Bioconjugate Chem. 2005, 16, 1034−1037
1034
Polyelectrolyte Complex Micelles Composed of c-raf Antisense Oligodeoxynucleotide-Poly(ethylene glycol) Conjugate and Poly(ethylenimine): Effect of Systemic Administration on Tumor Growth Ji Hoon Jeong,† Sun Hwa Kim,† Sung Wan Kim,‡ and Tae Gwan Park*,† Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 305-701, Korea (South), and Center for Controlled Chemical Delivery (CCCD)/Department of Pharmaceutics and Pharmaceutical Chemistry, University of Utah, Salt Lake City, Utah 84112. Received November 9, 2004; Revised Manuscript Received May 5, 2005
An antisense oligodeoxynucleotide (ODN) delivery system based on polyelectrolyte complex (PEC) micelles composed of an ODN-poly(ethylene glycol) (PEG) conjugate and polyethylenimine (PEI) was demonstrated. The PEC micelles having a core/shell structure were spontaneously formed in an aqueous solution by ionic interactions between ODN part in the conjugate and PEI. The ODN/PEI polyelectrolyte complex formed an inner core while PEG chains surrounded it as a shell. The morphology of the micelles was visualized as a separate sphere by atomic force microscopy (AFM). When the micelles containing a c-raf antisense ODN were intravenously administered into tumorbearing nude mice, significant antitumor activities against human lung cancer were observed. The intravenously injected micelles also showed significantly higher accumulation level in the solid tumor region compared to that of naked ODN.
INTRODUCTION
Novel drug delivery systems based on self-assembled polymeric micelles have drawn much attention due to their unique properties in therapeutic applications (16). Polymeric micelles, mostly prepared from various hydrophobic and hydrophilic A-B type di-block copolymers, are generally composed of a hydrophobic core and a surrounding hydrophilic shell (7, 8). Alternatively, polyelectrolyte complex micelles were prepared by using a di-block copolymer composed of a charged polymer segment and a hydrophilic PEG segment. Macromolecules having counterions were interacted to form a polyelectrolyte complex core with generating a PEG shell. The small size (usually less than 100 nm) and surrounding hydrophilic corona structure provide the micelles with a possibility to escape from opsonization and the clearance by reticuloendothelial system (RES) (9, 10). These properties also permit the micellar carriers to have enhanced permeability through loosened interendothelial junctions in the vicinity of solid tumors (11). Antisense ODN has been thought to be a promising therapeutic agent for treatment of various diseases including cancer. However, the therapeutic effect of antisense ODN in vivo has not been as efficient as expected due to several inherent properties of ODN, which are susceptibility to enzymatic degradation and limited uptake into target tissue (12-14). To improve the cellular uptake, various kinds of cationic carriers were utilized to produce nanosized complex particulates that can be more readily endocytosed into cells than naked ODN. The formation of polyelectrolyte complexes between * To whom correspondence should be addressed. Tel: +8242-869-2621, Fax: +82-42-869-2610, E-mail:
[email protected]. † Korea Advanced Institute of Science and Technology. ‡ University of Utah.
