) and Western blotting (Figure 5B) showed that Res dose dependently increased the expression of Drp1 and Fis but decreased the expression of Mfn2 in both DLD1 and HeLa cells. PKM2 overexpression reversed these changes. Further results showed that Res-treated HeLa cells exhibited more fragmented mitochondria in comparison to mitochondria in the untreated controls (Figure 5C,D). Statistically, the number of mitochondria was increased to 52 and 76 in cells treated with Res at 50 and 75 μM, respectively. The basal number of mitochondria in nontreated cells was 35 (Figure 5E). These results suggest that PKM2-mediated mitochondrial fission and fusion participate in Res-induced cell apoptosis. PKM2 Actively Induces ER Stress and Mitochondrial Fission. To further confirm the pivotal role of PKM2 in Resmediated ER stress and mitochondrial fission, we first measured expression of PKM2 in Res-treated DLD1, HeLa, and MCF-7 cells. As shown in Figure 6A, Res treatment significantly induced E

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 4. Res triggers ER Stress in tumor cells. (A) At 24 h post-transfection with GFP or GFP-PKM2, HeLa and DLD1 cells were treated with the indicated concentrations of Res for another 24 h. The mRNA levels of regulators of ER stress were detected by qPCR. *p < 0.05, **p < 0.01. (B) (a) At 24 h post-transfection with GFP or GFP-PKM2, HeLa and DLD1 cells were treated with the indicated concentrations of Res for another 24 h. The protein levels of regulators of ER stress were determined by Western blot. A representative result from three independent experiments is shown. (b) The densitometry analysis of relative protein expression. *p < 0.05, **p < 0.01. (C) At 24 h post-transfection with GFP or GFP-PKM2, HeLa cells were treated with the indicated concentrations of Res for another 24 h. The concentration of intracellular Ca2+ was determined using a calcium test kit. The experiment was repeated three times, with each treatment performed in triplicate. *p < 0.05, **p < 0.01. (D) (a) HeLa cells were treated with the indicated concentrations of Res for 24 h. Calcium localization was determined using confocal microscopy with Fluo-3/AM (Green). The endoplasmic reticulum was stained with ER-Tracker (red). Nuclei were marked with DAPI (blue). The corresponding images were superimposed to determine the degrees of colocalization of calcium and endoplasmic reticulum. Scale bar = 10 μm. (b) The colocalization of calcium and endoplasmic reticulum was quantified using ImageJ. *p < 0.05, **p < 0.01.

a dose-dependent decrease in endogenous PKM2 expression. To investigate the role of PKM2 in cell proliferation, we generated

stable PKM2 knockdown DLD1 cell lines (shPKM2-1 and shPKM2-2), as described previously, using two shRNAs targeted F

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 5. Res induces apoptosis through a mitochondrial-dependent pathway. (A) At 24 h post-transfection with GFP or GFP-PKM2, HeLa and DLD1 cells were treated with the indicated concentrations of Res for another 24 h. The mRNA levels of mitochondrial fusion/fission proteins were detected by qPCR. *p < 0.05, **p < 0.01. (B) (a) At 24 h post-transfection with GFP or GFP-PKM2, HeLa and DLD1 cells were treated with the indicated concentrations of Res for another 24 h. The protein levels of mitochondrial fusion/fission proteins were detected by Western blot. A representative result from three independent experiments is shown. (b) The densitometry analysis of relative protein expression. *p < 0.05, **p < 0.01. (C) Representative images of mitochondrial morphology. HeLa cells were treated with the indicated concentrations of Res for 24 h. The mitochondria was stained with Mitotracker dye (Red), and the morphology was observed by confocal fluorescence microscopy. Nuclei were marked with DAPI (Blue). The insets are amplified images of the mitochondrial morphology. Scale bar = 10 μm. (D) The statistical analysis of the percentage of fragmented mitochondria per cell. *p < 0.05, **p < 0.01.(E) Quantitative analysis of mitochondrial number per cell. *p < 0.05, **p < 0.01.

