Plasmonic Selection of ssDNA Aptamers against Fibroblast Growth

Research Article pubs.acs.org/acscombsci

Cite This: ACS Comb. Sci. XXXX, XXX, XXX−XXX

Plasmonic Selection of ssDNA Aptamers against Fibroblast Growth Factor Receptor Hasan Kurt,†,‡ Alp Ertunga Eyüpoğlu,§ Tolga Sütlü,⊥ Hikmet Budak,∥ and Meral Yüce*,⊥ †

Istanbul Medipol University, School of Engineering and Natural Sciences, Beykoz, 34810 Istanbul, Turkey Nanosolar Plasmonics Ltd., Gebze, 41400 Kocaeli, Turkey § Sabanci University, Faculty of Engineering and Natural Sciences, Tuzla, 34956 Istanbul, Turkey ⊥ Sabanci University, SUNUM Nanotechnology Research Centre, Tuzla, 34956 Istanbul Turkey ∥ Montana State University, Cereal Genomics Lab, Bozeman, Montana 59717-2000, United States

Downloaded via NOTTINGHAM TRENT UNIV on July 21, 2019 at 04:57:37 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

S Supporting Information *

ABSTRACT: In this work, we describe the selection of ssDNA aptamers targeting fibroblast growth factor receptor binding protein 3 K650E, which has roles in cell division, growth, and differentiation through the kinase cascade. The selection process was based on the label-free, real-time monitoring of binding interactions by surface plasmon resonance, allowing for convenient manipulation of the selection rounds. Next generation sequencing data provided four major motif families from which nine individual sequences were selected based on their abundance levels. Electrophoretic mobility shift assays revealed binding of the selected aptamers to the target protein without significant interference from fibroblast growth factor receptor binding protein 2, indicating the selectivity of the aptamers. The dissociation constant at equilibrium for the best aptamer candidate, SU-3, was found to be (28.2 ± 19.6) × 10−9 M (n = 5) using a single-cycle kinetic analysis method. Advantages of the experimental setup and potential applications of the selected aptamers are discussed. KEYWORDS: aptamer, ssDNA, SELEX, next generation sequencing, surface plasmon resonance

■

biomarker discovery.5,6,15−18,7−14 Since the inception of the original aptamer selection method, systematic evolution of ligands by exponential enrichment (SELEX),19,20 a number of alternative technique with substantial improvements has been suggested in the literature in which the main benefits included automation, miniaturization, slow off-rate selection, nextgeneration sequencing (NGS) strategy, and multitargeting abilities. The basic steps of the SELEX technique and different SELEX approaches (for example, magnetic bead-based SELEX, capillary electrophoresis-based SELEX, microfluidic-based SELEX, whole cell SELEX, robotic SELEX, and sequencingbased SELEX) were reviewed previously by our group.5,13 In contrast to the other SELEX techniques, SPR-based aptamer selection provides real-time examination and manipulation opportunities throughout the binding and elution steps. The surface preparation, target immobilization, surface blocking, binding of the random library to the target molecules, and putative nonspecific interactions can be scrutinized without difficulty. Taking advantage of the integrated flow system in SPR instruments, it is also possible to manipulate the binding

INTRODUCTION Surface plasmon resonance (SPR) is a well-known technique for real-time and label-free monitoring of molecular adsorption interactions of binding partners down to the nanomolar range. Limit of detection values (LOD) can be reduced to the subattomolar range by incorporation of gold nanoparticles of a specific size and shape1−3 based on plasmonic coupling and size/mass loading effects.4 SPR allows kinetic measurements with relatively low sample consumption, facilitating the development of cost-effective biosensors and lab-on-a-chip devices. SPR has also been proposed as an effective platform for the selection of short, synthetic oligonucleotide-based sensing bodies, known as aptamers, from combinatorial libraries. Aptamers (target-specific DNA or RNA sequences) have been considered significant counterparts of monoclonal antibodies based on advantages such as in vitro selection, small size, chemical synthesis opportunity at large scale with negligible batch-to-batch variation, ease of pre- or postmodification, labeling flexibility, and long shelf life.5 To date, considerable progress has been made in the field where a diverse collection of aptamers has been selected from combinatorial DNA, RNA, or peptide libraries for various applications including sensing, imaging, drug delivery, and © XXXX American Chemical Society