ODN and cationic lipids or polymers was a prerequisite step for enhancing the cellular uptake. Among the cationic polymers, PEG-b-poly(L-lysine) di-block copolymer (15) and PEG-grafted PEI (16) were used to form polyelectrolyte complex (PEC) micelles by interacting with ODN. These systems could provide ODN with an improved stability against nuclease attacks (17). Nevertheless, the stability of the polyelectrolyte complex micelles in the bloodstream has been issued as a major obstacle for in vivo applications (18). Previously, we have shown efficient c-myb and c-raf antisense ODN delivery systems based on PEC micelles, which were formed by combining ODN-PEG conjugate and cationic fusogenic peptide (19) or polycations (PEI, poly(L-lysine), and protamine) (19, 20). The PEC micelles having a spherical shape with about 70 nm in diameter could be efficiently transported within cells and could significantly inhibit the growth of smooth muscle cells and tumor cells in a dose-dependent manner. Moreover, when the PEC micelles containing c-raf ODN were administered intratumorally, they exhibited superior tumor suppression effect compared to naked ODN. In this study, c-raf antisense ODN PEC micelles were administered intravenously using an animal tumor model to explore their antitumor activities and tissue distribution behaviors. EXPERIMENTAL PROCEDURES
Materials. Twenty-base oligonucleotides (ODN) with 5′-terminal amine group (antisense c-raf ODN, TCCCGCCTGTGACATGCATT; random ODN, TCACATTGGCGCTTAGC-CGT) and fluorescence-labeled c-raf ODN (AATGCATGTCACAGGCGGGA) with a complementary sequence to antisense c-raf ODN were purchased from Bioneer (Daejeon, Korea). N-Hydroxylsuccinimidederivatized methoxy-poly(ethylene glycol) (mPEG-NHS,
10.1021/bc0497315 CCC: $30.25 © 2005 American Chemical Society Published on Web 06/18/2005
Technical Notes
Bioconjugate Chem., Vol. 16, No. 4, 2005 1035
Scheme 1. A Synthetic Scheme of ODN-PEG Conjugate
MW 2000) was obtained from Nektar (Huntsville, AL). Polyethylenimine (branched PEI, MW 25 000) was purchased from Aldrich (Milwaukee, WI). Cell culture materials, Roswell Park Memorial Institute 1640 medium (RPMI 1640), and fetal bovine serum (FBS) were purchased from Invitrogen (Carlsbad, CA). All other chemicals were of analytical grade and used without further purification. Synthesis of ODN-PEG Conjugate. To synthesize ODN-PEG conjugate, 5′-amine-derivatized ODN (1 mg, 180 nmol) was mixed with mPEG-NHS (Mw 2000, 1 mg, 540 nmol) in sodium phosphate buffer (10 mM NaH2PO4/ Na2HPO4, 100 mM NaCl, pH 7.0). After 1.5 h incubation at room temperature, the resulting product was dialyzed against deionized water (MWCO 5000). The synthesis of ODN-PEG conjugate was analyzed by reversed-phase chromatography, which was carried out on C18 column (200 × 4.6 mm, Waters, Milford, MA) with detection at 260 nm using a gradient from 5% acetonitrile in 0.1 M triethylammonium acetate to 50% acetonitrile in 0.1 M triethylammonium acetate with a flow rate of 1.0 mL/ min at 56 °C. The conjugate fraction of the ODN-PEG was about 65%. The fractionated conjugate was analyzed by using a matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (Voyager DE-STR, Perkin-Elmer Biosystems, Boston, MA). The matrix for the ODN-PEG conjugate was R-cyano-4hydroxycinnamic acid. Formation and Characterization of Polyelectrolyte Complex Micelles. Polyelectrolyte complex (PEC) micelles between ODN-PEG conjugate and polyethylenimine were formed as previously described (20). Briefly, the ODN-PEG conjugate diluted in PBS was filtered through 0.2 µm filter (Millipore, Bedford, MA) and mixed with PEI solution at a nitrogen/phosphate (N/P) ratio of 2.5:1. The micelles were incubated for 30 min to stabilize the complexes. The PEC micelles were visualized by using atomic force microscopy (AFM). The micelle solution was dropped on a clean mica surface and air-dried at room temperature. AFM analysis was carried out in a constant tapping mode by using Nanoscope II (Digital Instruments, Woodbury, NY). A standard Nanoprobe silicon single-crystal lever was used as a cantilever, and a constant force mode was used with a scan speed at 0.5 Hz. The scanning image was collected in 0.5 × 0.5 µm area.