to two different sites within the PKM2 mRNA.24 We observed that the PKM2 expression level was significantly reduced in shPKM2 cells relative to expression in control cells (shcont)

(Figure 6B). The PKM2 stable knockdown cells grew much more slowly than control cells (Figure 6C). In addition, markers of ER stress were significantly increased (Figure 6D), the G

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 6. PKM2 takes an active role in induction of ER stress and mitochondrial fission. (A) (a) HeLa, MCF-7, and DLD1 cells were treated with increasing concentrations of Res for 24 h. PKM2 expression levels were detected by Western blot. A representative result from three independent experiments is shown. (b) The densitometry analysis of relative protein expression. *p < 0.05, **p < 0.01. (B) The expression level of PKM2 was determined by Western blot in PKM2 stable knockdown DLD1 cells (shPKM2). A representative result from three independent experiments is shown. (C) The viability of PKM2 stable knockdown DLD1 cells (shPKM2) was measured by MTT assays. The data are presented as the mean ± SEM from three independent experiments. *p < 0.05. (D) (a) The protein levels of regulators of ER stress were determined by Western blot in PKM2 stable knockdown DLD1 cells (shPKM2). A representative result from three independent experiments is shown. (b) The densitometry analysis of relative protein expression. *p < 0.05, **p < 0.01. (E) (a) The protein levels of mitochondrial fusion/fission proteins were detected by Western blot in PKM2 stable knockdown DLD1 cells (shPKM2). A representative result from three independent experiments is shown. (b) The densitometry analysis of relative protein expression. *p < 0.05, **p < 0.01.

confirm that PKM2 is involved in Res-induced ER stress and unbalanced mitochondrial dynamics. miR-326 Controls Res-Mediated Tumor Suppression and PKM2 Expression. Studies have revealed that Res performs

mitochondrial fusion protein Mfn2 was decreased, and the mitochondrial fission proteins Drp1 and Fis were increased in stable PKM2 knockdown DLD1 cells (Figure 6E). These results are similar to the effect of Res treatment. These data strongly H

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 7. miR-326 has a crucial role in Res-mediated tumor suppression and PKM2 expression. (A) The sequence of regions of the human PKM2 3′UTR showing complementary pairing with miR-122, miR-149, miR-326, and miR-491. (B) qPCR evaluation of the expression of miR-122, miR-149, miR-326, and miR-491 after HeLa and MCF-7 cells were treated with the indicated concentrations of Res. The data are presented as the mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01. (C) Relative fold changes in luciferase activity expressed from PKM2 3′-UTR reporter constructs. At 48 h post-transfection, HeLa cells were collected and the activity of firefly luciferase was measured by the dual-luciferase reporter assay. Firefly luciferase activity was normalized to Renilla luciferase activity and compared to luciferase values obtained from the psicheck2 control. The experiment was repeated for three times, with each treatment performed in triplicate. *p < 0.05. (D) The expression of miR-326 was analyzed by qPCR after HeLa cells transfected with miR-326 mimics or inhibitor. The experiment was repeated three times, with each treatment in triplicate. *p < 0.05, **p < 0.01. (E) (a) PKM2 expression was analyzed by Western blot after HeLa cells were transfected with miR-326 mimic or miR-326 inhibitor. Data are representative of at least three independent experiments, with each treatment performed in triplicate. (b) The densitometry analysis of relative protein expression. *p < 0.05. (F) (a) After HeLa cells were transfected with the N.C. mimic or miR-326 mimic and either GFP or GFPPKM2, the expression levels of ER stress-related proteins and mitochondrial fusion/fission proteins were determined by Western blot. A representative result from three independent experiments is shown. (b) The densitometry analysis of relative protein expression. *p < 0.05. (c) The densitometry analysis of relative protein expression. *p < 0.05.

