Polymorphism of FtsZ Filaments on Lipid Surfaces: Role of Monomer

Article pubs.acs.org/Langmuir

Polymorphism of FtsZ Filaments on Lipid Surfaces: Role of Monomer Orientation Mario Encinar,†,‡,§ Andrew V. Kralicek,§,∥ Ariadna Martos,⊥ Marcin Krupka,# Sandra Cid,# Alvaro Alonso,† Ana, I. Rico,# Mercedes Jiménez,∇ and Marisela Vélez*,†,○ †

Instituto de Catálisis y Petroleoquímica, CSIC, Marie Curie, 2, Cantoblanco, 28049 Madrid, Spain The New Zealand Institute for Plant & Food Research Limited, Private Bag 92169, Auckland, New Zealand ⊥ Max Planck Institute of Biochemistry, Am Klopferspitz 18, D-82152 Martinsried, Munich, Germany # Centro Nacional de Biotecnología, CSIC, Darwin 3, 28049 Madrid, Spain ∇ Centro de Investigaciones Biológicas, CSIC, Ramiro de Maeztu 9, 28040 Madrid, Spain ○ Instituto Madrileño de Estudios Avanzados en Nanociencia, Ciudad Universitaria de Cantoblanco, Faraday, 9, 28049 Madrid, Spain ∥

S Supporting Information *

ABSTRACT: FtsZ is a bacterial cytoskeletal protein involved in cell division. It forms a ringlike structure that attaches to the membrane to complete bacterial division. It binds and hydrolyzes GTP, assembling into polymers in a GTP-dependent manner. To test how the orientation of the monomers affects the curvature of the filaments on a surface, we performed site-directed mutagenesis on the E. coli FtsZ protein to insert cysteine residues at lateral locations to orient FtsZ on planar lipid bilayers. The E93C and S255C mutants were overproduced, purified, and found to be functionally active in solution, as well as being capable of sustaining cell division in vivo in complementation assays. Atomic force microscopy was used to observe the shape of the filament fibers formed on the surface. The FtsZ mutants were covalently linked to the lipids and could be polymerized on the bilayer surface in the presence of GTP. Unexpectedly, both mutants assembled into straight structures. E93C formed a well-defined lattice with monomers interacting at 60° and 120° angles, whereas S255C formed a more open array of straight thicker filament aggregates. These results indicate that filament curvature and bending are not fixed and that they can be modulated by the orientation of the monomers with respect to the membrane surface. As filament curvature has been associated with the force generation mechanism, these results point to a possible role of filament membrane attachment in lateral association and curvature, elements currently identified as relevant for force generation.

■

membrane is sensitive to the type of underlying lipids,8 and the orientation of the protein on the membrane determines the membrane deformation observed. It has been described that artificially membrane-bound FtsZ generated either convex bulges or concave depressions in the membrane of giant unilamellar vesicles depending on the position of the membrane anchor on FtsZ.4,9 To understand in more detail the effect of the protein orientation on the curvature and shape of the filaments on a lipid surface, we have developed a strategy based on covalently anchoring single cysteine mutants of E. coli (EcFtsZ) proteins to maleimide-modified lipids included on a planar lipid bilayer. As EcFtsZ does not contain any cysteines,10 the location of the introduced cysteine in the mutant will determine the orientation of the protein on the surface. The fluidity of the underlying lipid membrane allows for rearrangement of the

INTRODUCTION FtsZ is a bacterial cytoskeletal protein that plays an essential role in cell division. It is a soluble protein with GTPase activity that attaches to the inner cytoplasmic membrane through its interaction with other proteins, such as FtsA or ZipA in Escherichia coli.1 FtsZ polymerizes into a ringlike structure and plays an important role in acting as a scaffold to recruit other proteins forming the division ring2 and exerting a force to drive cell constriction.3,4 In a living cell, FtsZ attachment to the membrane and its interaction with other proteins is likely to restrict and modulate polymer formation and, consequently, the force generated by the dynamic assembly of the protein. In vitro, the isolated protein forms linear polymers in the presence of guanosine 5′-triphosphate (GTP) that can condense into a large variety of higher-order structures depending on the medium conditions.5−7 Recent studies on reconstituted membrane systems have demonstrated that the structure of the polymers and the deformations induced in the membrane are indeed affected by the way they are anchored: The structure of FtsZ polymers anchored through ZipA to a planar lipid © 2013 American Chemical Society

