Polymeric vector-mediated targeted delivery of anti-PAK1 siRNA to

Subscriber access provided by Nottingham Trent University

Controlled Release and Delivery Systems

Polymeric vector-mediated targeted delivery of anti-PAK1 siRNA to macrophages for efficient atherosclerosis treatment Teng Wu, Hong Xiao, Liejing Lu, Yali Chen, Yong Wang, Wenhao Xia, Ming long, Jun Tao, Jun Shen, and Xintao Shuai ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/ acsbiomaterials.9b01076 • Publication Date (Web): 12 Aug 2019 Downloaded from pubs.acs.org on August 12, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Polymeric vector-mediated targeted delivery of anti-PAK1 siRNA to macrophages for efficient atherosclerosis treatment

Teng Wu,a,b,1 Hong Xiao,b,c,1 Liejing Lu,d,1 Yali Chen,a Yong Wang,*b,c Wenhao Xia,a Ming Long,a Jun Tao,*a Jun Shen,d and Xintao Shuai*a,b

aDepartment

of Hypertension and Vascular Disease, the First Affiliated Hospital, Sun

Yat-Sen University, Guangzhou, 510080, China bPCFM

Lab of Ministry of Education, School of Materials Science and Engineering,

Sun Yat-sen University, Guangzhou 510275, China cCollege

of Chemistry and Materials Science, Jinan University, Guangzhou, 510632,

China dDepartment

of Radiology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University,

Guangzhou 510120, Guangdong, China

1 These

authors contributed equally to this work.

* Correspondence should be addressed to: Xintao Shuai, E-mail: [email protected] Yong Wang, E-mail: [email protected] Jun Tao, E-mail: [email protected]

1

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Atherogenesis, initially induced by endothelial structure alteration and dysfunction, is the main cause of cardiovascular diseases that jeopardize public health. Unfortunately, an efficient strategy for atherosclerosis treatment is still far from satisfying the clinical requirements. Dyslipidaemia and chronic inflammatory responses, especially the overexpression of the pro-atherosclerotic factors monocyte chemotactic protein 1 (MCP-1) and interleukin-6 (IL-6) in plaques, represent the key features that promote the development of atherosclerosis. Here, a CD36 antibody-modified siRNA nanomedicine based on the mPEG-PAsp-(g-PEI) vector was developed for atherosclerosis therapy. In vitro and in vivo studies demonstrated that the synthesized siRNA nanomedicine targeted macrophages, reduced CD36 expression and inhibited IL-6 and MCP-1 upregulation, and eventually reduced the formation of foam cells and alleviated the pathological process of atherosclerosis. These results indicate that the targeted delivery of anti-PAK1 siRNA using a CD36 antibody modified polymeric vector represents a novel and efficient strategy for atherosclerosis treatment.

Key words: Atherosclerosis, siRNA delivery, macrophages, CD36 targeting, antiinflammatory

1. Introduction Atherogenesis, which is initially induced by endothelial structure alteration and dysfunction, progresses with the subendothelial accumulation of lipoproteins, and 2


Page 2 of 33

Page 3 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


finally ends with apoptotic or necrotic cell debris that accumulates within the vessel walls of medium- and large-sized arteries,1,2 is still the leading cause of morbidity and mortality in developed countries.3,4 Chronic inflammation is related to the metabolic disorder of circulating blood lipids, e.g., low-density lipoprotein (LDL), cholesterol, and triglycerides,5,6 and plays significant roles in atherogenesis. The standard LDL

particles that accumulate in the subintima of vascular injury can be modified by reactive oxygen species (ROS) or enzymes released from inflammatory cells (e. g. macrophages),7 leading to the formation of oxidized LDL (oxLDL).8 OxLDL not only contributes to pro-atherogenic responses by facilitating cholesterol incorporation into macrophages via the CD36 and SR-A scavenger pathway, but also induces proinflammatory responses to promote macrophage accumulation as well as foam cell formation.9 Additionally, the accumulation of foam cells causes the further overexpression of pro-inflammatory cytokines such as interleukin-6 (IL-6) and monocyte chemotactic protein 1 (MCP-1),10 resulting in plaque formation to promote smooth muscle cell migration and proliferation in the intimal layer.11 Furthermore, accumulated macrophages in atherosclerotic plaques seem to reduce the migration capacity of foam cells, leading to more advanced progression of lesions.12 Given the important role that macrophages play in all atherosclerosis-related processes. i.e., initiation, progression and regression, a therapeutic strategy targeting macrophages possesses great potential for atherosclerosis treatment. A series of studies has indicated that CD36 overexpression in macrophages is the most remarkable feature of atherosclerotic lesions.11 In addition, CD36-mediated 3



oxLDL uptake by macrophages has been proven to take part in the formation of foam cells and promote the deterioration of atherosclerosis.12 In this case, blocking or reducing the interaction of oxLDL with macrophages may alleviate the progression of atherosclerosis. P21-activated kinase 1 (PAK1), a member of the highly conserved PAK family of serine/threonine protein kinases, has been demonstrated to regulate human scavenger receptor class B, type I expression in macrophages via its GTPasebinding domain.13 Moreover, research with a PAK knockout mouse revealed that blocking the PAK1 gene can reduce the expression of some pro-atherosclerosis factors such as MCP-1 and IL-6, resulting in an effective amelioration of atherosclerosis.14 Hopefully, silencing the PAK1 gene will lead to the suppression of both the cellular internalization of oxLDL and pro-atherosclerosis factors such as MCP-1 and IL-6, thereby achieving an enhanced therapeutic effect for atherosclerosis treatment. Owing to its high efficiency in silencing target genes, RNA interference (RNAi) is regarded as a potential approach for gene therapy of cancer,15 hepatic fibrosis16 and cerebral ischaemic stroke.17 Additionally, polymeric vectors have demonstrated great potential in improving the delivery efficiency of small interfering RNA (siRNA).18-20 Nevertheless, siRNA nanomedicine-mediated atherosclerosis treatment has been rarely reported thus far. Previous studies have shown that active targeted ligands have an important role in guiding the atherosclerotic plaque homing of nanomedicines.21,22 In this study, treatment of atherosclerosis was attempted via targeted delivery of antiPAK1 siRNA to macrophages using a CD36 antibody-decorated nanomedicine (Figure 1). The polymer for siRNA complexation was biodegradable poly(aspartic acid) grafted 4


Page 4 of 33

Page 5 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with low-molecular-weight polyethyleneimine (PAsp(-g-PEI)), which was employed to reduce the cumulative cationic toxicity of nondegradable high-molecular-weight PEI.23,24 It was hoped that PAK1 gene silencing would suppress the expression of PAK1-related pro-inflammatory factors such as MCP-1 and IL-6, leading to efficient atherosclerosis treatment. Moreover, the nanomedicine was expected to reduce the oxLDL uptake of macrophages due to the downregulation of the CD36 receptor, which may further suppress the progression of atherosclerosis. Both in vitro and in vivo studies were performed to explore the potential of this CD36-targeted polymeric nanomedicine incorporating anti-PAK1 siRNA for atherosclerosis treatment.