its antitumor function by regulating the expression of miRNA.30 Consequently, we tested whether miRNA participates in the Resinduced suppression of PKM2. Candidate miRNAs were selected by screening miRNA target databases (Miranda and TargetScan). As shown in Figure 7A, miR-122, miR-149, miR-326, and miR-491 are conservatively targeted to PKM2. We investigated the expression level of these microRNAs by qPCR in Res treated HeLa and MCF-7 cells. These results show that expression of miR-326 was significantly up-regulated in a dose-dependent manner in both cell lines, but the other miRNAs were not affected (Figure 7B). To further assess whether PKM2 is directly regulated by miR326, we cloned the 3′-UTR of PKM2 into the luciferase reporter

vector psincheck2. The reporter vector was cotransfected with the miR-326 mimic or the miR-326 inhibitor. The miR-326 mimic decreased luciferase activity, but the miR-326 inhibitor increased luciferase activity relative to the luciferase activity in the vector and negative control (NC) groups (Figure 7C). These results indicate that miR-326 directly targets the 3′-UTR of PKM2. In addition to the reporter assay, the level of endogenous PKM2 was measured after transfection with the miR-326 inhibitor or mimic. Administration of the miR-326 mimic or inhibitor increased or decreased, respectively, the endogenous level of miR-326 as detected by qPCR in HeLa cells (Figure 7D). Moreover, the miR-326 mimic caused a significant reduction in I

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 8. Down-regulation of miR-326 affects the growth inhibition induced by Res. (A) HeLa cells were treated with Res alone or treated with Res after transfection with the NC inhibitor or the miR-326 inhibitor. The cell viability was then measured by MTT assays. The experiment was repeated three times, with each treatment performed in triplicate. *p < 0.05. (B) HeLa cells were treated with Res alone or treated with Res after transfection with the NC inhibitor or the miR-326 inhibitor. Colony formation assays were conducted. The quantitative analysis of colony formation is shown in a histogram. **p < 0.01. (C) HeLa cells were treated with Res alone or treated with Res after transfection with the NC inhibitor or the miR-326 inhibitor. At 48 h post-transfection, the activity of firefly luciferase was measured by the dual-luciferase reporter assay. Firefly luciferase activity was normalized to Renilla luciferase activity and compared to luciferase values obtained from the psickeck-2 control. *p < 0.05. (D) HeLa cells were treated with Res alone or treated with Res after transfection with the NC inhibitor or the miR-326 inhibitor. PKM2 expression levels were measured by Western blot. A representative result from three independent experiments is shown (bottom panel). The densitometry analysis of relative protein expression (upper panel). *p < 0.05.

the level of PKM2 protein. In contrast, PKM2 protein was increased in miR-326 inhibitor-transfected cells (Figure 7E). These results suggested that PKM2 was a target of miR-326. Furthermore, the expression of ER stress related proteins and mitochondrial fusion/fission proteins was determined in cells transfected with GFP-PKM2 and either a control or miR-326 mimic. GFP-PKM2 expression rescued cells from ER stress and mitochondrial fission induced by expression of the miR-326 mimic, demonstrating that miR-326 and PKM2 mediate the Resinduced cell apoptosis. Down-Regulation of miR-326 Affects the Growth Inhibition Caused by Res. The results above showed that Res induced miR-326 expression, resulting in a reduction in the expression of its target gene PKM2, thereby inhibiting apoptosis. We further tested the role of miR-326 in Res induced apoptosis by using the miR-326 inhibitor. Treatment with the miR-326 inhibitor restored viability to 79.8% and colony-forming activity to 65.5% in Res-treated cells. Viability and colony-forming activity in cells treated with the negative control were 45.3% and

16.4%, respectively (Figure 8A,B). This indicates that suppressing miR-326 impairs the ability of Res to inhibit tumors. Additionally, Res treatment decreased luciferase activity of the PKM2 3′-UTR reporter and endogenous PKM2 protein levels in HeLa cells. These effects of Res were ameliorated by treatment with the miR-326 inhibitor (Figure 8C,D). Taken together, these results demonstrate that Res inhibits cancer cell proliferation and growth by affecting the binding of miR-326 to the PKM2 3′-UTR.