Received: March 29, 2019 Revised: June 4, 2019 Published: June 21, 2019 A

DOI: 10.1021/acscombsci.9b00059 ACS Comb. Sci. XXXX, XXX, XXX−XXX

Research Article

ACS Combinatorial Science

Random oligonucleotide library (94-mer, 2.1 nmol) and the primer sequences were purchased from Microsynth, Switzerland. The random DNA library had a random region of 50 bases flanked by the primer binding regions (5′-AGCTCCAGAAGATAAATTACAGG-N 5 0 -CAACTAGGATACTATGACCCC-3′). The ratio of individual bases in the random region was optimized to be 1:1:1:1 during the synthesis. Polymerase chain reaction (PCR) kit with dNTPs was purchased from KAPA Bio-Systems, USA (cat. no. KK1016). Bio-Rad Mini-Protean gel system was used for polyacrylamide gel electrophoresis (PAGE), and the PCR products on the gel were visualized under UV light illumination using Gel-Doc EZ system from Bio-Rad, USA, following standard ethidium bromide staining (0.5 pg/mL). The reverse primer included a phosphate group modification (PO4) at the 5′ end to be used in ssDNA production through a λ exonuclease digestion reaction method (cat. no. M0262S, New England Biolabs).29 Agencourt RNA Clean XP magnetic beads used to purify ssDNA from the exonuclease digestion reaction were obtained from Beckman Coulter, USA. All buffer solutions were prepared using sterile Milli-Q water (18.2 MΩ cm at 25 °C, Millipore, USA). All heat-compatible plastic and glassware were sterilized for 15 min at 121 °C before the experiments using an HMC autoclave from Hirayama, Japan. PCR and ssDNA Production. The random DNA library was amplified with KAPA standard PCR kit where 50 μL of reaction mixture contained 1 U of KAPA Taq polymerase enzyme, 10 μL of KAPA 5× PCR buffer A, 1 μL of dNTP mix (10 mM), 1 μL of MgCl2 (25 mM), 1 μL of each primer (10 pmol), 1 μL of DNA template, and water. All amplification reactions and thermal incubations were performed in a TC4000 thermal cycler (Techne, U.K.). The thermal conditions of the amplification reaction were 3 min at 95 °C, followed by eight cycles of 20 s at 95 °C, 20 s at 58 °C, and 20 s at 72 °C. A final extension step for 1 min at 72 °C was applied for all PCR sets. A PCR sample without the template was used as the negative control in all setups. To reduce the nonspecific byproduct formation during PCR, which is considered one of the most significant problems in aptamer screening, we pursued a two-step PCR procedure. Following the initial amplification of the eluted ssDNA (obtained from the SPR selection step), we performed another 5 sets of PCR by using 2, 4, 6, 8, and 10 μL of template DNA from the initial amplification reaction, from which we identified the best PCR product based on electrophoretic band specificity and intensity. A 6% PAGE gel was used to visualize the PCR products. Five microliter samples from each PCR tube were loaded into the wells and run about 45 min at 100 V. A DNA ladder of 50−100 bp (New England Biolabs, U.K.) was used to define the DNA product size (94 bp). Following gel electrophoresis, the gel was stained with ethidium bromide solution (0.5 pg/mL) for 1 min and gently washed with sterile water to remove the excess dye. Visualization of the bands was realized by the Gel Doc EZ system, after which the selected PCR sample was used for the ssDNA production step. The generation of ssDNA from double-stranded DNA was achieved by λ exonuclease digestion reaction in which the exonuclease enzyme preferentially digested the DNA strand containing a 5′ PO4 group.29 PCR product (50 μL) included 5 μL of 10× digestion buffer and 1 μL of λ exonuclease enzyme that was incubated at 37 °C for 50 min for digestion, followed

interactions in a way that the desired stringency could be reached during the combinatorial pool enrichment. These manipulations are comprised of accelerated flow rate, incorporation of a counter molecule in the running buffer, changes in the salt composition of the running buffer, use of sophisticated chip surfaces (such as nanohole gold arrays or nanoparticle-embedded arrays), multitargeting strategy using parallel flow cells simultaneously, and many others merely constrained by the imagination. Conversely, real-time monitoring of the significant SELEX steps with high sensitivity and manipulation of the binding interactions as they occur is not possible with the SELEX approaches mentioned earlier. Last but not least, an SPR-based SELEX technique allows examining the binding kinetics of each SELEX cycle throughout the selection process without further experimental effort. Despite many advantages, few examples of SPR-based realtime SELEX have appeared in the literature. In these previous reports, the SPR technique was typically used to screen the binding events of individual aptamer sequences21 or enriched SELEX pools that were obtained through different SELEX approaches.22 Besides the inventor’s patent where an SPRbased SELEX technique was introduced as “Flow-cell SELEX”,23 Khati et al.24 reported protein gp120 specific RNA aptamers, Misono et al.25 described aptamers targeting hemagglutinin protein of human influenza virus, and Ngubane et al.26 reported aptamers specific to EsxG protein from Mycobacterium tuberculosis using SPR-based SELEX methods. While successful, none of these reports provided a general method for a real-time SELEX procedure. In a recent study conducted by Jia et al.,27 an SPR imaging (SPRi) SELEX approach was suggested to screen aptamers in real time against lactoferrin where the initial random oligonucleotide library was modified with silver nanoparticles to improve the final plasmonic signals. The authors developed the SPRi instrument, and the kinetic analysis of the selected sequences was confirmed further with a standard SPR machine. In this study, we have exploited a label-free standard SPR technique to screen ssDNA aptamers against the cytoplasmic region of fibroblast growth factor receptor 3 (FGFR3) proteins, which have roles in cell division, cell growth, and cell differentiation through the kinase cascade.28 In the hopes of stimulating further use of this method, we have provided comprehensive information about an improved screening process that requires 1 day for each SELEX cycle. To the best of our knowledge, this is the first report on the generation of FGFR3-specific DNA aptamers in the literature.

■

EXPERIMENTAL SECTION Reagents. Bare gold chips used to screen aptamers were purchased from BioNavis, Finland. Acetone, ethanol, methanol, 11-mercaptoundecanoic acid (97%), 11-mercapto-1undecanol (97%), N-hydroxysulfosuccinimide sodium salt (Sulpho-NHS), N-(3-(dimethylamino)propyl)-N′-ethylcarbodiimide hydrochloride (EDC-hydrochloride), phosphate buffer saline tablets (PBS), sodium chloride (NaCl), potassium Chloride (KCl), magnesium Chloride (MgCl2), hydrochloric acid (HCl), sodium hydroxide (NaOH), and ethanolamine (99.5%) were purchased from Sigma, USA. FGFR2 (cat. no. PR5332A) and FGFR3 K650E (cat. no. PR8155A) recombinant human proteins were purchased from Invitrogen, USA. Microcon centrifugal filter units with 10−50 kDa cut-offs were purchased from Millipore, USA. B


Research Article


Figure 1. Sensorgram representing the details of our SPR-based aptamer selection strategy: (A) gold chip with self-assembled monolayer of 11mercaptoundecanoic acid and 11-mercapto-1-undecanol; (B) activation of surface −COOH groups via NHS-EDC chemistry; (C, D) covalent immobilization of the target protein onto the activated chip surface; (E) Deactivation of the remaining −COOH groups with ethanolamine injection; (F) injection of the random oligonucleotide library over the protein surface and elimination of the nonbinders through automated buffer flow; (G) Removal of the target-bound oligonucleotides through NaOH injection over the surface and collection of the ssDNA detached from the surface in an Eppendorf tube; (H) neutralization, purification, and amplification of the collected DNA for the next cycle.