2. Experimental and Methods 2.1. Materials. The following reagents were purchased from Sigma-Aldrich and used as received: α-methoxy-ε-hydroxy-poly(ethylene glycol) (mPEG-OH, Mn = 2 kDa), p-toluenesulfonyl chloride (TsCl), methyl p-toluenesulphonate (MPTS), 2-ethyl2-oxazoline (EtOx), dicyclohexyl-carbodiimide (DCC), N-hydroxysuccinimide (NHS), anhydrous dimethyl sulfoxide (DMSO), anhydrous dimethylformamide (DMF). A dialysis bag with a molecular weight cut off (MWCO) of 3.5 kDa was purchased from Shanghai Green Bird Technology Development Co., Ltd., China. Chloroform (CHCl3), acetonitrile (CH3CN), acetic ether, petroleum ether, and dichloromethane (DCM, CH2Cl2) were dried over CaH2 and then distilled under ambient pressure. Diethyl ether of analytical grade was purchased from Guangzhou Chemical Reagent Factory, China. N-carboxyanhydride of β-benzyl-L-aspartate (BLA-NCA) and mPEG-NH2 were 5



synthesized as previously reported.19 2.2. Nanomedicine Preparation. To synthesize the antibody modified delivery vector, excessive tris(2-carboxyethyl)phosphine (TCEP, 50 μg) was added into 10 μL of CD36 single-chain variable fragment (scFv) antibody (10 μg, Santa Cruz, CA, USA) to obtain free sulfhydryl. After a 2-h incubation at 4 ○C, the TCEP was removed by washing three times with phosphate-buffered saline (PBS) containing 0.5 M ethylenediamine tetra-acetic acid (EDTA) using ultrafiltration (MWCO: 10 kDa). Then, 10 μg of mPEG-PAsp(-g-PEI)-Mal dissolved in 10 μL of PBS containing 0.5 M EDTA was added into the antibody solution. Afterwards, the solution was incubated overnight at 4 ○C to get CD36-targeted polymer. For the polyplex preparation, predetermined amounts of polymer (CD36-targeted polymer or non-targeted polymer) and siRNA dissolved in sterile water were mixed according to N/P ratios. The mixtures were vigorously vibrated for 30 seconds and kept at room temperature for 30 minutes to form polyplexes. The CD36 targeted polyplexes and non-targeted polyplexes were denoted as T-PPs and N-PPs, respectively. 2.3. Agarose gel electrophoresis. The polyplexes formed from polymer and scrambled siRNA (SCR, Genepharmas, China) at various N/P radios were prepared in a final volume of 10 μL containing 30% glycerol and were loaded into 1.5% agarose gels (Biowest, USA) with 0.1 μL/mL GoldView (Vazyme, China). After the gels were run with tris-acetate (TAE) buffer at 120 V for 15 min, siRNA motion retardation was visualized by irradiation with UV light with a DNR Bio-Imaging System (DNR BioImaging System Ltd, Israel). 6


Page 6 of 33

Page 7 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.4. Cell transfection. RAW 264.7 cells were cultured in petri dishes at a density of 2×104 cells per well and incubated overnight. After treatment with 80 μg/mL oxLDL (Yiyuan, Guangzhou, China) or culture medium (the negative control group) for 24 h, the cells were incubated with polyplexes loaded with Cy3-SCR for 6 h at a final SCR concentration of 100 nM. Specifically, the cells of the competitive group were pretreated with excess CD36 antibody (Santa Cruz, USA) to saturate CD36 receptors on the surface of macrophages for 12 h and then co-incubated with T-PPs for 6 h. After fixing with 4% paraformaldehyde for 5 min and staining with DAPI (1 μg/mL in PBS) for 2 min, the samples were observed under confocal laser scanning microscopy (CLSM, Carl Zeiss, German). Moreover, the transfection efficiency of different polyplexes was quantitatively detected by flow cytometry analysis. The cells treated under the abovementioned protocol were harvested and resuspended in 0.5 mL of binding buffer (BD Medical Technology, USA), and then Cy3-positive cells were detected by flow cytometry (Gallios, Beckman, USA). 2.5. In vitro RNA interference assessment. RAW 264.7 cells were grown to confluence and synchronized in serum-free DMEM for 12 h; then, the medium was replaced with complete medium containing 80 μg/mL oxLDL for an additional incubation of 24 h. Cells incubated with complete medium without oxLDL were used as a negative group. Subsequently, the cells were co-incubated with anti-PAK1 siRNAloaded T-PPs or N-PPs in serum-free DMEM for another 6 h. Cells of the competitive group were pre-treated with excess CD36 antibody for 12 h and then co-incubated with 7



Page 8 of 33

T-PPs for another 6 h. Anti-PAK1 siRNA was purchased from Genpharma (Soochow, China). The sequences of anti-PAK1 siRNA were listed as: sense 5'GCUUCAGGCACAGUGUAUATT-3',

anti-sense

5'-

UAUACACUGUGCCUGAAGCTT-3'. For the qRT-PCR assay, the total cellular RNA of each group was extracted using TRIzol (Invitrogen, USA) according to the manufacturer’s recommended protocol and transcribed into cDNA with a reverse transcription kit (Takara, Japan). Two microlitres of cDNA as template was used for qRT-PCR with PAK1 primers and Fast Start Universal SYBR Green Master (ROX) reagents (Roche, Switzerland) according to the protocol using the StepOne Plus system (Applied Biosystems, USA). Quantitative measurement was achieved using the 2-ΔΔCt method, and the expression of β-actin was used as an internal control. The PCR prime sequences of PAK1 and β-actin are listed from 5' to 3': PAK1 forward GAAACACCAGCACTATGATTGGA, PAK1 reverse ATTCCCGTAAACTCCCCTGTG; β-actin forward GGCTGTATTCCCCTCCATCG, β-actin reverse CCAGTTGGTAACAATGCCATGT. For the western blot assay, total protein was extracted from RAW 264.7 cells receiving different treatments with RIPM lysis (Beyotime, Shanghai, China) according to the recommended protocol. Forty micrograms of each protein samples were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (MERCK MILLIPORE ， Canada). After blocking with 5% non-fat milk for 2 h at 25 °C, the membranes were incubated with anti-α-tubulin antibody (1:1000 dilution, Beyotime, 8