■

DISCUSSION Res is one of the most attractive antitumor agents because it has been shown to inhibit cancer initiation, progression, and metastasis both in vitro and in vivo.31 Mounting evidence reveals that there are multiple intracellular targets of Res.32 For example, Res-mediated apoptosis occurs by inducing the expression of pro-apoptotic proteins and suppressing that of antiapoptotic proteins.33 Additionally, Res can induce apoptosis via disturbing the distribution of death receptors.34 In the present study, J

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry we report the novel finding that Res induces cellular apoptosis by suppressing PKM2 expression. Although Res has been investigated in phase I clinical trials, the oral concentration for Res treatment still needs to be resolved.35 In a study published by Ketan R Patel, oral doses of 0.5 or 1 g of Res were administered daily for 8 days prior to surgery. Following treatment with the 0.5 g dose, the highest mean concentration of Res and its metabolites glucuronides and sulfates were 18.6, 86, and 33.6 nmol/g, respectively, in colorectal tissue.36 The mean concentration of Res measured in the gastrointestinal tract of ApcMin mice was 36 nmol/g. The doses used in our study are similar to those found to have therapeutic effects in vivo. PKM2 is a multifunctional protein. Besides its well-known role in glycolysis, PKM2 also functions as a transcriptional coactivator in the nucleus.37 Unlike the tetrameric M1 isomer of pyruvate kinase (PKM1), PKM2 can form both dimers and tetramers. The tetrameric form of PKM2 has elevated pyruvate kinase activity, whereas the dimeric form exhibits high protein kinase and low pyruvate kinase activities. The dimeric PKM2 was reported to translocate to the nucleus to interact with various transcription factors such as β-catenin, Oct-4, and HIF-1, potentiating cell survival and proliferation. The pivotal role of PKM2 in tumorigenesis stimulated identification of small molecule inhibitors, for example, shikonin, that specially target PKM2.38 Our results indicate that Res inhibits PKM2 expression by up-regulating miR-326. Several groups have revealed that ER stress correlates with Res-induced apoptosis. Gwak et al. reported that Res induces ER stress-mediated apoptosis by interrupting protein glycosylation.39 In addition, it was reported that Res potentiates 2-DGinduced ER stress and NB cell death by inhibiting Akt activity.40 Our results reveal a new pathway whereby Res triggers ER stress by suppressing PKM2 expression. The role of mitochondrial fission in apoptotic induction is well established. It was reported that blocking the mitochondrial fission by overexpressing a dominant negative mutant of Drp1 (Drp1 K38A) can inhibit mitochondria-induced cell death.41 In addition, hFis1 overexpression42 or silencing of Mfn243 or ATAD3A44 increases mitochondrial fragmentation, inhibits proliferation, and induces apoptosis. Moreover, we previously reported that PKM2 overexpression induces mitochondrial fusion by suppressing Drp1 expression and enhancing Mfn2 expression, suggesting an underlying link between PKM2 and mitochondria.26 Here, we tested whether Res induces mitochondrial dysfunction via PKM2. Reduced expression of PKM2 elevated the number of fragmented mitochondria and expression of Drp1 and Fis but decreased expression of Mfn2. More importantly, PKM2 overexpression reversed this phenomenon. PKM2 is regulated by several post-translational modifications, which include phosphorylation, acetylation, and oxidation.45−47 Recently, microRNAs have been identified as additional regulators of PKM2. miR-122 plays an important role in the occurrence and development of gallbladder carcinoma by down-regulating PKM2.48 miR-let-7a significantly inhibits the proliferation, migration, and invasion of gastric cancer cells by targeting PKM2.49 To explore how Res regulates PKM2, we analyzed the expression of several microRNAs. The present study indicates that miR-326 blocks PKM2 expression by directly binding to its 3′-UTR. Moreover, Res treatment elevates the expression of miR-326. Collectively, our data demonstrate that Res induces cell apoptosis through PKM2-mediated ER stress and mitochondrial fission, and Res suppresses PKM2 expression by up-regulating

miR-326, providing an effective therapeutic target of Res and a novel Res function in apoptosis induction.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +863517018268. Fax: +863517018268. E-mail: lzy@ sxu.edu.cn. ORCID