Received: October 6, 2012 Revised: July 1, 2013 Published: July 9, 2013 9436

dx.doi.org/10.1021/la401673z | Langmuir 2013, 29, 9436−9446

Langmuir

Article

proteins upon GTP addition to form higher-order FtsZ structures. Each cysteine mutant is able to permit cell division in vivo in a complementation assay, showing they still retain the functional characteristics and interactions of EcFtsZ required for cell division. Restricted FtsZ orientation on the lipid surface has strong effects on the shape of the filaments formed. We conclude that the monomer orientation on the surface contributes significantly to the morphology of the functional polymer by exposing different flexible domains of the protein and by making available additional monomer interfaces that can contribute to the shaping of the final structures.

■

MATERIALS AND METHODS

Structural Analysis to Identify Surface Residues of EcFtsZ Protein for Mutation to Cysteines. A conservative approach was used to identify potential sites for cysteine mutagenesis to minimize problems with the expression, folding, and function of EcFtsZ both in vivo and when purified. The CLUSTAL W1.6 program11 was used to align 43 FtsZ protein sequences, and then three criteria were applied to select sites for cysteine mutagenesis. First, 37 possible sites in EcFtsZ were identified because at least one of the other FtsZ sequences in the alignment had a naturally occurring cysteine at the equivalent position. Second, a site was approved if it was found on the lateral surface of the structure of FtsZ but not near the two faces involved in polymerization. This was assessed by using the program RasMol to examine the equivalent sites in the M. jannaschii FtsZ (MjFtsZ) crystal structure12 and the structurally homologous tubulin α/β dimer crystal structure,13 as well as in a homology model of EcFtsZ (provided by Biomol-Informatics). Bacterial FtsZ sequences are 40−50% identical in sequence.14 Finally, a site was rejected if it was located in or near a region in FtsZ where a naturally occurring or previously introduced mutation had affected the functional properties of published FtsZ mutants. As a result of this selection process, only two residues, Glu93 and Ser255 (Figure 1), were chosen. Final confirmation of the viability of these sites was made using the WHAT IF program15 to mutate the selected residues to cysteines in the EcFtsZ homology model, confirming that the introduced cysteines had exposed and free side chains available for chemical modification. Site-Directed Mutagenesis of the EcFtsZ Gene. Site-directed mutagenesis was performed using a modified version of the inverse polymerase chain reaction (PCR) protocol of Weiner et al.16 The pET28a derivative plasmid pMFV56,17 which has the EcFtsZ gene under the control of a T7 promoter, was used as the PCR template. Primers were designed to introduce the cysteine mutation accompanied by silent mutations that encode the marker restriction site for NarI. The primers used to generate E93C-EcFtsZ were primE93C (GCCGCACAGCGCCGCACGCAATGCATC) and primNarIa (GCCGACATGGTCTTTATTGCTGC). The primers used to generate S255C-EcFtsZ were primS255C (GCCACACAGGTCGATATCTTCCAGCAGAG) and primNarIb (GCCCGCGGCGTGCTGGTTAACATCACGGC). Primers were phosphorylated using E. coli E.D. pFDX polynucleotide kinase (Roche Molecular Biochemicals). PCR products for each mutant were amplified using the Excite High Fidelity PCR system (Roche) and the following program: 5 min at 95 °C, followed by 15 cycles of 15 s at 94 °C, 30 s at 55 °C, and 4 min at 68 °C, and terminated with 20 min at 68 °C. PCR fragments were purified with the Concert Rapid PCR Purification System (Life Technologies, Inc.) and polished with Pwo DNA polymerase (Roche) to remove any additional nucleotides added to the 3′ end of the PCR product. Each polished PCR product was purified and ligated by T4 DNA ligase (Roche). The ligated PCR products were transformed into E. coli DH5α cells and grown on Luria broth (LB) plates containing 50 μg/mL kanamycin. Plasmid DNA was purified from individual transformants, and the mutant plasmids pAKV3 (pET28a-E93C-EcFtsZ) and pAKV4 (pET28a-S255C-EcFtsZ) were identified by digestion with NarI. The presence of the mutation in the EcFtsZ gene was then confirmed by sequencing with the