Page 9 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


China) or anti-PAK1 antibody (1:1000 dilution, Cell Signaling Technology, USA) overnight at 4 °C.α-Tubulin was used as an internal standard protein for normalization. Horseradish peroxidase (HRP)-conjugated IgG (Santa Cruz, USA) was used to amplify the signals. Protein signals were detected using a chemiluminescence kit (KeyGEN, China). 2.6. CD36 expression measurement. RAW 264.7 cells were cultured in petri dishes at a density of 2×104 cells per dish and incubated overnight. After treatment with oxLDL and polyplexes, cells were washed with PBS three times, fixed in 4% paraformaldehyde for 5 min, stained with CD36 antibody (Abcam, UK) overnight at 4 °C, and then stained with AF555-labelled second antibody for 1 h. Finally, cells were stained with DAPI for 2 min, and observed under CLSM. CD36 gene expression in each group receiving different nanomedicines was further tested at the mRNA and protein levels by qRT-PCR and western blot analysis, respectively. 2.7. The cellular uptake of oxLDL in macrophages. RAW 264.7 cells were seeded on cover glasses at 8×103 per well in 6-well plates and divided into six groups: negative (without oxLDL pretreatment), control, N-PPs, T-PPs, T-PPs complexing SCR, and competitive treatment group. After co-incubation, 20 μg/mL Dil-labelled oxLDL (Yiyuan, Guangzhou, China) was added into the medium for 3 h. Subsequently, cells were washed with PBS three times, fixed in 4% paraformaldehyde for 5 min, stained with DAPI for 2 min, and then observed by CLSM. 2.8. MCP-1 and IL-6 expression level detection. Brefeldin A at 10 μg/mL was added into each well followed by starvation for 8 h. RAW 264.7 cells were harvested, 9



Page 10 of 33

and 200 μL of BD Fc BlockTM (1:100 dilution) was added into each sample to block nonspecific staining for 30 min at 4 ○C. After treatment with permeabilization solution for 20 min at 4 ○C, cells were incubated with AF488-conjugated anti-mouse IL-6 (BD, USA) and PE-conjugated anti-mouse MCP-1 (BD, USA) for 30 min at 4 ○C. The fluorescence intensities of IL-6 and MCP-1 were detected using CytoFLEX (Beckman, USA). Additionally, the gene expression of IL-6 and MCP-1 in each group receiving different polyplexes was tested by qRT-PCR. The PCR prime sequences of IL-6 and MCP-1 were listed from 5' to 3': IL-6 forward TAGTCCTTCCTACCCCAATTTCC, IL-6

reverse

TTGGTCCTTAGCCACTCCTTC;

MCP-1

forward

TTAAAAACCTGGATCGGAACCAA,

MCP-1

reverse

GCATTAGCTTCAGATTTACGGGT;

β-actin

forward

GGCTGTATTCCCCTCCATCG;

β-actin

reverse

CCAGTTGGTAACAATGCCATGT. 2.9. Animal model. Homozygous apolipoprotein E deficient mice (ApoE-/-) were purchased from The Jackson Laboratory and housed at 24 h on a fixed 10/14-hour light/dark cycle. Male mice and female mice were crossed, and all offspring were genotyped using polymerase chain reaction (PCR) techniques; the primer sequences for ApoE-/-

mouse

genotyping

are

GCCTAGCCGAGGGAGAGCCG;

listed: wild-type

common

primer reverse

TGTGACTTGGGAGCTCTGCAGC; mutant reverse GCCGCCCCGACTGCATCT. All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Sun Yat-sen University and approved by the Animal 10


Page 11 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Ethics Committee of the People's Republic of China. ApoE-/- mice (8-week-old males) were fed on a western diet purchased from the Animal Center of Guangdong Province (Guangzhou, China). 2.10. In vivo MR Imaging and ex vivo fluorescence imaging. SPIO-labelled CD36targeted polymer (T-PPs/SPIO) or SPIO-labelled non-targeted polymer (N-PPs/SPIO) was intravenously injected into ApoE-/- mice fed a western diets for 8 weeks via the tail vein, and then the abdominal aortas of animals were imaged with a 3.0-T MR unit (Achieva, Philips Healthcare, Best, the Netherlands) and a 32-channel small animal coil. Mice underwent general anaesthesia with 1% pentobarbital sodium (50 mg/kg) and were imaged in the supine position at 3 h and 12 h after injection. Axial pelvic images were obtained using a two-dimensional turbo spin echo T2-weighted sequence. For fluorescence imaging, the ApoE-/- mice were sacrificed at 3 h and 12 h after receiving AF750-SCR-loaded N-PPs and T-PPs via intravenous injection. Then, the thoracic/abdominal aortas were separated and subjected to ex vivo fluorescence imaging (Carestream, USA). The laser excitation and emission of AF750 were 720 nm and 790 nm, respectively. Additionally, Cy3-SCR-loaded N-PPs or Cy3-SCR-loaded T-PPs were intravenously injected into ApoE-/- mice via the tail vein; then, the mice were sacrificed at 3 h and 12 h after polyplex administration, and aortic roots were subjected to frozen sectioning. The sections were stained with anti-CD31 antibody to label blood vessels and anti-CD36 antibody to label the overexpressed CD36 receptor on macrophages. Afterwards, the nuclei were stained with DAPI for 2 min. The samples were observed under CLSM to analyse the Cy3 distribution in aortic root sections. 11



2.11. Atherosclerotic lesion measurement. After 4 weeks of feeding on a western diet, mice were randomly grouped into the Control, N-PPs and T-PPs groups and treated with different nanomedicines via tail vein injection every three days; the siRNA dose was 400 μg/kg body weight. After treatment, the mouse atherosclerotic lesion measurement protocol was conducted as described previously.25 Briefly, mice receiving different treatments were sacrificed and perfused with PBS. Thoracic/abdominal aortas were separated from fat and other tissues and stained with Oil-red O for 30 min. Pictures of Oil red-O stained aortas were taken using a Nikon digital camera (Tokyo, Japan). Meanwhile, the intimal atherosclerotic lesion areas per cross section of aortic root were used to evaluate atherosclerosis severity via Image-Pro Plus version 6.0 software (Media Cybernetics Inc.). 2.12. Immunofluorescence and immunohistochemistry assay. Frozen sections of aortic roots obtained from the mice receiving different treatments were incubated with anti-PAK1 primary antibody (1:100 dilution, Abcam, UK) and anti-Mac-3 primary antibody (1:100 dilution, Abcam, UK) overnight at 4 ○C, then incubated with Cy3labelled secondary antibody (1:100 dilution, Life Technologies, USA) for PAK1 and AF488-labelled secondary antibody (1:100 dilution, Life Technologies, USA) for Mac3 at room temperature for 1 h. After staining with DAPI to label nuclei, the samples were observed under CLSM. Furthermore, paraffin sections of aortic roots were incubated with the anti-Mac-3 antibody (1:100, Santa Cruz, USA), anti-MCP-1 antibody (1:100 dilution, Santa Cruz, USA) and anti-IL-6 antibody (1:100 dilution, Santa Cruz, USA) at 4 ○C overnight, 12