Zhuoyu Li: 0000-0003-3338-7822 Funding

This work was supported by the National Natural Science Foundation of China (grant no. 31271516), the Scholarship Council of Shanxi Province, China (grant no. 2015-2), the R&D Infrastructure and Facility Development Program of Shanxi Province (grant no. 2015091015), Zhejiang Province Science Foundation (grant no. LY15H280008) to Dr. Zhuoyu Li, the Scientific and Technological Innovation Programs of Higher Education Institutions in Shanxi (grant no. 2015175, 2016121), Shanxi Province Science Foundation for Outstanding Youths (201601D021007), and Shanxi Province Science Foundation for Youths (201601D021107). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Oi, N.; Yuan, J.; Malakhova, M.; Luo, K.; Li, Y.; Ryu, J.; Zhang, L.; Bode, A. M.; Xu, Z.; Li, Y.; Lou, Z.; Dong, Z. Resveratrol induces apoptosis by directly targeting Ras-GTPase-activating protein SH3 domain-binding protein 1. Oncogene 2015, 34, 2660−71. (2) Celotti, E.; Ferrarini, R.; Zironi, R.; Conte, L. S. Resveratrol content of some wines obtained from dried Valpolicella grapes: Recioto and Amarone. Journal of chromatography. A 1996, 730, 47−52. (3) Rimando, A. M.; Kalt, W.; Magee, J. B.; Dewey, J.; Ballington, J. R. Resveratrol, pterostilbene, and piceatannol in vaccinium berries. J. Agric. Food Chem. 2004, 52, 4713−9. (4) Chen, R. S.; Wu, P. L.; Chiou, R. Y. Peanut roots as a source of resveratrol. J. Agric. Food Chem. 2002, 50, 1665−7. (5) Sobolev, V. S.; Cole, R. J. trans-resveratrol content in commercial peanuts and peanut products. J. Agric. Food Chem. 1999, 47, 1435−9. (6) Shi, J.; He, M.; Cao, J.; Wang, H.; Ding, J.; Jiao, Y.; Li, R.; He, J.; Wang, D.; Wang, Y. The comparative analysis of the potential relationship between resveratrol and stilbene synthase gene family in the development stages of grapes (Vitis quinquangularis and Vitis vinifera). Plant Physiol. Biochem. 2014, 74, 24−32. (7) Jang, M.; Cai, L.; Udeani, G. O.; Slowing, K. V.; Thomas, C. F.; Beecher, C. W.; Fong, H. H.; Farnsworth, N. R.; Kinghorn, A. D.; Mehta, R. G.; Moon, R. C.; Pezzuto, J. M. Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science 1997, 275, 218−220. (8) Rahman, M. A.; Kim, N. H.; Kim, S. H.; Oh, S. M.; Huh, S. O. Antiproliferative and cytotoxic effects of resveratrol in mitochondriamediated apoptosis in rat b103 neuroblastoma cells. Korean J. Physiol. Pharmacol. 2012, 16, 321−6. (9) Liu, M. L.; Zhang, S. J. Effects of resveratrol on the protein expression of survivin and cell apoptosis in human gastric cancer cells. J. B.U.ON.: Off. J. Balkan Union Oncol. 2014, 19, 713−717. (10) Han, G.; Xia, J.; Gao, J.; Inagaki, Y.; Tang, W.; Kokudo, N. Antitumor effects and cellular mechanisms of resveratrol. Drug Discoveries Ther. 2015, 9, 1−12. (11) Hockenbery, D. M.; Tom, M.; Abikoff, C.; Margineantu, D. Warburg Effect and Beyond: Metabolic Dependencies for Cancer Cells 2013, 35−51. (12) Wong, N.; De Melo, J.; Tang, D. PKM2, a Central Point of Regulation in Cancer Metabolism. Int. J. Cell Biol. 2013, 2013, 242513. (13) Christofk, H. R.; Vander Heiden, M. G.; Harris, M. H.; Ramanathan, A.; Gerszten, R. E.; Wei, R.; Fleming, M. D.; Schreiber, K