Cell Culture. Human lung carcinoma cells (A549 cells) were purchased from the Korean Cell Line Bank (Seoul, Korea). A549 cells were maintained in RPMI 1640 medium, supplemented with 100 units/mL penicillin, 100 µg/mL streptomycin, and 10% fetal bovine serum. The cells were cultured as a monolayer in a humidified atmosphere containing 5% CO2 at 37 °C. For mice injection, A549 cells were grown until confluence, detached with trypsin/EDTA, washed three times with PBS, and resuspended in PBS. Tumor Growth Regression Studies. To generate an animal tumor model, A549 cells (1 × 106 cells) were injected subcutaneously into rear flanks of seven-week old female nude mice (nu/nu, Charles River Laboratories, Wilmington, MA). When a minimum tumor volume reached about 30 mm3, various ODN formulations (naked antisense ODN, antisense ODN polyelectrolyte complex micelles, or mismatched ODN polyelectrolyte complex micelles) were intravenously administered via a tail vein at 2.5 mg kg-1 injection-1 at predetermined time intervals. Tumor growth was monitored by measuring perpendicular diameters three times a week. The tumor volumes were determined as previously described (21). Statistical significance was evaluated by using a Student’s t-test and defined as P < 0.05. Assay of ODN Accumulated in Tumor. Fluoresceinlabeled ODN was prepared as previously described (20). Fluorescein-labeled ODN-PEG/PEI polyelectrolyte complex micelles (0.1 mg) were administered to tumorbearing nude mice via a tail vein. A group of mice were sacrificed at 3, 12, and 24 h after the injection. The tumor tissues were ground in a hypotonic solution by using a tissue homogenizer, centrifuged, and filtered through 0.45 µm filter membrane (Millipore, Bedford, MA). In vivo deposition of ODN in tumor was determined by measuring fluorescence intensity monitored from the tissue extract using spectrofluorometry (SLM-AMINCO 8100, SLM Instruments Inc., Urbana, IL) and expressed as a percent initial dosage per gram tissue. RESULTS AND DISCUSSION
A synthetic scheme of ODN-PEG conjugate is shown in Scheme 1. c-raf antisense ODN derivatized with an amine group at a 5′ terminal end was conjugated with a mPEG-NHS derivative to form an ODN-PEG conjugate.
1036 Bioconjugate Chem., Vol. 16, No. 4, 2005
Technical Notes
Figure 1. MALDI-TOF analysis of ODN-PEG conjugate purified by reversed-phase chromatography.
Figure 2. Atomic force microscopy (AFM) image of the polyelectrolyte complex micelles formed by the interaction between ODN-PEG and PEI.
The conjugation efficiency was ca. 65% as determined by reversed-phase HPLC. An average molecular weight of the purified conjugate analyzed by MALDI-TOF MS was 8989.1, which corresponds to the molecular weight sum of ODN and PEG (Figure 1). Polyelectrolyte complex micelles (PEC micelles) could be formed by ionic interactions between the ODN-PEG conjugate and polyethylenimine (PEI). The ODN part of the conjugate interacted with PEI to form a chargeneutralized ODN/PEI complex core, while the hydrophilic PEG segment of the conjugate surrounded it. The formation and characterization of the PEC micelles were previously reported (19, 20). The hydrodynamic diameter of the PEC micelles determined by dynamic light scattering (DLS) was ca. 70 nm with a narrow size distribution as described previously (20). The morphology of the PEC micelles was a round shaped structure as visualized on mica surface by using AFM (Figure 2). The size of PEC micelles observed by AFM was very consistent with that determined by DLS. We previously showed that the antisense ODN-PEG conjugate containing a noncleavable linkage between ODN and PEG could hybridize with its corresponding complementary sense ODN sequence like naked antisense ODN (20). The thermal melting behavior of antisense ODN-PEG/sense ODN duplex was the same as that of antisense ODN/sense ODN duplex, indicating that the presence of a PEG chain adjacent to ODN segment did not perturb the antisense/sense ODN hybridization process. When the antisense c-raf ODN-PEG/PEI conjugate PEC micelles were treated with human ovarian cancer A2780 cells, they exhibited a dose-dependent antiproliferative activity. Furthermore, they showed significant retardation of tumor growth after intratumoral administration. In this study, the antitumor activity of systemically administered PEC micelles containing c-raf antisense ODN was investigated using nude mice having subcutaneously implanted human lung carcinoma cells (A549). Compared to control groups (mice treated with a saline solution, naked antisense ODN, and PEC micelles containing mismatched ODN with a random sequence), antisense ODN PEC micelles suppressed tumor growth significantly. The PEC micelles containing c-raf antisense ODN noticeably retarded the tumor
Figure 3. Effect of ODN-PEG/PEI polyelectrolyte complex micelles containing antisense c-raf ODN on the growth of A549 tumors in nude mice (n ) 4-6). Tumors were allowed to grow until a mean volume of tumor reached 0.1 cm3 before treatment. Each ODN formulation was administered through tail vein at 2.5 mg kg-1 injection-1. The ODN formulations were injected at day 1, 3, 6, 8, 10, 13, and 15.