Page 12 of 33

Page 13 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


followed by incubation with a secondary antibody at 37 ○C for 1 h. Positive immunostaining was visualized by using the diaminobenzidine substrate (DBA, Thermo, USA) for 1.5 min, and then haematoxylin was utilized to stain nuclei for 30 seconds. The samples were observed under a BX51 microscope. 2.13. Statistics. Significant differences between the two groups were analysed by unpaired Student's t test, and differences between the data of multiple groups were analysed using one-way ANOVA with the Bonferroni correction (GraphPad Prism 5.0, USA). All experiments were performed at least three times. The data are expressed as the means ± SD. P < 0.05 was considered statistically significant.

3. Results and Discussion 3.1. siRNA complexation evaluated by agarose gel electrophoresis. After the polymers were synthesized via multi-step reactions (Scheme S1) and characterized by 1H

NMR, FT-IR and GPC (Figure S1), agarose gel electrophoresis was performed to

analyse the siRNA complexation ability of mPEG-PAsp-(g-PEI) and mPEG-PAsp-(gPEI)-CD36Ab. It is well-known that the N/P ratio plays an important role in the complexation of siRNA with cationic polymers, and insufficiently complexed siRNA will migrate towards the anode only at low N/P values. As shown in Figure 2A, complete retardation of siRNA migration was achieved at the N/P ratio of 3.2 for the two polymers, indicating complete siRNA complexation. CD36 antibody conjugation appeared to have no effect on the complexation of siRNA with polymer. To ensure good siRNA protection, an N/P ratio of 4.8 was chosen for subsequent experiments. 13



The CD36 antibody targeted and non-targeted polyplexes, called nanomedicines, were denoted as T-PPs and N-PPs, respectively. 3.2. Characterization of siRNA nanomedicines. It has been reported that an appropriate size, i.e. less than 200 nm, is crucial for a nanomedicine to cross the injured blood-vessel wall and further target macrophages in plaques.25,26 As detected by dynamic light scattering (DLS), the formed N-PPs and T-PPs showed average hydrodynamic diameters of 112.9 ± 14.3 nm and 129.8 ± 23.9 nm, respectively, which were considered suitable for accumulation in plaques. In addition, the zeta potentials were detected as 12.03 ± 1.03 mV for N-PPs and 10.50 ± 2.74 mV for T-PPs (Figure 2B), indicating complete complexation and good protection of siRNA.19,20 Additionally, the N-PPs and T-PPs both exerted fairly constant particle sizes within 24 h (Figure S2), indicating the polyplexes were stable under physiological conditions. Moreover, the morphology and size distribution of the nanomedicines were analysed by TEM. As shown in Figure 2C, the T-PPs and N-PPs both showed spherical structures and uniform particle sizes approximately 100 nm, which were in line with the results detected by DLS. These findings indicated that the targeted and non-targeted nanomedicines both possessed similar properties in terms of particle size and zeta potential, which may endow N-PPs and T-PPs with similar fates in vivo. 3.3. CD-36-mediated cell uptake of nanomedicine. First, an MTT assay was conducted to evaluate the cytotoxicity of the polymers and nanomedicines. As shown in Figure S3A, RAW 264.7 cells after 48 h of co-incubation showed a high viability of 85.34%, even at high polymer concentrations up to 250 μg/mL. Meanwhile, the 14


Page 14 of 33

Page 15 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cytotoxicity of polyplexes increased along with the increase in the N/P ratio when loading the same amount of SCR (Figure S3B and C), which was most likely due to the increase in the positive surface charge. Nevertheless, the cell viability remained above 80% even when the N/P ratio reached 24, indicating the low cytotoxicity of the polyplexes. CLSM and flow cytometry assays were carried out to evaluate the CD-36mediated internalization of nanomedicines into macrophages in vitro. As shown in Figure 3A, after co-incubation for 6 h, pretreatment with oxLDL showed no effect on the cellular uptake of N-PPs. In contrast, the T-PPs group showed obviously enhanced cellular uptake after treatment with oxLDL, which could be attributed to the CD36 receptor up-regulation on macrophages induced by oxLDL exposure.27,28 Meanwhile, the flow cytometry results were in line with the results of the CLSM test (Figure S43). To confirm that the enhanced cellular uptake of T-PPs was truly mediated by the CD36 pathway, a competitive group was introduced. Pre-treating the oxLDL-induced macrophages with excessive CD36 antibody to block the receptor obviously reduced the internalization of T-PPs relative to the T-PPs-oxLDL(+) group (Figure 3A). The results implied that the CD36 antibody-modified nanomedicine could efficiently deliver siRNA into macrophages suffering from oxLDL exposure in plaques. 3.4. Nanomedicine-mediated gene silencing of PAK1. Since the PAK1 gene plays crucial roles in the progression of atherosclerosis,8 it is a useful target for drug treatment. As evaluated by qRT-PCR and western blot assays (Figure 3B, C and D), the expression levels of PAK1 mRNA and protein in RAW 264.7 cells were significantly increased after cell exposure to oxLDL for 24 h (control group), which indicated that PAK1 was 15



upregulated during the formation of foam cells at atherosclerotic plaques. However, the upregulation of PAK1 expression at both the mRNA and protein levels was impeded when the RAW 264.7 cells were treated with T-PPs loaded with anti-PAK1 siRNA. The mRNA and protein expression levels of PAK1 in the T-PPs treatment group decreased to approximately 40% and 65% compared with those of the control and NPPs groups, respectively. In addition, after the CD36 receptor was saturated with free antibody, the PAK1 silencing efficiency of T-PPs significantly decreased. These results provided strong evidence that the nanomedicine efficiently downregulated PAK1 gene expression in macrophages in vitro. 3.5. Inhibition of oxLDL uptake through CD36 downregulation. An early lesion in atherosclerosis is characterized by the sub-endothelial deposition of oxLDL.9,29 Scavenger receptors, e.g., CD36 and SR-A, have been found to play a crucial role in the oxLDL uptake of macrophages leading to the formation of foam cells.30,31 Hence, inhibition of CD36 expression is a promising way to prevent macrophages from absorbing oxLDL and further suppress the development of atherosclerosis.32,33 As assessed by qRT-PCR and western blot assay, after treating the cells with T-PPs, the up-regulation of CD36 in cells receiving oxLDL pretreatment was not detected (Figure 4 A-C). The obvious down-regulation of CD 36 was attributed to efficient PAK1 silencing due to nanomedicine treatment.13 Then, RAW 264.7 cells were co-incubated with Dil-labelled oxLDL to evaluate uptake inhibition through the down-regulation of CD36. As shown in Figure 4D, the intercellular Dil-oxLDL fluorescence in T-PPs-treated cells was much lower than that 16