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

(34) Delmas, D.; Rebe, C.; Lacour, S.; Filomenko, R.; Athias, A.; Gambert, P.; Cherkaoui-Malki, M.; Jannin, B.; Dubrez-Daloz, L.; Latruffe, N.; Solary, E. Resveratrol-induced apoptosis is associated with Fas redistribution in the rafts and the formation of a death-inducing signaling complex in colon cancer cells. J. Biol. Chem. 2003, 278, 41482− 41490. (35) Baur, J. A.; Sinclair, D. A. Therapeutic potential of resveratrol: the in vivo evidence. Nat. Rev. Drug Discovery 2006, 5, 493−506. (36) Patel, K. R.; Brown, V. A.; Jones, D. J.; Britton, R. G.; Hemingway, D.; Miller, A. S.; West, K. P.; Booth, T. D.; Perloff, M.; Crowell, J. A.; Brenner, D. E.; Steward, W. P.; Gescher, A. J.; Brown, K. Clinical pharmacology of resveratrol and its metabolites in colorectal cancer patients. Cancer Res. 2010, 70, 7392−9. (37) Luo, W.; Semenza, G. L. Emerging roles of PKM2 in cell metabolism and cancer progression. Trends Endocrinol. Metab. 2012, 23, 560−6. (38) Chen, J.; Xie, J.; Jiang, Z.; Wang, B.; Wang, Y.; Hu, X. Shikonin and its analogs inhibit cancer cell glycolysis by targeting tumor pyruvate kinase-M2. Oncogene 2011, 30, 4297−306. (39) Gwak, H.; Kim, S.; Dhanasekaran, D. N.; Song, Y. S. Resveratrol triggers ER stress-mediated apoptosis by disrupting N-linked glycosylation of proteins in ovarian cancer cells. Cancer Lett. 2016, 371, 347− 53. (40) Graham, R. M.; Hernandez, F.; Puerta, N.; De Angulo, G.; Webster, K. A.; Vanni, S. Resveratrol augments ER stress and the cytotoxic effects of glycolytic inhibition in neuroblastoma by downregulating Akt in a mechanism independent of SIRT1. Exp. Mol. Med. 2016, 48, e210. (41) Frank, S.; Gaume, B.; Bergmann-Leitner, E. S.; Leitner, W. W.; Robert, E. G.; Catez, F.; Smith, C. L.; Youle, R. J. The Role of DynaminRelated Protein 1, a Mediator of Mitochondrial Fission, in Apoptosis. Dev. Cell 2001, 1, 515−525. (42) Lee, Y.-j.; Jeong, S.