Figure 1. Structural model of EcFtsZ in solution and oriented on a planar lipid bilayer. (a) Mutated residues (spheres) were C93 and C255, located at the end of the H3 helix and at a long loop connecting H9 and S8, respectively. The N-terminal domain is shown in green/ blue, the core helix H7 in yellow, and the C-termial domain in red/ orange. The N- and C-terminal ends are the T8 and R316 residues, respectively. The polymerization direction is indicated by the gray arrow. (Homology model for E. coli FtsZ protein provided by BiomolInformatics.) The introduced cysteines act as linkers to the lipid heads of the lipid bilayer substrate. (b,c) Possible orientations of the two mutant proteins with respect to the membrane: (b) for E93C and (c) for S255C. primers ak1 (GTTTGTCGTTCGGGATAGTG), ak2 (CTGGAAGATATCGACCTCTCTGGC), and mf3 (GCACCAGTCGTCGCTGAAGTGGCA). Overexpression and Purification of E93C-EcFtsZ and S255CEcFtsZ. Overexpression of the two mutants was initially tested by transforming pAVK3 and pAVK4 into the E. coli strains BL21(DE3) and C41(DE3).18 Induction of protein expression with 1 mM isopropyl-1-thio-β-D-galactopyranoside resulted in only very low levels of each mutant being produced. To achieve high levels of production, the E93C-EcFtsZ and S255C-EcFtsZ mutant genes were cloned into the lambda-promoter expression vector pND706.19 Both genes were PCR amplified using the primers EcFtsZnde (GGAGAGAACATATGTTTGAACCAATGGAAC) and EcFtsZXhoI (TCCAGTCTCGAGTTAATCAGCTTGCTTACGC) to incorporate an NdeI site before the start codon and an XhoI site after the stop codon. Digestion of the resulting PCR products with NdeI and XhoI enabled cloning into pND706 to create pAVK5 (pND706-E93C-EcFtsZ) and pAVK6 (pND706-S255C-EcFtsZ). These constructions were checked by DNA sequencing as before. E. coli C43(DE3) cells18 transformed with either pAVK5 or pAVK6 were grown at 30 °C in LB broth supplemented with 50 μg/mL ampicillin to an absorbance (at 595 wavelength) value of 0.5. Synthesis 9437


Langmuir

Article

To anchor each FtsZ mutant to the lipid bilayer surface, a 2 μM solution of the protein in buffer Z was incubated on the formed bilayer for several hours to ensure complete coverage of the active surface, under conditions similar to those used to attach cysteine-containing proteins to maleimide-containing surfaces.26 The amount of protein in a 2 μM solution is in large excess with respect to the amount of lipid linker head on the surface. Buffer Z is an appropriate environment for FtsZ, as the high ionic strength prevents self-association and magnesium and potassium are important ions for nucleotidedependent polymerization and GTP hydrolysis.17,27−29 In addition, 100 μM TCEP was added to reduce eventual disulfide bonds formed between proteins. After the incubation period, the sample was rinsed with buffer Z to remove excess protein. Protein attachment to the lipids was confirmed with a density-gradient floating assay30 Atomic Force Microscopy. Atomic force microscopy (AFM) imaging was performed on the bilayer-anchored FtsZ mutants in buffer Z in the absence and presence of 5 mM GTP to study the polymerized state. AFM images were recorded with a microscope from Nanotec Electrónica (Madrid, Spain) operated in jump mode31 in a liquid environment. The scanning piezo was calibrated using silicon calibrating gratings (NT-MDT, Moscow, Russia). Silicon nitride tips (Veeco) with a force constant of 0.05 N/m and a 20-nm tip radius were used.