Page 16 of 33

Page 17 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in other cells. In addition, the Dil-oxLDL fluorescence intensity of T-PPs-treated cells was similar to that of negative control cells (Figure S5). Moreover, oxLDL decreased obviously in macrophages receiving treatment with T-PPs in complex with SCR, indicating competitive inhibition between the CD36 antibody-modified nanomedicine and oxLDL. These results provided evidence of the lowered uptake of oxLDL in macrophages with PAK1 gene silencing, which should further suppress the development of atherosclerosis. 3.6. The suppression of inflammatory factors upon PAK-1 gene silencing. It has been reported that the chemokine MCP-1 and pro-inflammatory cytokine IL-6 are two major PAK1-related factors affecting the progression of atherosclerosis [34]. Therefore, the expression of MCP-1 and IL-6 was measured in RAW 264.7 cells treated with TPPs and N-PPs by qRT-PCR and flow cytometry analyses. As shown in Figure 5 A&B and Figure S6, both T-PPs-treated and N-PPs-treated RAW 264.7 cells exhibited obviously decreased expression of MCP-1 and IL-6 as a result of the PAK1 silencing in macrophages in atherosclerotic plaques. The mechanism by which the PAK1 gene regulates MCP-1 and IL-6 expression can be attributed to the NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) signalling pathway, which is one of the most important signalling pathways affecting the expression of pro-inflammatory factors.35 3.7. In vivo targeting effect of nanomedicine to atherosclerosis plaques. It is important that a nanomedicine can accumulate in the targeting site. Magnetic resonance (MR) and fluorescence imaging studies were both conducted to track the nanomedicine 17



distribution in vivo. For fluorescence imaging, T-PPs and N-PPs loaded with AF750labelled SCR were tail vein-injected into ApoE-/- mice. At pre-determined time points, mice were sacrificed. Fluorescent photographs of ex vivo organs showed that T-PPs accumulated effectively in the arterial plaques at 3 h and 12 h. In addition, the injected T-PPs showed much higher fluorescence intensity than N-PPs, owing to the CD36mediated active targeted delivery of siRNA to plaques (Figure 6A). More evidence was obtained when observing the frozen sections of aortic roots under a confocal microscope after immunofluorescence staining. As shown in Figure 6B, the Cy3labelled polyplexes (red) tended to localize in macrophages (green, CD36-labelled) rather than endothelial cells (purple, CD31-labelled). Furthermore, MR imaging was utilized to track the nanomedicines, as fluorescence imaging failed to show the in vivo signals in plaques. The targeted polyplex T-PPs/SPIO and non-targeted polyplex N-PPs/SPIO possessed particle sizes and zeta potentials similar to those of T-PPs and N-PPs, respectively (Figure 6C and S7A). The polyplexes were injected into ApoE-/- mice via the tail vein, and the mice were anaesthetized at 3 h and 12 h after injection for MR imaging. As shown in Figure 6D, an obviously lower T2 signal was detected in aortic roots. In addition, T-PPs/SPIO accumulated in plaques more efficiently than N-PPs/SPIO, showing a significant difference at 3 h after injection without showing much difference in T2 values in the liver and spleen (Figure 6E). Prussian blue staining of aortic root sections showed enhanced SPIO accumulation after the injection of T-PPs/SPIO (Figure S7B). These results demonstrated that the CD36targeting strategy enhanced the efficiency of nanomedicine delivery to atherosclerotic 18


Page 18 of 33

Page 19 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


plaques. 3.8. In vivo anti-atherosclerosis of siRNA nanomedicines. ApoE-/- mice were treated with nanomedicines loaded with anti-PAK1 siRNA. After treatment for 4 weeks, the mice were sacrificed, and serial sections of aortic roots in each group were obtained. The split aortas were analysed via Oil red O-staining. As shown in Figure 7, the lipid deposits in atherosclerotic plaques which were stained red, were distributed in the aortic trees of the control group. After treatment with N-PPs and T-PPs, obvious reductions in plaques were observed. In comparison with the control group, the mice treated with T-NPs showed lesion areas decreased by 62.38% (Figure S8). The Oil red O-staining of aortic root sections showed consistent results (Figure 7, aortic roots). The therapeutic effect was attributed to an efficient down-regulation of the PAK1 gene. As revealed by immunofluorescence staining, PAK1 protein (red) in macrophages (green) receiving T-PPs treatment was significantly decreased (Figure S9). Immunohistochemistry staining with the Mac-3 antibody was performed to evaluate the recruitment of macrophages in atherosclerotic plaques. As shown in Figure 7, treatment with nanomedicines remarkably inhibited macrophage recruitment (Mac3-positive area, brown). In particular, the pathological lesions in the T-PPs group were alleviated more obviously than those in the N-PPs group (Figure S8). Meanwhile, the pro-inflammatory cytokines/chemokines, i.e., IL-6 and MCP-1,36-38 produced by foam cells to aggravate atherosclerosis, were distinctly down-regulated (Figure 7). The expression of MCP-1 and IL-6 on the aortic roots of T-PPs was decreased by 73.12% and 57.23%, respectively, compared with that in the control group (Figure S8). These 19



in vivo treatment results provided strong evidence that the CD36-mediated targeted delivery of anti-PAK1 siRNA to macrophages could effectively alleviate atherosclerosis via the joint effects of reduced oxLDL deposition and anti-inflammation.

4. Conclusion CD36 antibody-mediated targeted delivery of anti-PAK1 siRNA to macrophages was introduced for atherosclerosis therapy. The nanomedicine was based on a cationic polymer of PEG-PAsp(-g-PEI) with efficient siRNA complexation and low cytotoxicity. The nanomedicine accumulated in atherosclerotic plaques and was transfected into macrophages to silence the PAK1 gene effectively. Consequently, IL6 and MCP-1 expression was reduced, and concurrently, the deposition of oxLDL was decreased in macrophages, resulting in substantially alleviated atherosclerosis in both in vitro and in vivo models.