-Y.; Karbowski, M.; Smith, C. L.; Youle, R. J. Roles of the Mammalian Mitochondrial Fission and Fusion Mediators Fis1, Drp1, and Opa1 in Apoptosis. Mol. Biol. Cell 2004, 15, 5001−5011. (43) Chen, W.; Xu, X.; Wang, L.; Bai, G.; Xiang, W. Low Expression of Mfn2 Is Associated with Mitochondrial Damage and Apoptosis of Ovarian Tissues in the Premature Ovarian Failure Model. PLoS One 2015, 10, e0136421. (44) Teng, Y.; Ren, X.; Li, H.; Shull, A.; Kim, J.; Cowell, J. K. Mitochondrial ATAD3A combines with GRP78 to regulate the WASF3 metastasis-promoting protein. Oncogene 2016, 35, 333−43. (45) Lv, L.; Li, D.; Zhao, D.; Lin, R.; Chu, Y.; Zhang, H.; Zha, Z.; Liu, Y.; Li, Z.; Xu, Y.; Wang, G.; Huang, Y.; Xiong, Y.; Guan, K. L.; Lei, Q. Y. Acetylation targets the M2 isoform of pyruvate kinase for degradation through chaperone-mediated autophagy and promotes tumor growth. Mol. Cell 2011, 42, 719−30. (46) Hitosugi, T.; Kang, S.; Vander Heiden, M. G.; Chung, T. W.; Elf, S.; Lythgoe, K.; Dong, S.; Lonial, S.; Wang, X.; Chen, G. Z.; Xie, J.; Gu, T. L.; Polakiewicz, R. D.; Roesel, J. L.; Boggon, T. J.; Khuri, F. R.; Gilliland, D. G.; Cantley, L. C.; Kaufman, J.; Chen, J. Tyrosine phosphorylation inhibits PKM2 to promote the Warburg effect and tumor growth. Sci. Signaling 2009, 2, ra73. (47) Anastasiou, D.; Poulogiannis, G.; Asara, J. M.; Boxer, M. B.; Jiang, J. K.; Shen, M.; Bellinger, G.; Sasaki, A. T.; Locasale, J. W.; Auld, D. S.; Thomas, C. J.; Vander Heiden, M. G.; Cantley, L. C. Inhibition of pyruvate kinase M2 by reactive oxygen species contributes to cellular antioxidant responses. Science 2011, 334, 1278−83. (48) Lu, W.; Zhang, Y.; Zhou, L.; Wang, X.; Mu, J.; Jiang, L.; Hu, Y.; Dong, P.; Liu, Y. miR-122 inhibits cancer cell malignancy by targeting PKM2 in gallbladder carcinoma. Tumor Biol. 2015, DOI: 10.1007/ s13277-015-4308-z. (49) Tang, R.; Yang, C.; Ma, X.; Wang, Y.; Luo, D.; Huang, C.; Xu, Z.; Liu, P.; Yang, L. MiR-let-7a inhibits cell proliferation, migration, and invasion by down-regulating PKM2 in gastric cancer. Oncotarget 2016, 7, 5972−5984.