was induced by the rapid shift of each culture to 42 °C by immersing the culture in a 70 °C water bath for approximately 2 min. Synthesis was then maintained for 3 h in a shaking water bath at 42 °C. The produced proteins were purified as described in ref 17, except with the addition of 1 mM dithiothreitol (DTT) in buffers to keep their cysteine residues in a reduced state. Protein purities were checked by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) and were found to be 95% for the two purified proteins (see Figure S1 of the Supporting Information). Protein concentrations were measured using the bicinchoninic acid (BCA) assay (Pierce). The GTPase turnover rate for each mutant was determined by measuring released inorganic phosphate using the malachite green−molybdate reagent.20,21 Analytical Ultracentrifugation. Experiments were carried out in a Beckman Optima XL-I ultracentrifuge (Beckman-Coulter) equipped with interference optics that allow monitoring of FtsZ sedimentation in the presence of different nucleotides. Each FtsZ mutant (0.5 g/L) was equilibrated in working buffer [20 mM tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl) (pH 7.5), 500 mM KCl, 5 mM Mg2Cl, and 1 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM guanosine diphosphate (GDP)]. FtsZ samples were centrifuged at 30000 rpm and 25 °C using an An50Ti eight-hole rotor and double-sector Epon-charcoal centerpieces. Differential sedimentation coefficient distributions, c(s), were calculated by least-squares boundary modeling of the experimental data using SEDFIT 12.52.22 Transmission Electron Microscopy. The mutant FtsZ polymers (protein concentration of 0.5 g/L) were prepared in the presence of 1 mM GTP and 1 mM DTT and visualized by transmission electron microscopy (TEM) after negative staining with 2% uranyl acetate, using a JEOL-1200 electron microscope. Complementation Assays. The E93C-EcFtsZ, S255C-EcFtsZ, and wild-type EcFtsZ genes were cloned under an isopropyl-β-Dthiogalactopyranoside- (IPTG-) inducible promoter in pJF119EH23 to study the effect of their expression in vivo. The mutated genes were obtained by PCR amplification from the plasmids pAVK3 and pAVK4, and the EcFtsZ+ gene was obtained from pZAQ.24 We used the upstream primer AR58 (5′-CGGGATCCCATATGTTTGAACCAATGGAAC-3′), which introduces the restriction sites BamHI/ NdeI (underlined) containing the start codon (bold), and the downstream primer AR54 (5′-CCCAAGCTTAATCAGCTTGCTTACG-3′), which introduce a HindIII restriction site (underlined) immediately downstream of the stop codon (bold) of the f tsZ genes. The resulting plasmids were named pSCV2 (for E93C-EcFtsZ), pSCV3 (for S255C-EcFtsZ), and pARV66 (for EcFtsZ+). These constructions were checked by DNA sequencing as before. For complementation assays, the E. coli thermosensitive conditional FtsZ strain VIP2 [MC1061 f tsZ:kan/pLAR10 rep(Ts) f tsZ+]25 transformed with pSCV2, pSCV3, or pSCV4 was replica-plated with Bertani plates and grown overnight at the permissive (30 °C) or restrictive (42 °C) temperature in LB agar plates supplemented with the required antibiotics (50 μg mL−1 kanamycin, 20 μg mL−1 chloramphenicol, and 50 μg mL−1 ampicillin) and with 0, 50, 100, or 200 μM IPTG. Preparation of E93C-EcFtsZ and S255C-EcFtsZ Anchored to Planar Lipid Bilayers. Two separate 0.1 M stock solutions of the lipids dioleoyl phosphatidylcholine (DOPC, 786 Da, Avanti Polar Lipids) and distearoyl N-(3-maleimido-1-oxopropyl)-L-α-phosphatidylethanolamine (DSPE-MAL, 921 Da, NOF Corporation) were prepared in CHCl3/CH3OH 1/1 (v/v) solvent. A mixture of 90% DOPC/10% DSPE-MAL (mol/mol) was evaporated under nitrogen and resuspended in buffer L [50 mM Tris-HCl (pH 7.4), 200 mM NaCl, 5 mM CaCl2] at a final lipid concentration of 2.5 mM. To obtain large unilamellar vesicles (LUVs), the suspension was extruded 31 times through a 200-nm-pore membrane. To fuse the lipid bilayer on the substrate, a dilute 0.1 mM solution of the LUVs was placed in contact with freshly cleaved mica for 45 min at 30 °C. Then, the samples were rinsed with buffer Z [50 mM Tris-HCl (pH 7.4), 500 mM KCl, 5 mM MgCl2] to remove excess LUVs.