Conflicts of interest There are no conflicts to declare.

Acknowledgements This study was supported by the National Basic Research Program of China (2015CB755500), the National Natural Science Foundation of China (21805314, 81800426 and 31530023), the Natural Science Foundation of Guangdong Province (2014A030312018), and the Guangdong Innovative and Entrepreneurial Research 20


Page 20 of 33

Page 21 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Team Program (2013S086).

Supporting Information Synthesis and characterization of polymer in details; Detailed protocol of MTT assay, SPIO labelling of polyplexes, and prussian blue staining; 1H NMR, FT-IR spectra, and GPC data; Stability of N-PPs and T-PPs, MTT data, cytometry results of nanomedicinemediated delivery efficiency, prussian blue staining pictures of arotic root sections, and other statistics.

References: (1) Hansson, G. K.; Libby, P. The immune response in atherosclerosis: a double-edged sword. Nat. Rev. Immunol. 2006, 6, 508-519, DOI: 10.1038/nri1882. (2) Kwon, G. P.; Schroeder, J. L.; Amar, M. J.; Remaley, A. T.; Balaban, R. S. Contribution of macromolecular structure to the retention of low-density lipoprotein at arterial branch points. Circulation 2008, 117, 2919-2927, DOI: 10.1161/CIRCULATIONAHA.107.754614. (3) Li, A. C.; Glass, C. K. The macrophage foam cell as a target for therapeutic intervention. Nat. Med. 2002, 8, 1235-1242, DOI: 10.1038/nm1102-1235. (4) Mozaffarian, D.; Benjamin, E. J.; Go, A. S.; Arnett, D. K.; Blaha, M. J.; Cushman, M.; Das, S. R.; Ferranti, S. de; Despres, J. P.; Fullerton, H. J.; Howard, V. J.; Huffman, M. D.; Isasi, C. R.; Jimenez, M. C.; Judd, S. E.; Kissela, B. M.; Lichtman, J. H.; Lisabeth, L. D.; Liu, S.; Mackey, R. H.; Magid, D. J.; McGuire, D. K.; Mohler, E. R.; Moy, C. S.; Muntner, P.; Mussolino, M. E.; Nasir, K.; Neumar, R. W.; Nichol, G.; Palaniappan, L.; Pandey, D. K.; Reeves, M. J.; Rodriguez, C. J.; Rosamond, W.; Sorlie, P. D.; Stein, J.; Towfighi, A.; Turan, T. N.; Virani, S. S.; Woo, D.; Yeh, R. W.; Turner, M. B. Executive summary: heart disease and stroke statistics-2016 update: a report from the

American

Heart

Association.

Circulation

2016,

10.1161/CIR.0000000000000366. 21


133,

447-454,

DOI:


Page 22 of 33

(5) Prasad, K. Regression of hypercholesterolemic atherosclerosis in rabbits by secoisolariciresinol diglucoside

isolated

from

flaxseed.

Atherosclerosis

2008,

197,

34-42,

DOI:

10.1016/j.atherosclerosis.2007.07.043. (6) Griffin, B. A.; Freeman, D. J.; Tait, G. W.; Thomson, J.; Caslake, M. J.; Packard, C. J.; Shepherd, J. Role of plasma triglyceride in the regulation of plasma low density lipoprotein (LDL) subfractions: relative contribution of small, dense LDL to coronary heart disease risk. Atherosclerosis 1994, 106, 241-253, DOI: 10.1016/0021-9150(94)90129-5. (7) Werz, O.; Szellas D.; Steinhilber, D. Reactive oxygen species released from granulocytes stimulate 5‐lipoxygenase activity in a B-lymphocytic cell line. Eur. J. Biochem. 2000, 267, 12631269, DOI: 10.1046/j.1432-1327.2000.01000.x. (8) Robbesyn, F.; Garcia, V.; Auge, N.; Vieira, O.; Frisach, M. F.; Salvayre, R.; Negre-Salvayre, A. HDL counterbalance the proinflammatory effect of oxidized LDL by inhibiting intracellular reactive oxygen species rise, proteasome activation, and subsequent NF-κB activation in smooth muscle cells. FASEB J. 2003, 17, 743-745, DOI: 10.1096/fj.02-0240fje. (9) Hansson, G. K.; Hermansson, A. The immune system in atherosclerosis. Nat. Immunol. 2011, 12, 204-212, DOI: 10.1038/ni.2001. (10) Martin, C. A.; Dorf, M. E. Differential regulation of lnterleukin-6, macrophage inflammatory protein-1, and JE/MCP-1 cytokine expression in macrophage cell lines. Cell Immunol. 1991, 135, 245-258, DOI: 10.1016/0008-8749(91)90269-H. (11) Berman, J. P.; Farkouh, M. E.; Rosenson, R. S. Emerging anti-inflammatory drugs for atherosclerosis.

Expert

Opin.

Emerg.

Drugs

2013,

18,

193-205,

DOI:

10.1517/14728214.2013.801453. (12) Puato, M.; Faggin, E.; Rattazzi, M.; Zambon, A.; Cipollone, F.; Grego, F.; Ganassin, L.; Plebani, M.; Mezzetti, A.; Pauletto, P. Atorvastatin reduces macrophage accumulation in atherosclerotic plaques: a comparison of a nonstatin-based regimen in patients undergoing carotid endarterectomy. Stroke 2010, 41, 1163-1168, DOI: 10.1161/STROKEAHA.110.580811. (13) Hullinger, T. G.; Panek, R. L.; Xu, X.; Karathanasis, S. K. p21-activated Kinase-1 (PAK1) Inhibition of the Human Scavenger Receptor Class B, Type I promoter in macrophages is independent of PAK1 kinase activity, but requires the GTPase-binding domain. J. Biol. Chem. 2001, 22