S. L.; Cantley, L. C. The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature 2008, 452, 230−3. (14) Iqbal, M. A.; Bamezai, R. N. Resveratrol inhibits cancer cell metabolism by down regulating pyruvate kinase M2 via inhibition of mammalian target of rapamycin. PLoS One 2012, 7, e36764. (15) Zhang, N.; Bi, C.; Liu, L.; Dou, Y.; Tang, S.; Pang, W.; Deng, H.; Song, D. IMB-6G, a novel N-substituted sophoridinic acid derivative, induces endoplasmic reticulum stress-mediated apoptosis via activation of IRE1α and PERK signaling. Oncotarget 2016, 7, 23860−23873. (16) Walter, P.; Ron, D. The unfolded protein response: from stress pathway to homeostatic regulation. Science 2011, 334, 1081−6. (17) Wang, W. A.; Groenendyk, J.; Michalak, M. Endoplasmic reticulum stress associated responses in cancer. Biochim. Biophys. Acta, Mol. Cell Res. 2014, 1843, 2143−9. (18) Reichert, A. S.; Neupert, W. Mitochondriomics or what makes us breathe. Trends Genet. 2004, 20, 555−62. (19) Liesa, M.; Shirihai, O. S. Mitochondrial dynamics in the regulation of nutrient utilization and energy expenditure. Cell Metab. 2013, 17, 491−506. (20) Gao, A. W.; Canto, C.; Houtkooper, R. H. Mitochondrial response to nutrient availability and its role in metabolic disease. EMBO Mol. Med. 2014, 6, 580−689. (21) Bolinches-Amoros, A.; Molla, B.; Pla-Martin, D.; Palau, F.; Gonzalez-Cabo, P. Mitochondrial dysfunction induced by frataxin deficiency is associated with cellular senescence and abnormal calcium metabolism. Front. Cell. Neurosci. 2014, 8, 124. (22) Grandemange, S.; Herzig, S.; Martinou, J. C. Mitochondrial dynamics and cancer. Semin. Cancer Biol. 2009, 19, 50−6. (23) Dubois, A.; Ginet, C.; Furstoss, N.; Belaid, A.; Hamouda, M. A.; El Manaa, W.; Cluzeau, T.; Marchetti, S.; Ricci, J. E.; Jacquel, A.; Luciano, F.; Driowya, M.; Benhida, R.; Auberger, P.; Robert, G. Differentiation inducing factor 3 mediates its anti-leukemic effect through ROSdependent DRP1-mediated mitochondrial fission and induction of caspase-independent cell death. Oncotarget 2016, 7, 26120−26136. (24) Wu, H.; Li, Z.; Yang, P.; Zhang, L.; Fan, Y.; Li, Z. PKM2 depletion induces the compensation of glutaminolysis through beta-catenin/cMyc pathway in tumor cells. Cell. Signalling 2014, 26, 2397−405. (25) Yang, P.; Li, Z.; Fu, R.; Wu, H.; Li, Z. Pyruvate kinase M2 facilitates colon cancer cell migration via the modulation of STAT3 signalling. Cell. Signalling 2014, 26, 1853−1862. (26) Wu, H.; Yang, P.; Hu, W.; Wang, Y.; Lu, Y.; Zhang, L.; Fan, Y.; Xiao, H.; Li, Z. Overexpression of PKM2 promotes mitochondrial fusion through attenuated p53 stability. Oncotarget 2016, 7, 78069−78082. (27) Tabas, I.; Ron, D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat. Cell Biol. 2011, 13, 184− 90. (28) Berridge, M. J.; Bootman, M. D.; Roderick, H. L. Calcium signalling: dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol. 2003, 4, 517−29. (29) Lynch, K.; Fernandez, G.; Pappalardo, A.; Peluso, J. J. Basic Fibroblast Growth Factor Inhibits Apoptosis of Spontaneously Immortalized Granulosa Cells by Regulating Intracellular Free Calcium Levels through a Protein Kinase Cδ-Dependent Pathway. Endocrinology 2000, 141, 4209−4217. (30) Tili, E.; Michaille, J. J.; Adair, B.; Alder, H.; Limagne, E.; Taccioli, C.; Ferracin, M.; Delmas, D.; Latruffe, N.; Croce, C. M. Resveratrol decreases the levels of miR-155 by upregulating miR-663, a microRNA targeting JunB and JunD. Carcinogenesis 2010, 31, 1561−6. (31) Aggarwal, B. B.; Bhardwaj, A.; Aggarwal, R. S.; Seeram, N. P.; Shishodia, S.; Takada, Y. Role of Resveratrol in Prevention and Therapy of Cancer: Preclinical and Clinical Studies. Anticancer Res. 2004, 24, 2783−2840. (32) Athar, M.; Back, J. H.; Kopelovich, L.; Bickers, D. R.; Kim, A. L. Multiple molecular targets of resveratrol: Anti-carcinogenic mechanisms. Arch. Biochem. Biophys. 2009, 486, 95−102. (33) Shankar, S.; Singh, G.; Srivastava, R. K. Chemoprevention by resveratrol: molecular mechanisms and therapeutic potential. Front. Biosci., Landmark Ed. 2007, 12, 4839−4854. L

DOI: 10.1021/acs.jafc.6b04549 J. Agric. Food Chem. XXXX, XXX, XXX−XXX