by 15 min incubation at 65 °C for deactivation of the enzyme. The digestion reaction was immediately purified by Agencourt RNA Clean XP magnetic beads in 40 μL of water, according to the manufacturer’s instructions. The ssDNA generation procedure yielded around 3−4 ng/μL ssDNA, and around 120−160 ng of ssDNA was used for the next selection cycle. Preparation of SPR Chip Surface. The SPR-based selection procedure was adopted from a US patent published as WO1998033941 A1.23 Each bare gold chip was washed with acetone, methanol, and ethanol, followed by UV/ozone treatment for 45 min. A self-assembled monolayer (SAM) of thiol was formed on the treated gold surface through 72 h incubation in 11-mercaptoundecanoic acid (1 mM) and 11mercapto-1-undecanol (4 mM) dissolved in absolute ethanol at 4 °C. Subsequently, the surface-modified gold chip was washed with copious amounts of absolute ethanol to remove unreacted or weakly bound chemicals, dried under nitrogen flow, and stored in a vacuum environment for further use.

Screening of ssDNA Aptamers Using SPR. Aptamer selection experiments were performed on an SPR Navi 200 instruments from BioNavis, Finland. After docking the gold chip, the instrument flow was left running for about an hour to reach a stable baseline. A flow rate of around 30−50 μL/min was applied to prevent mass transport effects as well as to select aptamers with fast on and slow off rates. PBS buffer, 1× containing 100 mM NaCl, 5 mM MgCl2, and 2.5 mM KCl, was used as running buffer for all SPR assays unless otherwise stated, and all samples were prepared in the same buffer wherever applicable in order to circumvent negative response units or refractive index differences. It should be noted that we experienced the negative response unit problem mostly during injections of ssDNA samples that were heated and cooled in 1× PBS before the injection. That was because the salts in the buffer were sensitive to the heat, and they changed their characteristics in a way that created the unwanted negative SPR signal. We solved the problem by heating and cooling the ssDNA samples in water first (instead C


Research Article


evaluate the enrichment of the random oligonucleotide library over the course of selections. NGS Data Analysis. The enriched ssDNA pool obtained at the end of SELEX was sequenced using an Illumina MiSeq system at Istanbul Medipol University, Turkey. NGS data were analyzed using CLC Genomics Workbench v5, MEME Suit, mfold online servers. The raw data was initially cleaned from the sequences having a size greater or less than 94-mer and followed by truncation of the primer binding regions at both ends. The remaining sequences (each 50mer) were listed based on the copy numbers (repeat number, abundance rate), and the most abundant 500 sequences were aligned to discover the motif families. Based on the motifs and their occurrence in the overall NGS data set, nine sequences were selected for further analysis. Gibbs free energy (ΔG) values for the selected sequences were predicted using the mfold online server.32 Electrophoretic Mobility Shift Assay (EMSA). Following the chemical synthesis of the selected sequences without the primer binding regions (Integrated DNA Technologies, USA), an EMSA procedure was applied for the initial characterization of the protein−DNA interactions. Aptamer samples dissolved in water were heat-denatured at 95 °C for 5 min, immediately cooled on ice for 5 min, and renatured at room temperature for 15 min before the EMSA assay. Each sequence (250 ng) was incubated separately with the target protein (FGFR3 K650E, 500 ng) and the counter protein (FGFR2, 500 ng) in 1× PBS buffer for 15 min at room temperature. The aptamer−target protein or −counter protein samples and the naive aptamer sample were run on the 6% native PAGE, stained in ethidium bromide solution, and visualized by Gel Doc EZ system under UV light illumination in order to evaluate the potential DNA band shift because of the analyte−ligand interaction. Evaluation of the Aptamer Binding Kinetics. Selected aptamer kinetics were evaluated using a Biacore T200 SPR instrument from GE Healthcare, docked with a standard CM5 chip. The target protein was immobilized on the CM5 chip using NHS-EDC coupling chemistry as described earlier. Dilutions (1000 nM) of the aptamers were prepared in 1× PBS buffer and injected over the protein-coated surface one by one. The surface regeneration was performed after each aptamer injection using 50 mM NaOH. The best aptamer candidate (SU-3) was evaluated for binding kinetics through single cycle kinetic analysis33,34 using P20 supplied (0.005%) 1× PBS buffer from GE. For single cycle kinetic analysis, the surface was regenerated after each kinetic assay with 25 mM NaOH. The selected aptamer compound was injected consecutively at four logarithmic concentrations over the surface immobilized with the target protein and, in parallel, to a reference surface. The injections were matched by reference injections or by buffer containing no ligand. Both buffer injections and the reference flow channel signal are subtracted from the original signal. Both kinetic rate constants and linked reaction models were fitted using BiaEvaluation Software. Universal fitting to a 1:1 Langmuir binding model was applied to predict the equilibrium binding constants (KD).35,36 The fitting data are displayed with the global rate constants (ka, kd, and KD).