■

RESULTS AND DISCUSSION

The strategy used to orient proteins on a lipid membrane is based on the introduction of a cysteine group within the protein that can be covalently anchored to a maleimidecontaining lipid included in the planar lipid bilayer. EcFtsZ has no cysteines,10 so introducing such an amino acid places a reactive site at a known location on the protein surface. The use of maleimide−poly(ethylene glycol)-derivatized phospholipids to bind proteins through sulfur-containing cysteines to liposomes has been previously described.32−34 We adapted this strategy to attach the monomer form of the self-assembling bacterial cytoskeletal protein directly to a planar lipid bilayer. The maleimide anchoring group on the lipid polar head, with no poly(ethylene glycol) (PEG) spacer, imposes strong orientational restrictions on each individual monomer. Two different cysteine mutants were prepared: E93CEcFtsZ, in which the cysteine substitutes a glutamic acid residue on the N-terminal GTP binding domain, located on the lateral region of the monomer, near the H3 α-helix, and S255CEcFtsZ, in which the substituted amino acid is a serine in the Cterminal domain, located in the loop between α-helix 9 and βS8 (see Figure 1). Both mutations are located outside the monomer−monomer interface region involved in the protofilament formation12,35 and at opposite sides with respect to the polymerization direction. Therefore, both polymerization and GTP hydrolysis are possible, even with the protein oriented with residue C93 or C255 facing the surface. Given the external position of the cysteine in both mutants, no change in the secondary structure of the protein is expected.36,37 Panels b and c in Figure 1 present cartoons of the possible orientations of the proteins with respect to the membrane. The precise orientations, however, determined by the details of the stereochemistry and flexibility of the proteins and steric effects due to surface proximity, are unknown. Similarity of the Functional Properties of E93C-EcFtsZ and S255C-EcFtsZ with Those of E. coli FtsZ. Biochemical characterization of the mutant proteins was performed to assess their GTPase activity and their aggregation state. S255CEcFtsZ was found to retain 98% of the GTPase activity observed for the native protein; in contrast, E93C-EcFtsZ displayed only 20% of this activity (Figure S2, Supporting 9438


Langmuir

Article

Figure 2. Analytical ultracentrifugation and electron microscopy analysis of E93C-EcFtsZ and S255C-EcFtsZ in solution. Derived distributions of sedimentation coefficients obtained from experiments conducted in the presence of 1 mM GDP for the (a) E93C and (b) S255C mutants. The 2− 2.4S peak corresponds to the monomeric form, and the 5S peak corresponds to the dimer. Larger aggregates appear at even higher S values. Transmission electron microscopy analysis of the (c) E93C and (d) S255C mutants and (e) wild-type FtsZ polymers formed in the presence of 1 mM GTP (bars, 100 nm).

conditional FtsZ strain with the chromosomal f tsZ gene interrupted by a kanamycin cassette and an additional f tsZ copy in a plasmid with a thermosensitive replication origin.25 By varying the amount of IPTG added, the level of each mutant could be controlled. In the presence of 50 μM IPTG, FtsZ wildtype and the two mutants could each rescue the absence of FtsZ in VIP2 at 42 °C (Figure 3). However, only FtsZ wildtype and S255C-EcFtsZ were able to rescue VIP2 at 100 μM IPTG. This indicates that S255C-EcFtsZ is completely functional, whereas the E93C-EcFtsZ protein, although active at moderate levels, is toxic at higher levels. Covalent Attachment of E93C-EcFtsZ and S255CEcFtsZ to Lipid Bilayers in the Absence of GTP. We used atomic force microscopy (AFM) to investigate whether the FtsZ mutants could anchor to a lipid surface in the absence of GTP. A layer of protein was observed on the lipid surface after incubation of the maleimide-containing bilayer with the mutant proteins. Given that there was only one attachment site per monomer and that excess protein was removed from the