Page 23 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


276, 46807-46814, DOI: 10.1074/jbc.M103176200. (14) Jhaveri, K. A.; Debnath, P.; Chernoff, J.; Sanders, J.; Schwartz, M. A. The role of p21activated kinase in the initiation of atherosclerosis. BMC Cardiovasc. Disord. 2012, 12, 55, DOI: 10.1186/1471-2261-12-55. (15) Coelho, T.; Adams, D.; Silva, A.; Lozeron, P.; Hawkins, P. N.; Mant, T.; Perez, J.; Chiesa, J.; Warrington, S.; Tranter, E.; Munisamy, M.; Falzone, R.; Harrop, J.; Cehelsky, J.; Bettencourt, B. R.; Geissler, M.; Butler, J. S.; Sehgal, A.; Meyers, R. E.; Chen, Q.; Borland, T.; Hutabarat, R. M.; Clausen, V. A.; Alvarez, R.; Fitzgerald, K.; Gamba-Vitalo, C.; Nochur, S. V.; Vaishnaw, A. K.; Sah, D. W.; Gollob, J. A.; Suhr, O. B. Safety and efficacy of RNAi therapy for transthyretin amyloidosis. New Engl. J. Med. 2013, 369, 819-829, DOI: 10.1056/NEJMoa1208760. (16) Guo, Y.; Wang, J.; Zhang, L.; Shen, S.; Guo, R.; Yang, Y.; Chen, W.; Wang, Y.; Chen, G.; Shuai, X. Theranostical nanosystem‐mediated identification of an oncogene and highly effective therapy in hepatocellular carcinoma. Hepatology 2016, 63, 1240-1255, DOI: 10.1002/hep.28409. (17) Li, Z.; Chen, X.; Zhang, X.; Ren, X.; Chen, X.; Cao, J.; Zang, W.; Liu, X.; Guo, F. Small interfering RNA targeting Dickkopf-1 contributes to neuroprotection after intracerebral hemorrhage in rats. J. Mol. Neurosci. 2017, 61, 279-288, DOI: 10.1007/s12031-017-0883-3. (18) Vader, P.; J van der Aa, L.; Storm, G.; Schiffelers, R. M.; Engbersen, J. F. Polymeric carrier systems

for

siRNA

delivery.

Curr.

Top.

Med.

Chem.

2012,

12,

108-119,

DOI:

10.2174/156802612798919123. (19) Wang, Y.; Xiao, H.; Fang, J.; Yu, X.; Su, Z.; Cheng, D.; Shuai, X. Construction of negatively charged and environment-sensitive nanomedicine for tumor-targeted efficient siRNA delivery. Chem. Commun. 2016, 52, 1194-1197, DOI: 10.1039/c5cc09181k. (20) Li, J.; Yu, X.; Wang, Y.; Yuan, Y.; Xiao, H.; Cheng, D.; Shuai, X. A reduction and pH dualsensitive polymeric vector for long-circulating and tumor-targeted siRNA delivery. Adv. Mater. 2014, 26, 8217-8224, DOI: 10.1002/adma.201403877. (21) Beldman, T. J.; Senders, M. L.; Alaarg, A.; Perez-Medina, C.; Tang, J.; Zhao, Y.; Fay, F.; Deichmoller, J.; Born, B.; Desclos, E.; N van der Wel, N.; Hoebe, R. A.; Kohen, F.; Kartvelishvily, E.; Neeman, M.; Reiner, T.; Calcagno, C.; Fayad, Z. A.; J de Winther, M. P.; Lutgens, E.; Mulder, W. J. M.; Kluza, E. Hyaluronan nanoparticles selectively target plaque-associated macrophages and 23



Page 24 of 33

improve plaque stability in atherosclerosis. ACS Nano 2017, 11, 5785-5799, DOI: 10.1021/acsnano.7b01385. (22) Qiao, R.; Qiao, H.; Zhang, Y.; Wang, Y.; Chi, C.; Tian, J.; Zhang, L.; Cao, F.; Gao, M. Molecular imaging of vulnerable atherosclerotic plaques in vivo with osteopontin-specific upconversion nanoprobes. ACS Nano 2017, 11, 1816-1825, DOI: 10.1021/acsnano.6b07842. (23) Fischer, D.; Li, Y.; Ahlemeyer, B.; Krieglstein, J.; Kissel, T. In vitro cytotoxicity testing of polycations: influence of polymer structure on cell viability and hemolysis. Biomaterials 2003, 24, 1121-1131, DOI: 10.1016/S0142-9612(02)00445-3. (24) Godbey, W. T.; Wu, K. K.; Mikos, A. G. Poly(ethylenimine) and its role in gene delivery. J. Controlled Release 1999, 60, 149-160, DOI: 10.1016/S0168-3659(99)00090-5. (25) Mitani, Y.; Sawada, H.; Hayakawa, H.; Aoki, K.; Ohashi, H.; Matsumura, M.; Kuroe, K.; Shimpo, H.; Nakano, M.; Komada, Y. Elevated levels of high-sensitivity C-reactive protein and serum amyloid-A late after Kawasaki disease: association between inflammation and late coronary sequelae

in

Kawasaki

disease.

Circulation

2005,

111,

38-43,

DOI:

10.1161/01.CIR.0000151311.38708.29. (26) Kamaly, N.; Fredman, G.; Subramanian, M.; Gadde, S.; Pesic, A.; Cheung, L.; Fayad, Z. A.; Langer, R.; Tabas, I.; Farokhzad, O. C. Development and in vivo efficacy of targeted polymeric inflammation-resolving nanoparticles. Proc. Natl. Acad. Sci., U.S.A. 2013, 110, 6506-6511, DOI: 10.1073/pnas.1303377110. (27) Ta, H. T.; Truong, N. P.; Whittaker, A. K.; Davis, T. P.; Peter, K. The effects of particle size, shape, density and flow characteristics on particle margination to vascular walls in cardiovascular diseases. Expert Opin. Drug Deliv. 2018, 15, 33-45, DOI: 10.1080/17425247.2017.1316262. (28) McClelland, S.; Cox, C.; O'Connor, R.; de Gaetano, M.; McCarthy, C.; Cryan, L.; Fitzgerald, D.; Belton, O. Conjugated linoleic acid suppresses the migratory and inflammatory phenotype of the

monocyte/macrophage

cell.

Atherosclerosis

2010,

211,

96-102,

DOI:

10.1016/j.atherosclerosis.2010.02.003. (29) Guy, R. A.; Maguire, G. F.; Crandall, I.; Connelly, P. W.; Kain, K. C. Characterization of peroxynitrite-oxidized low density lipoprotein binding to human CD36. Atherosclerosis 2001, 155, 19-28, DOI: 10.1016/S0021-9150(00)00524-4. 24


Page 25 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(30) Legein, B.; Temmerman, L.; Biessen, E. A.; Lutgens, E. Inflammation and immune system interactions in atherosclerosis. Cell Mol. Life Sci. 2013, 70, 3847-3869, DOI: 10.1007/s00018-0131289-1. (31) Park, Y. M. CD36, a scavenger receptor implicated in atherosclerosis. Exp. Mol. Med. 2014, 46, e99, DOI: 10.1038/emm.2014.38. (32) Makinen, P. I.; Lappalainen, J. P.; Heinonen, S. E.; Leppanen, P.; Lahteenvuo, M. T.; Aarnio, J. V.; Heikkila, J.; Turunen, M. P.; Yla-Herttuala, S. Silencing of either SR-A or CD36 reduces atherosclerosis in hyperlipidaemic mice and reveals reciprocal upregulation of these receptors. Cardiovasc. Res. 2010, 88, 530-538, DOI: 10.1093/cvr/cvq235. (33) Han, J.; Zhou, X.; Yokoyama, T.; Hajjar, D. P.; GottoJr, A. M.; Nicholson, A. C. Pitavastatin downregulates expression of the macrophage type B scavenger receptor, CD36. Circulation 2004, 109, 790-796, DOI: 10.1161/01.CIR.0000112576.40815.13. (34) Bao, Y.; Wang, L.; Xu, Y.; Yang, Y.; Wang, L.; Si, S.; Cho, S.; Hong, B. Salvianolic acid B inhibits macrophage uptake of modified low density lipoprotein (mLDL) in a scavenger receptor CD36-dependent

manner.