of the buffer), followed by the addition of an equal amount of 2× PBS buffer in order to match the overall buffer content with the running buffer. As illustrated in Figure 1, SPR-based selection strategy started with EDC and NHS injection that enabled the covalent immobilization of proteins with primary -NH2 groups. Following protein injection and covalent coupling, 1 M ethanolamine-HCl (pH 7.4) injection was used to deactivate the remaining −COOH groups that were susceptible to nonspecific interactions. The amount of the target protein on the chip surface for all SELEX cycles was kept around 250− 350 RU, where 1000 RU corresponds to an angle change of ∼0.1°. For most proteins, binding of ∼1 ng/mm2 of protein at the dextran surface is required to cause a signal change of 1000 RU.30,31 Although these SPR values are not very accurate (because keeping the amount of protein constant on the surface is hard to achieve all the time; similarly for the injected amount of the ssDNA), the change in the signal trend still delivered useful information to assess the overall enrichment process. Next, the ssDNA library was injected over the target immobilized surface from which the nonspecific binders or weak binders were eliminated through the continuous flow of the running buffer on the chip surface. Finally, 50−100 mM NaOH was injected over the surface that released the targetbound oligonucleotides (the putative aptamers) from the outlet tubing because of the disturbed secondary structure. The collected ssDNA sample was around 300 μL that consisted of the running buffer (1× PBS) and NaOH along with the aptamer candidates. Following the neutralization of the collected sample with diluted HCl, the solution was transferred to a 10 kDa centrifugal filter unit and supplemented with sterile MQ water up to 500 μL. The centrifugation step took around 30 min at 14 000g, which delivered around 8−10 μL of the concentrated ssDNA to be used in the initial PCR, as described earlier. The best PCR sample obtained from the amplification reactions was converted into ssDNA via λ exonuclease digestion reaction and purified for the next SELEX cycle. During the sixth cycle, the ssDNA pool generated from the fifth cycle was directly incubated with the target protein in 1× PBS for 5 min and transferred to a centrifugal filter unit (50 kDa cutoff) to eliminate the unbound or free DNA molecules. The recovered protein−DNA complex solution was heated at 95 °C for 5 min in order to degrade the protein content, and the recovered ssDNA was subjected to PCR, the λ exonuclease digestion reaction, and the purification step. The filtrationbased selection at cycle 6 was performed to allow aptamer candidates to target the protein in its complete 3D structure in solution as well as to eliminate possible chip surface-specific oligonucleotides (negative selection) from the enriched ssDNA pool. The negative and counter selection steps were performed using the ethanolamine immobilized and FGFR2 (counter protein) immobilized chip surfaces, respectively. In contrast to the elution step of the positive selection against the target protein, the ethanolamine or counter protein-bound oligonucleotides were left on the chip surface, while the other oligonucleotides were collected from the system outlet throughout a ssDNA injection step. The collected ssDNA sample was directly injected over a new chip surface that was freshly modified with the target for positive selection. The SPR signal shift received upon ssDNA library injection was used to

■

RESULTS AND DISCUSSION Real-Time Screening of Aptamers. The SPR-based ssDNA aptamer selection strategy applied in this work is illustrated in Figure 1. Steps from A to G illustrate one cycle of the selection that can be monitored in real-time and controlled

D


Research Article


Figure 2. SPR response received upon random ssDNA pool injection over the target immobilized chip surface was presented for 9 cycles of the selection. The round 6 selection was performed using a centrifugal filter unit as a negative selection step. SPR-based negative and counter selection steps were also applied during rounds 7 and 8, respectively. Inset PAGE image shows the PCR products received from rounds 3−10. Control is the PCR sample without the DNA template.

at each step, individually. Flexibility and the sensitivity of the procedure enable the selection of aptamers against any target that can be immobilized on the chip surface. Depending on the configuration of the SPR instrument, parallel selection of aptamers against multiple targets can also be achieved through the independent flow channels. Based on the described selection procedure, nine rounds of selection were performed to screen aptamers against the target protein, and the SPR responses recorded from the positive selection cycles were used for a raw estimation of the random ssDNA pool enrichment throughout selections, as shown in Figure 2. The enriched ssDNA pool obtained from the fifth round was used in a filter-based selection step in the sixth round, as described in the Experimental Section, in order to target the protein in its 3D structure and to eliminate the potential chip-surface-specific aptamers as much as possible. As presented in the data, this step significantly reduced the number of participating nontarget oligonucleotides. In round 8, a negative selection was performed against the target-free, ethanolamine-immobilized chip surface that was immediately followed by a positive selection cycle on the freshly prepared target-immobilized chip. The counter selection step in round 9 was conducted similarly except that the immobilized molecule was FGFR2 instead of ethanolamine, during which the aptamers targeting structurally similar proteins were targeted to be eliminated. As shown in Figure 2, SPR signals from the first five cycles were rather low but reached a significant level following the filter-based selection, indicating the presence of nonspecific oligonucleotides in the partially enriched pool, which should be taken into consideration during any SELEX experiment. These nonspecific oligonucleotides might have been targeting either the thiol reagents on the chip surface or the ethanolamine reagent that was used to deactivate the free −COOH groups.

Moreover, a decrease in the SPR response following the negative and the counter-SELEX steps indicated further removal of some nonspecific oligonucleotides from the enriched pool. It was still possible that there was a great deal of nonspecific oligonucleotides remaining in the 10th round pool used for the sequencing. Since NGS was used to evaluate the final enriched pool, the copy number data of the individual sequences allowed us to disregard those sequences with low copy numbers that were considered as the nonspecific oligonucleotides. The inset in Figure 2 presents the PCR products (94 bp) of the 3−10th rounds that were reasonably clear and intense. Evaluation of NGS Data. The NGS data was first cleaned from the oligonucleotides that showed a size different than the original size of the pool (94 bp with primers), which eventually reduced the number of sequences from 10 846 808 to 4 186 971. After trimming the primer binding sites at both ends, the remaining data was filtered for potential sequences bearing primer-like sequences, which yielded 3 822 252 sequences. Scanning of the data for over-represented sequences resulted in 37 870 individual sequences with different copy numbers from which the most repeated 500 sequences were used for further evaluation of the pool, as a representative of the full data set. The sequences were tagged with “SU-” and numbered from 1 to 500, SU-1 being the most repeated sequence in the data set. As presented in Figure 3A, copy numbers of the selected top 500 sequences varied from 200 to 200 000, which showed a good sequence homology upon alignment. Figure 3B presents that alignment evolved from a different sequence of families. The MEME Suite web server used to identify the sequence families or the motifs produced four main motifs that reflected a considerable part of the entire data set, as shown in Figure 3C,D. For instance, sequence homology of motif 1 and motif 4 E


Research Article


Figure 3. Assessment of the NGS data using CLC Genomics Workbench v.5 and MEME Suite online tools. Primer binding regions were truncated before the analysis. Sequences were numbered according to their copy numbers in the data set; for example, 1 refers to the sequence with the highest copy number and 500 is the sequence with the lowest copy number. (A) Copy numbers of the top 500 sequences given in a logarithmic scale. (B) Alignment of the top 500 sequences based on the sequence homology. (C) Motifs were generated from the sequence homology data using MEME suite. (D) Number of overall sequences showing at least 85% sequence homology with the identified motifs. (E) Examples of some sequences in top 500 list showing a high degree of sequence homology with motif 1. (F) Example of some sequences in top 500 showing high degree of sequence homology with motif 4.