Information). The assays were carried out in a buffer containing 1 mM GTP, so it is possible that the GTP affinity is perturbed in E93C-EcFtsZ even though the negative charge of the removed glutamic acid is distant from the GTP binding pocket. Analytical ultracentrifugation experiments were carried out to identify the level of aggregation of the monomers in the absence of GTP. E93C-EcFtsZ showed a greater tendency to dimerize, as 85% of this mutant was present as a dimer (Figure 2a) under conditions in which S255C-EcFtsZ was more than 70% present as a monomer (Figure 2b). Native FtsZ, under similar conditions, is also present mostly as a monomer.17 Decreased substrate accessibility due to this partial dimerization could also be the cause of the observed reduction in GTPase activity. Transmission electron microscopy images of the polymers produced in the presence of 1 mM GTP show that both mutants produce the expected filaments in solution (Figure 2c,d). Complementation assays were carried out in the E. coli strain VIP2 to explore the impact of the amino acid substitutions on the biological function in vivo. VIP2 is a thermosensitive 9439


Langmuir

Article

Figure 3. Suppression of cell division defects by expression of Ecf tsZ mutants under Ptac promoter control. At least five isolated colonies were suspended in LB and replica-plated onto LB plates, supplemented with the corresponding antibiotics for vector selection, in addition to increasing concentrations of IPTG (0, 50, 100, or 200 μM) for pSCV2 (pJF119/E93C-Ecf tsZ) and pSCV3 (pJF119/S255C-Ecf tsZ). pARV66 (pJF119/Ecf tsZ+) and the empty plasmid (pJF119/) were used as positive and negative controls, respectively. Growth was assessed after overnight incubation of duplicate plates at 30 or 42 °C.

Figure 4. Atomic force microscopy analysis of E93C-EcFtsZ on DOPC/DSPE-Mal (9:1) lipid bilayer in the absence of GTP: (a) 2 × 2 μm micrograph of the protein surface, (b) 500 × 500 nm image, with the profile marked as I given in panel bI. Both images show a compact protein layer with occasional defects with a depth of 2−3 nm.

solution before imaging, the presence of varying amounts of reversible dimers or trimers formed in the presence of GDP did not seem to affect the formation of a full dense layer of protein, one monomer thick, permitted by the 10% molar ratio of DSPE-MAL lipid linker present. Figure 4a shows images of the lipid surfaces after incubation of the E93C mutant protein, revealing a densely packed protein surface with occasional defects having a depth of 2−3 nm (Figure 4b). Incubation of S255C-EcFtsZ on the maleimide-containing lipid surface also gave full surface coverage, as expected from the density of linker lipid used (Figure 5a,b). The distribution

of the monomers, however, differed significantly from that observed for the E93C mutant. The protein layer was loosely packed, and the proteins were concentrated around empty regions. The average height of the protein layer field was 1.7 nm, probably reflecting that the attachment of the protein to the surface was different than for the E93C mutant and, most likely, less rigid. We did not observe lipid phase separation on the bilayer, either before or after protein addition, probably due to the small amount of DSPE present in the bilayer. Ongoing experiments at variable sample temperatures using membranes 9440


Langmuir

Article

Figure 5. Atomic force microscopy analysis of S255C-FtsZ on DOPC/DSPE-Mal (9:1) lipid bilayer in the absence of GTP: (a) 12 × 12 μm AFM image of the protein surface, (b) 4 × 4 μm micrograph, with the profile marked as I given in panel bI. A dense layer of protein concentrated around empty depressions is shown.

to form filaments, they rose higher above the membrane surface (Figure 6b). Both the rapid polymerization after GTP addition and the increase in height upon polymerization could reflect that the attachment point was far from the polymerization axis (see Figure 1) and located in a loop on the C-terminal subdomain. This location would give a loose bonding to the surface with enough degrees of freedom to allow the monomers to stand higher above the membrane surface once they formed the longitudinal bonds required for polymerization (Figure 6b). This interpretation is compatible with previous results indicating that the C-terminal subdomain region is more flexible than the N-terminal subdomain region39 and that polymerization induces a conformational change withinin the monomer, affecting the orientation between these subdomains.40 In the case of E93C-EcFtsZ, polymerization occurred several minutes after GTP addition, and the filaments extended to form a network structured at 60° and 120° angles (Figure 7a). The surface attachment at residue 93 was located near the H3 loop in the more rigid N-terminal domain,39 placing the polymerization axis closer to the surface (Figure 1b). The filament height determined at regions with lower filament density was 2 nm on average, which was lower than the 4 nm measured for the structures formed from the S255C mutant. This height difference could reflect the different orientations of the filaments and the fact that their interaction with the membrane was through the more rigid N-terminal domain of the protein, which had fewer degrees of freedom to accommodate reorientations with respect to the membrane plane. Previous observations of filaments on mica and lipid surfaces showed that polymers adopt curved shapes.8,41 However, the filaments observed here, in which the monomers were covalently linked to the lipids with defined orientations, showed no indication of curvature. Because lipid membranes