Figure 4. Accumulation of ODN-PEG/PEI PEC micelles in solid tumor after intravenous administration. Each ODN formulation containing 0.1 mg ODN was administered through mouse tail vein. The amount of ODN in each organ was measured by spectrofluorometric analysis and was shown as percent initial dose per gram of tumor.
growth after 10 days (Figure 3). This could be attributed to passive targeting effect of the nanosized PEC micelles by an enhanced permeation and retention (EPR) effect. The leaky vascular structure in solid tumor causes facilitated penetration and accumulation of nano-particulates. Polymer conjugates, liposomes, and polymeric micelles containing various anticancer agents showed increased accumulation in solid tumors (22-24). Likewise, the PEC micelles with ca. 70 nm in diameter were expected to penetrate into the interstitial space between loosened endothelial cell junctions and to accumulate in the tumor site that has insufficient lymphatic drainage. Figure 4 shows significant amount of the PEC micelles containing c-raf ODN accumulated in the tumor compared to naked ODN. After 12 h, the PEC micellar formulation showed about 3-fold higher local deposition amount of ODN in the tumor compared to that of naked ODN. Highly flexible PEG layers surrounding the PEC micelles could also play an important role in prolonging their circulation time in blood stream by suppressing nonspecific adsorption of opsonins and other serum proteins and by avoiding the recognition of reticuloen-
Bioconjugate Chem., Vol. 16, No. 4, 2005 1037
Technical Notes
dothelial systems (RES). The PEC micelles formed from the interaction between an ODN-PEG conjugate and linear-type PEI were reported to be stable against nuclease attack and showed minimal adsorption of serum proteins (25). This study demonstrated that the PEC micelles containing a c-raf antisense ODN, which were spontaneously formed by the interaction between ODN-PEG conjugate and PEI in an aqueous milieu, could significantly reduce the growth of tumor after systemic administration. The PEC micelle also showed enhanced accumulation in the tumor. This suggests that the ODN delivery system based on PEC micelles could be successfully used for systemic antisense ODN delivery for treatment of cancer. ACKNOWLEDGMENT
This work was supported by the grant from the Ministry of Science and Technology, Republic of Korea. LITERATURE CITED (1) Kataoka, K., Kwon, G., Yokoyama, T., Okano, T., and Sakurai, Y. (1993) Block copolymer micelles as vehicles for drug delivery. J. Controlled Release 24, 119-132. (2) Kwon, G., Naito, M., Yokoyama, M., Okano, T., Sakurai, Y., and Kataoka, K. (1995) Physical entrapment of adriamycin in AB block copolymer micelles. Pharm. Res. 12, 192-195. (3) Yoo, H. S., and Park, T. G. (2001) Biodegradable polymeric micelles composed of doxorubicin conjugated PLGA-PEG block copolymer. J. Controlled Release 70, 63-70. (4) Yu, B. G., Okano, T., Kataoka, K., and Kwon, G. (1998) Polymeric micelles for drug delivery: solubilization and haemolytic activity of amphotericin B. J. Controlled Release 53, 131-136. (5) La, S. B., Okano, T., and Kataoka, K. (1996) Preparation and characterization of the micelle-forming polymeric drug indomethacin-incorporated poly(ethylene oxide)-poly(betabenzyl L-aspartate) block copolymer micelles. J. Pharm. Sci. 85, 85-90. (6) Yoo, H. S., Lee, E. A., and Park, T. G. (2002) Doxorubicinconjugated biodegradable polymeric micelles having acidcleavable linkages. J. Controlled Release 82, 17-27. (7) Malmsten, M., and Lindman, B. (1992) Self-assembly in aqueous block copolymer solution. Macromolecules 25, 54405445. (8) Kwon, G., Naito, M., Yokoyama, M., Okano, T., Sakurai, Y., and Kataoka, K. (1993) Micelles based on AB block copolymers of poly(ethylene oxide) and poly(beta-benzyl L-aspartate). Langmuir 9, 945-949. (9) Bader, H., Ringsdorf, B., and Schmidt, B. (1984) Water soluble polymers in medicine. Angew. Makromol. Chem. 124, 457-485. (10) Klibanov, A. L., Maruyama, K., Torchilin, V. P., and Huang, L. (1990) Amphipathic poly(ethylene glycol)s effectively prolong the circulation time of liposomes. FEBS Lett. 268, 235-237. (11) Kwon, G., and Okano, T. (1996) Polymeric micelle as new drug carriers. Adv. Drug Delivery Rev. 16, 107-116.