Table 1. Selected Aptamer Sequences (without Primer Regions, Each 50-mer), Respective Copy Numbers, and Predicted ΔG Values at 25 °C, 100 mM NaCl, and 5 mM MgCl2 ID

copy number

5′-sequence without primer regions-3′

ΔG (kcal/mol)

SU-1 SU-2 SU-3 SU-4 SU-5 SU-6 SU-7 SU-8 SU-9

202303 (motif 3) 59116 (motif 1) 32562 (motif 4) 23429 22872 (motif 1) 21902 20310 19896 17327

CCGACGAGACTTCCACAACGCTGCCAAGCCATCGTCCCCCCGCACTCAGG ATGACACGAAGTATGGTAGCGCTGGGGCAACACCACCCGTTTGGAGCCGT CAGAGGCTGACGTAAACAGACATTGATGGGACCCACCCTTCCGCTGGCAA TCCAATTAAACGACGGGGAGGGATCGCGCCGTACCTAATTGAGCGTATGT ATGACACGAAGTATGGTAGCGCTGGGGCAACACCACCCGTCTGGAGCCGT CAAATGAACATCAAATAACCGTGACCTACCCCGAGTCAACCGTAGAGCAA TGTTTTACCCGCAATCCCCGATGCGCCGCTCAGCAGGATCATTGAATTTC CCAATGCGATGTCCCGCAGCCGGTGATTGAGAAATCGGTAAGGACGGATC ATTGATGTAGACCATAATTGTGACTAACGCCCCCCCGTCTCATGCAACTG

−3.63 −4.79 −4.10 −5.69 −2.96 −0.78 −3.01 −5.34 −1.54

considered as a revolution in the field although there are contradictory reports in the literature. In theory, the high abundance rate or copy number is expected to be in correlation with the pool enrichment as long as the bias originating from

with other sequences in the top 500 list are illustrated in Figure 3E,F, respectively. Identification of candidate aptamers through NGS based on copy number, sequence homology, and secondary structures is F


Research Article


Figure 4. EMSA results of the selected aptamers. The first lane refers to the 50 bp DNA ladder, Apt ID refers to the sequence name, A refers to the naive aptamer sample without any protein, B refers to the aptamer incubated with the target protein, C refers to the aptamer incubated with the counter protein, and the red arrows refer to the aptamer−protein complexes. Unbound aptamers are located at the end of the gels due to the smaller molecular weights. Aptamer concentration was 250 ng for all samples, while the protein concentration was 500 ng.

Figure 5. Evaluation of the binding capabilities of the selected aptamer candidates using the SPR technique. (A) Aptamers were prepared in 1× PBS, and the concentration for all aptamers was 1000 nM. (B) Binding analysis of SU-3 aptamer by single-cycle kinetics method. The predicted KD was 28.2 × 10−9 ± 19.6 × 10−9 M (n = 5) in 1× PBS buffer, using 1:1 Langmuir binding model. The red line shows the actual data, and the black line shows the fitting. Aptamer concentrations for single-cycle kinetics analysis were between 50 and 800 nM. Inset shows the secondary structure of SU-3 aptamer.44

the selection, PCR, sequencing, or data processing is negligible.13 In agreement with this approach, Bawazer et al.37 generated biomineralizing DNA aptamers by using only one cycle of an AB SOLID sequencing-based SELEX strategy where sequence similarity and the highest copy number strategy were applied for the selection of successful aptamers. Nevertheless, processing of the large data sets produced by the

sequencing platforms has remained a challenge for many due to the lack of open source bioinformatics tools. Because the NGS data looked consistent regarding the repeat numbers, motifs, and their sequence homology within the overall data set, the most abundant nine sequences were selected as the aptamer candidates for further evaluation. Table 1 shows the selected sequences without the primer binding regions, respective copy numbers, and the ΔG values predicted G


Research Article

ACS Combinatorial Science by mfold web server.32 Four sequences out of 9 were direct representatives of the motifs, while the other five sequences were not listed in any motif family identified by MEME Suite web server. EMSA. The band shift assay is a common electrophoresis technique used to study protein−DNA or protein−RNA interactions. EMSA assay was performed for all the selected sequences to visualize putative aptamer−protein complexes as a positive band shift on the electrophoretic gel. As presented in Figure 4, all sequences were incubated with the target protein (B) as well as the counter protein (C) to assess the interference potential of the sequences simultaneously. Naive aptamer sequences (A) and a DNA ladder of 50 bp were also loaded into the wells for control purposes. Under similar experimental conditions, the shifted bands indicated with the red arrows in the image showed the complexing of SU-1, SU-2, and SU-3 with the target protein. As evident in the EMSA data, aptamers formed two distinct bands when they bound to the target protein. This result is in agreement with the reports in the literature where the expression of FGFR3 proteins was confirmed with either denaturing PAGE or immunoblot methods that showed two distinct bands for the protein when it complexed with the target-specific antibodies.38,39 The remaining aptamer candidates (SU-4−9) did not yield such visible DNA and protein complexes, and the gel data for these aptamers required blackwhite contrast adjustment for visualization of the bands (Supplementary data, Figure S1). Also, the interference effect was not noticeable for any of the aptamer sequences tested. Based on the shifted bands from the EMSA assay, some of the aptamer candidates were investigated further with SPR to reveal their target binding capabilities. Evaluation of the Binding Kinetics. Based on the EMSA results, binding analysis of five aptamer candidates was performed using a Biacore T200 SPR instrument. Dilutions (1000 nM) of the selected aptamers (SU-2, SU-3, SU-4, SU-5, and SU-7) in 1× PBS buffer were conditioned before the measurements and injected over the target-immobilized surface in serial. Regeneration between the injection of individual aptamer candidates was done using 50 mM NaOH solution, and the data obtained from the target-free reference surface was subtracted from the actual surface data. Although SU-1 aptamer was also tested for kinetic analysis, all three trials failed due to the noise that appeared continuously during SU-1 injection (data not shown). As presented in Figure 5A, overall SPR signals were low due to the small molecular weight of the aptamers (around 13 kDa). This result was in agreement with similar DNA−protein interaction reports published previously.40 According to the SPR-based binding assessment of the selected aptamers, SU-3 presented a significant difference among the other tested candidates, and it was evaluated further with single cycle kinetics method to predict its binding constants. Single-cycle kinetics method, also known as kinetic titration assay, consisted of consecutive injections of the analyte at increasing concentrations without regeneration steps between each sample injection.41,42 This method is specifically applied when the regeneration solutions (Glycin, NaOH, NaCl) change the surface properties of the target-immobilized chip that eventually disturb the specific ligand and analyte interaction and prevent kinetic analysis. The reliability of the single-cycle kinetics method was shown several times in the literature by comparing the results with conventional multiple