Atherosclerosis

2012,

223,

152-159,

DOI:

10.1016/j.atherosclerosis.2012.05.006. (35) Carr, M. W.; Roth, S. J.; Luther, E.; Rose, S. S.; Springer, T. A. Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant. Proc. Natl. Acad. Sci., U.S.A. 1994, 91, 36523656, DOI:10.1073/pnas.91.9.3652. (36) Kim, S.; Joo, Y. E. Theaflavin inhibits LPS-induced IL-6, MCP-1, and ICAM-1 expression in bone marrow-derived macrophages through the blockade of NF-κB and MAPK signaling pathways. Chonnam. Med. J. 2011, 47, 104-110, DOI:10.4068/cmj.2011.47.2.104. (37) Ali, Z. A.; Bursill, C. A.; Douglas, G.; McNeill, E.; Papaspyridonos, M.; Tatham, A. L.; Bendall, J. K.; Akhtar, A. M.; Alp, N. J.; Greaves, D. R.; Channon, K. M. CCR2-mediated antiinflammatory effects of endothelial tetrahydrobiopterin inhibit vascular injury-induced accelerated

atherosclerosis.

Circulation

2008,

118,

S71-S77,

DOI:

10.1161/CIRCULATIONAHA.107.753558. (38) Abderrazak, A.; Couchie, D.; Mahmood, D. F.; Elhage, R.; Vindis, C.; Laffargue, M.; Mateo, V.; Buchele, B.; Ayala, M. R.; El Gaafary, M.; Syrovets, T.; Slimane, M. N.; Friguet, B.; Fulop, T.; 25



Simmet, T.; El Hadri, K.; Rouis, M. Anti-inflammatory and antiatherogenic effects of the NLRP3 inflammasome inhibitor arglabin in ApoE2.Ki mice fed a high-fat diet. Circulation 2015, 131, 10611070, DOI: 10.1161/CIRCULATIONAHA.114.013730.

26


Page 26 of 33

Page 27 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figures and captions

Figure 1. Schematic illustration of the formation of atherosclerotic plaques and the in vivo therapeutic mechanism of the targeted siRNA nanomedicine.

27



Figure 2. (A) Electrophoretic mobility of siRNA in agarose gel after complexing with polymer to form non-targeted polyplexes (N-PPs) and targeted polyplexes (T-PPs) at various N/P ratios. (B) The particle sizes and zeta potentials of N-PPs and T-PPs formed at an N/P ratio of 4.8 (mean ± SD, n = 5). (C) Transmission electron microscopy (TEM) images of N-PPs and T-PPs stained with uranyl acetate. The scale bars represent 200 nm.

28


Page 28 of 33

Page 29 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. (A) Confocal microscope pictures demonstrated that T-PPs showed an obvious effective internalization ability in RAW 264.7 cells after treatment with oxLDL. The scale bars represent 20 μm, and the co-incubation time is 6 h. PAK1 gene expression in treated RAW 264.7 cells was evaluated by real-time PCR (B) and western blot assay (C, D). The “negative” group without the oxLDL treatment was normalized as 100%. *P < 0.05 and **P < 0.01.

29



Page 30 of 33

Figure 4. CD36 gene expression in RAW 264.7 cells after treatment with siRNA nanomedicines evaluated by real-time PCR (A) and western blot assay (B). In (A) and the statistical analysis of the western blots (C), the “negative” group was normalized as 100%. *P < 0.05 and

**P

< 0.01. (D)

Confocal microscope pictures showed evidence that the oxLDL uptake by RAW 264.7 cells was reduced effectively by treatment with siRNA nanomedicine. The scale bars represent 20 μm.

Figure 5. The mRNA levels of IL-6 (A) and MCP-1 (B) in the RAW 264.7 cells after treatment with siRNA nanomedicines as detected by real-time PCR. The co-incubation time was 6 h, and the 30


Page 31 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


siRNA dose was 100 nM. *P < 0.05, **P < 0.01 and ***P < 0.001.

Figure 6. (A) Ex vivo fluorescence imaging of the aortas at different time points after mice received tail vein injections of AF750-SCR-loaded nanomedicines. (B) The distribution of siRNA nanomedicines in atherosclerotic plaque sections measured by confocal 3 or 12 h after injection. CD31: marker of endothelial cells; CD36: marker of foam cells. (C) TEM images show evidence of successful labelling of SPIO in N-PPs and T-PPs. The scale bars represent 100 nm. (D) Magnetic resonance imaging (MRI) pictures of plaques at different time points after mice received NPPs/SPIO and N-PPs/SPIO via tail vein injection. (E) Statistics for T2 values in plaques, liver and 31



spleen. **P < 0.01 compared with the N-PPs group at the same time point.

Figure 7. The effect of anti-PAK1 siRNA treatment on atherosclerotic development in ApoE-/- mice (n = 8). The aortic trees and aortic roots sections were stained by Oil red O, and Mac-3, MCP-1 and IL-6 expression on aortic roots were visualized by immunohistochemistry after mice were treated with siRNA nanomedicines. siRNA dose: 400 μg/kg body weight. The scale bars represent 200 μm in “Aortic roots” and 50 μm in immunohistochemical pictures, respectively.

32


Page 32 of 33

Page 33 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For Table of Contents Use Only

Polymeric vector-mediated targeteding delivery of anti-PAK1 siRNA to macrophages for efficient atherosclerosis treatment

Teng Wu, Hong Xiao, Liejing Lu, Yali Chen, Yong Wang,* Wenhao Xia, Ming Long, Jun Tao,* Jun Shen, and Xintao Shuai*

33


Polymeric vector-mediated targeted delivery of anti-PAK1 siRNA to

Recommend Documents