(12) Stein, C. A., and Cheng, Y. C. (1993) Anti-sense oligonucleotides as therapeutic agents -is the bullet really magical? Science 261, 1004-1012. (13) Wagner, R. W. (1994) Gene inhibition using anti-sense oligodeoxynucleotides. Nature 372, 333-335. (14) Jeong, J. H., and Park, T. G. (2001) Novel polymer-DNA hybrid polymeric micelles composed of hydrophobic poly(D,Llactic-co-glycolic acid) and hydrophilic oligonucleotides. Bioconjugate Chem. 12, 917-923. (15) Kataoka, K., Togawa, H., Harada, A., Yasugi, K., Matsumoto, T., and Katoyose, S. (1996) Spontaneous formation of polyion complex micelles with narrow distribution from antisense oligonucleotide and cationic block copolymer in physiological saline. Macromolecules 29, 8556-8557. (16) Vinogradof, S., Batrakova, E., Li, S., and Kabanov, A. (1999) Polyion complex micelles with protein-modified corona for receptor-mediated delivery of oligonucleotides into cells. Bioconjugate Chem. 10, 851-860. (17) Katayose, S., and Kataoka, K. (1998) Remarkable increase in nuclease resistance of plasmid DNA through supramolecular assembly with poly(ethyeneglycol)-poly(L-lysine) block copolymer. J. Pharm. Sci. 87, 160-163. (18) Kakizawa, Y., Harada, A., and Kataoka, K. (2001) Glutathione-sensitive stabilization of block copolymer micelles composed of antisense DNA and thiolated poly(ethyleneglycol)-block-poly(L-lysine): A potential carrier for systemic delivery of antisense DNA. Biomacromolecules 2, 491-497. (19) Jeong, J. H., Kim S. W., and Park, T. G. (2003) Novel intracellular delivery system of anti-sense oligonucleotide by self-assembled hybrid micelles composed of DNA/PEG conjugate and cationic fusogenic peptide. Bioconjugate Chem. 14, 473-479. (20) Jeong, J. H., Kim, S. W., and Park, T. G. (2003) A new anti-sense oligonucleotide delivery system based on selfassembled ODN/PEG hybrid conjugate micelles. J. Controlled Release 93, 183-191. (21) McPhillips, F., Mullen, P., Monia, B. P., Ritchie, A. A., Dorr, F. A., Smyth, J. F., and Langdon, S. P. (2001) Association of c-Raf expression with survival and its targeting with antisense oligonucleotides in ovarian cancer. Br. J. Cancer 85, 1753-1758. (22) Shiah, J.-G., Sun, Y., Peterson, C. M., and Kopecek, J. (1999) Biodistribution of free and N-(2-hydroxypropyl)methacrylamide copolymer-bound mesochlorin e6 and adriamycin in nude mice bearing human ovarian calcinoma OVCAR-3 xenografts. J. Controlled Release 61, 145-157. (23) Weissig, V., Whiteman, K. R., and Torchilin, V. P. (1998) Accumulation of protein-loaded long-circulating micelles and liposomes in subcutaneous Lewis lung carcinoma in mice. Pharm. Res. 15, 1552-1556. (24) Yoo, H. S., and Park, T. G. (2004) Folate receptor targeted biodegradable polymeric doxorubicin micelles. J. Controlled Release 96, 273-283. (25) Oishi, M., Sasaki, S., Nagasaki, Y., and Kataoka, K. (2003) pH-responsive oligonucleotide (ODN)-poly(ethyleneglycol) conjugate through acid-labile β-thiopropionate linkage: preparation and polyion complex micelle formation. Biomacromolecules 4, 1426-1432.
BC0497315