kinetics approach.33,34,43 Association rate constants (ka) and dissociation rate constants (kd) govern the differential equations leading to steady-state binding conditions. d [P ] = −(ka[P][A] − kd[PA]) dt d[PA] = ka[P][A] − kd[PA] dt

where [P], [A], and [PA] designate the concentrations of protein, aptamer candidate, and protein−aptamer conjugate, respectively. In addition to binding kinetics, SPR response (R) is modeled as below taking positive or negative baseline drift into account. R = RPA + R 0 + RI + mΔt

where RPA, R0, and RI represent SPR response from protein− aptamer binding, baseline, and refractive index change of the injection buffer, respectively; m and Δt represent the drift slope and time difference since the start of the measurement cycle.45 Since the target protein-immobilized chip surface was affected by the injection of regeneration solutions like NaOH and glycine, the single-cycle kinetics method was applied for further studies. In Figure 5B, a single cycle kinetics analysis of SU-3 is shown along with the respective binding constants and experimental details. Four different concentrations of the target protein (50−800 nM) were sequentially injected over the target-immobilized chip surface without surface regeneration.33,34 The fitting data (obtained through the universal fitting to a 1:1 Langmuir binding model)35,36 presents the global association constant (ka), dissociation constant (kd), and binding at equilibrium (KD), which provided a calculated average KD of (28.2 ± 19.6) × 10−9 M (n = 5) under the tested conditions. Another independent repeat of kinetics data tested with different concentrations of SU-3 is given in Figure S2. The same aptamer candidates were also tested with SPR on a nonrelated protein target (VEGF) and showed no significant binding interference.

■

CONCLUSION In this work, we present a set of ssDNA aptamers targeting FGFR3 protein using an SPR-based SELEX method, which enabled the real-time monitoring and quality control of each selection round. Since the SPR instrument is inherently coupled to a microfluidic system, elimination of the nonspecific oligonucleotides was simply ensured by the constant flow of the binding buffer over the chip surface. The tunability of the flow rate also enabled the on-demand adjustment of selection stringency through the elimination of the fast off-rate aptamer candidates. The exceptional sensitivity of the SPR phenomenon and integrated microfluidic recovery minimized the material consumption while monitoring of binding rates of selection rounds in real-time. Incorporation of an extra filter-based selection step outlined the significance of the surface-free negative selection step. In contrast to previous SELEX techniques in the literature, the SPR based SELEX method offers real-time sensitive monitoring and efficient microfluidic recovery of the selection rounds. Based on the data obtained from the bioinformatic analysis of the NGS results, SU-3 aptamer was able to bind to FGFR3 protein with a calculated KD value of (28.2 ± 19.6) × 10−9 M (n = 5), Future studies may focus on the identification H


Research Article


(10) Toh, S. Y.; Citartan, M.; Gopinath, S. C. B.; Tang, T.-H. Aptamers as a Replacement for Antibodies in Enzyme-Linked Immunosorbent Assay. Biosens. Bioelectron. 2015, 64, 392−403. (11) Sharma, R.; Ragavan, K. V.; Thakur, M. S.; Raghavarao, K. S. M. S. Recent Advances in Nanoparticle Based Aptasensors for Food Contaminants. Biosens. Bioelectron. 2015, 74, 612−627. (12) Dausse, E.; Barré, A.; Aimé, A.; Groppi, A.; Rico, A.; Ainali, C.; Salgado, G.; Palau, W.; Daguerre, E.; Nikolski, M.; et al. Aptamer Selection by Direct Microfluidic Recovery and Surface Plasmon Resonance Evaluation. Biosens. Bioelectron. 2016, 80, 418−425. (13) Yüce, M.; Ullah, N.; Budak, H. Trends in Aptamer Selection Methods and Applications. Analyst 2015, 140 (16), 5379−5399. (14) Kurt, H.; Yüce, M.; Hussain, B.; Budak, H. Dual-Excitation Upconverting Nanoparticle and Quantum Dot Aptasensor for Multiplexed Food Pathogen Detection. Biosens. Bioelectron. 2016, 81, 280−286. (15) Zargar, T.; Khayamian, T.; Jafari, M. T. Aptamer-Modified Carbon Nanomaterial Based Sorption Coupled to Paper Spray Ion Mobility Spectrometry for Highly Sensitive and Selective Determination of Methamphetamine. Microchim. Acta 2018, 185 (2), 103. (16) Shoghi, E.; Mirahmadi-Zare, S. Z.; Ghasemi, R.; Asghari, M.; Poorebrahim, M.; Nasr-Esfahani, M.-H. Nanosized Aptameric Cavities Imprinted on the Surface of Magnetic Nanoparticles for High-Throughput Protein Recognition. Microchim. Acta 2018, 185 (4), 241. (17) Ye, H.; Duan, N.; Wu, S.; Tan, G.; Gu, H.; Li, J.; Wang, H.; Wang, Z. Orientation Selection of Broad-Spectrum Aptamers against Lipopolysaccharides Based on Capture-SELEX by Using Magnetic Nanoparticles. Microchim. Acta 2017, 184 (11), 4235−4242. (18) Yüce, M.; Kurt, H.; Hussain, B.; Ow-Yang, C. W.; Budak, H. Exploiting Stokes and Anti-Stokes Type Emission Profiles of Aptamer-Functionalized Luminescent Nanoprobes for Multiplex Sensing Applications. Chemistry Select 2018, 3 (21), 5814−5823. (19) Tuerk, C.; Gold, L. Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science (Washington, DC, U. S.) 1990, 249 (4968), 505− 510. (20) Ellington, A. D.; Szostak, J. W. In Vitro Selection of RNA Molecules That Bind Specific Ligands. Nature 1990, 346 (6287), 818−822. (21) He, X.; Guo, L.; He, J.; Xu, H.; Xie, J. Stepping Library-Based Post-SELEX Strategy Approaching to the Minimized Aptamer in SPR. Anal. Chem. 2017, 89 (12), 6559−6566. (22) Spiga, F. M.; Maietta, P.; Guiducci, C. More DNA−Aptamers for Small Drugs: A Capture−SELEX Coupled with Surface Plasmon Resonance and High-Throughput Sequencing. ACS Comb. Sci. 2015, 17 (5), 326−333. (23) Gold, L.; Schneider, D. J.; Vanderslice, R. Flow Cell Selex. International Patent WO1998033941 A1 1998. (24) Khati, M.; Schuman, M.; Ibrahim, J.; Sattentau, Q.; Gordon, S.; James, W. Neutralization of Infectivity of Diverse R5 Clinical Isolates of Human Immunodeficiency Virus Type 1 by Gp120-Binding 2’FRNA Aptamers. J. Virol. 2003, 77 (23), 12692−12698. (25) Misono, T. S.; Kumar, P. K. R. Selection of RNA Aptamers against Human Influenza Virus Hemagglutinin Using Surface Plasmon Resonance. Anal. Biochem. 2005, 342 (2), 312−317. (26) Ngubane, N. A. C. C.; Gresh, L.; Pym, A.; Rubin, E. J.; Khati, M. Selection of RNA Aptamers against the M. Tuberculosis EsxG Protein Using Surface Plasmon Resonance-Based SELEX. Biochem. Biophys. Res. Commun. 2014, 449 (1), 114−119. (27) Jia, W.; Li, H.; Wilkop, T.; Liu, X.; Yu, X.; Cheng, Q.; Xu, D.; Chen, H.-Y. Silver Decahedral Nanoparticles Empowered SPR Imaging-SELEX for High Throughput Screening of Aptamers with Real-Time Assessment. Biosens. Bioelectron. 2018, 109, 206−213. (28) Tiong, K. H.; Mah, L. Y.; Leong, C.-O. Functional Roles of Fibroblast Growth Factor Receptors (FGFRs) Signaling in Human Cancers. Apoptosis 2013, 18 (12), 1447−1468. (29) Avci-Adali, M.; Paul, A.; Wilhelm, N.; Ziemer, G.; Wendel, H. P. Upgrading SELEX Technology by Using Lambda Exonuclease

of the critical sequence region in charge of the actual binding, postmodification of the critical sequences against alleged tyrosine kinase enzyme attacks, and investigate further for possible deactivation of the enzyme or growth factor binding. Also, SU-3 aptamer can be utilized in a wide range of biosensor platforms including in vivo FRET biosensing of FGFR3 kinase activity46 and in vivo imaging of FGFR overexpression characteristics.47

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acscombsci.9b00059.

■

EMSA results of the aptamers SU-4−9 and Single cycle kinetic analysis of SU-3 (PDF)

AUTHOR INFORMATION

Corresponding Author

*M.Y. E-mail: [email protected]. ORCID

Meral Yüce: 0000-0003-0393-1225 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors acknowledge Sabanci University SUNUM Nanotechnology Research Centre for Individual Research Funding, Istanbul Medipol University for NGS assays, and EMBO ST program. M.Y. owes special thanks to Dr. Naimat Ullah for his help during the optimization of the ssDNA production step.

■

REFERENCES

(1) Baek, S. H.; Wark, A. W.; Lee, H. J. Dual Nanoparticle Amplified Surface Plasmon Resonance Detection of Thrombin at Subattomolar Concentrations. Anal. Chem. 2014, 86 (19), 9824−9829. (2) Vance, S. A.; Sandros, M. G. Zeptomole Detection of C-Reactive Protein in Serum by a Nanoparticle Amplified Surface Plasmon Resonance Imaging Aptasensor. Sci. Rep. 2015, 4, 5129. (3) Yüce, M.; Kurt, H. How to Make Nanobiosensors: Surface Modification and Characterisation of Nanomaterials for Biosensing Applications. RSC Adv. 2017, 7 (78), 49386−49403. (4) Hong, X.; Hall, E. A. H. Contribution of Gold Nanoparticles to the Signal Amplification in Surface Plasmon Resonance. Analyst 2012, 137 (20), 4712. (5) Yüce, M.; Kurt, H.; Hussain, B.; Budak, H. Systematic Evolution of Ligands by Exponential Enrichment for Aptamer Selection. Biomedical Applications of Functionalized Nanomaterials; Elsevier, 2018; pp 211−243. DOI: 10.1016/B978-0-323-50878-0.00008-2. (6) Huang, C.-J.; Lin, H.-I.; Shiesh, S.-C.; Lee, G.-B. Integrated Microfluidic System for Rapid Screening of CRP Aptamers Utilizing Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Biosens. Bioelectron. 2010, 25 (7), 1761−1766. (7) Chen, A.; Yang, S. Replacing Antibodies with Aptamers in Lateral Flow Immunoassay. Biosens. Bioelectron. 2015, 71, 230−242. (8) Rubab, M.; Shahbaz, H. M.; Olaimat, A. N.; Oh, D.-H. Biosensors for Rapid and Sensitive Detection of Staphylococcus Aureus in Food. Biosens. Bioelectron. 2018, 105, 49−57. (9) Trapaidze, A.; Hérault, J.-P.; Herbert, J.-M.; Bancaud, A.; Gué, A.-M. Investigation of the Selectivity of Thrombin-Binding Aptamers for Thrombin Titration in Murine Plasma. Biosens. Bioelectron. 2016, 78, 58−66. I


Research Article

ACS Combinatorial Science Digestion for Single-Stranded DNA Generation. Molecules 2010, 15 (1), 1−11. (30) Dupont, D. M.; Larsen, N.; Jensen, J. K.; Andreasen, P. A.; Kjems, J. Characterisation of Aptamer−Target Interactions by Branched Selection and High-Throughput Sequencing of SELEX Pools. Nucleic Acids Res. 2015, No. gkv700. (31) Allard, J. The Effect of Viral Clearance Methods on Protein Quality. Master’s Thesis, Uppsala Universitet, 2004. (32) Zuker, M. Mfold Web Server for Nucleic Acid Folding and Hybridization Prediction. Nucleic Acids Res. 2003, 31 (13), 3406− 3415. (33) Glück, J. M.; Koenig, B. W.; Willbold, D. Nanodiscs Allow the Use of Integral Membrane Proteins as Analytes in Surface Plasmon Resonance Studies. Anal. Biochem. 2011, 408 (1), 46−52. (34) Karlsson, R.; Katsamba, P. S.; Nordin, H.; Pol, E.; Myszka, D. G. Analyzing a Kinetic Titration Series Using Affinity Biosensors. Anal. Biochem. 2006, 349 (1), 136−147. (35) Pollet, J.; Delport, F.; Janssen, K. P. F.; Jans, K.; Maes, G.; Pfeiffer, H.; Wevers, M.; Lammertyn, J. Fiber Optic SPR Biosensing of DNA Hybridization and DNA−Protein Interactions. Biosens. Bioelectron. 2009, 25 (4), 864−869. (36) Lou, X.; Qian, J.; Xiao, Y.; Viel, L.; Gerdon, A. E.; Lagally, E. T.; Atzberger, P.; Tarasow, T. M.; Heeger, A. J.; Soh, H. T. Micromagnetic Selection of Aptamers in Microfluidic Channels. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (9), 2989−2994. (37) Bawazer, L. A.; Newman, A. M.; Gu, Q.; Ibish, A.; Arcila, M.; Cooper, J. B.; Meldrum, F. C.; Morse, D. E. Efficient Selection of Biomineralizing DNA Aptamers Using Deep Sequencing and Population Clustering. ACS Nano 2014, 8 (1), 387−395. (38) Sorensen, V.; Wiedlocha, A.; Haugsten, E. M.; Khnykin, D.; Wesche, J.; Olsnes, S. Different Abilities of the Four FGFRs to Mediate FGF-1 Translocation Are Linked to Differences in the Receptor C-Terminal Tail. J. Cell Sci. 2006, 119 (20), 4332−4341. (39) Nelson, K. N.; Meyer, A. N.; Siari, A.; Campos, A. R.; Motamedchaboki, K.; Donoghue, D. J. Oncogenic Gene Fusion FGFR3-TACC3 Is Regulated by Tyrosine Phosphorylation. Mol. Cancer Res. 2016, 14 (5), 458−469. (40) Cho, B.; Vaidyanathan, V. G.; Xu, L.; Cho, B. P. Binding Kinetics of DNA-Protein Interaction Using Surface Plasmon Resonance. Protoc. Exch. 2013, 1−10. (41) Stoltenburg, R.; Schubert, T.; Strehlitz, B. In Vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A. PLoS One 2015, 10 (7), No. e0134403. (42) Kumar, P. K. R. Aptamers That Bind to the Human Complement Component Receptor HC5aR1 Interfere with HC5aR1 Interaction to Its HC5a Ligand. Mol. Biol. Rep. 2018, 45 (5), 851−864. (43) Manin, C.; Naville, S.; Gueugnon, M.; Dupuy, M.; Bravo de Alba, Y.; Adam, O. Method for the Simultaneous Assay of the Different Poliovirus Types Using Surface Plasmon Resonance Technology. Vaccine 2013, 31 (7), 1034−1039. (44) Mathews Lab Home. 2019, https://rna.urmc.rochester.edu/ index.html. (45) Oshannessy, D. J.; Brighamburke, M.; Soneson, K. K.; Hensley, P.; Brooks, I. Determination of Rate and Equilibrium Binding Constants for Macromolecular Interactions Using Surface Plasmon Resonance: Use of Nonlinear Least Squares Analysis Methods. Anal. Biochem. 1993, 212 (2), 457−468. (46) Ilgu, M.; Ray, J.; Bendickson, L.; Wang, T.; Geraskin, I. M.; Kraus, G. A.; Nilsen-Hamilton, M. Light-up and FRET Aptamer Reporters; Evaluating Their Applications for Imaging Transcription in Eukaryotic Cells. Methods 2016, 98, 26−33. (47) Shi, H.; He, X.; Wang, K.; Wu, X.; Ye, X.; Guo, Q.; Tan, W.; Qing, Z.; Yang, X.; Zhou, B. Activatable Aptamer Probe for ContrastEnhanced in Vivo Cancer Imaging Based on Cell Membrane ProteinTriggered Conformation Alteration. Proc. Natl. Acad. Sci. U. S. A. 2011, 108 (10), 3900−3905.

J


Plasmonic Selection of ssDNA Aptamers against Fibroblast Growth

Recommend Documents