with different lipid compositions will address this point and explore the role of lipids in the protein organization on the surface. In the absence of GTP, the distribution of the proteins on the surface remained stable for days for both mutants, reflecting the stability of the maleimide−cysteine covalent bond. GTP-Induced Formation of Distinctive Filamentous Structures by E93C-EcFtsZ and S255C-EcFtsZ. The presence of GTP in the imaging buffer induced the reorganization of both proteins on the lipid bilayer surface. As all of the excess protein was removed from solution prior to AFM imaging, the structures observed must have been formed by reorganization of previously covalently attached proteins. Both mutants were able to form longitudinal bonds to assemble into filaments (Figures 6 and 7). The underlying lipid matrix, composed of 90% DOPC, had a transition temperature −22 °C38 and was therefore fluid at room temperature, allowing the proteins to redistribute and align their monomer−monomer interactions due to the presence of GTP. The times needed for the proteins to reorient on the surface, however, were quite different for the two mutants. S255C-EcFtsZ formed longitudinal polymers immediately after GTP addition to the solution (Figure 6), whereas E93C-EcFtsZ required several minutes before forming visible filaments (Figure 7). The slow response of the E93C mutant could reflect the low GTPase hydrolysis rate described earlier, but steric restrictions to monomer reorientation are also likely to be present in such a densely packed protein monolayer. The structures of the polymers formed were also found to be strongly dependent on the orientation of the monomers on the surface. Addition of GTP to the S255C mutant resulted in the formation of straight filament aggregates. In this case, short filaments (few hundred nanometers long) with different orientations formed (Figure 6a). When the monomers aligned 9441


Langmuir

Article

Figure 6. Atomic force microscopy analysis of S255C-EcFtsZ on DOPC/DSPE-Mal (9:1) lipid bilayer in the presence of 5 mM GTP: (a) 10 × 10 μm AFM image of the protein surface on the bilayer immediately after addition of GTP to the sample. Short and straight filaments begin to lift over the surrounding monomeric layer. (b) This image shows the two height levels as measured in profile I (panel bI). (c) 9 × 9 μm AFM image obtained 1 h after addition of GTP. (d) White arrows point to filament junctions. Filaments are thinner at their ends, where the monomers incorporate. Profile I (panel dI) gives a value of 60 nm for the width at half-maximum of two filaments, which is near the average width (70 nm). Their height is 4.5 nm (diameter of one protein).

on hydrophilic solid supports remain fluid, we interpret that the shapes observed were mainly due to the polymerization properties of the proteins. In the case of S255C-EcFtsZ, filament aggregates formed in different orientations following the previous ordering of the monomers on the surface. Aggregates were around 10 filaments thick on average and one monomer thick, as measured from the AFM images. Although other experimental conditions facilitate the formation of round filament bundles,7 filament aggregates are very sensitive to the presence of crowding agents, ions, and pH, and it is not surprising that sample preparation protocols used to negatively stain and dry the samples for observation by transmission electron microscopy might give different aggregate shapes from the ones described here. The filament aggregates observed here did not curve following the initial monomer distribution. They assembled as short, straight aggregates oriented at different angles and grew mainly by modifications at their ends, probably indicating that monomers closer to the ends of the filaments exchangeed

at a higher rate than monomers within the central region of the filaments42,43 (Figure 6d). This allowed for reorganization of the filaments on the surface to give longer and more aligned structures. Although the filaments formed from the E93C mutant were also straight, the mesh mainly consisted of single filaments or aggregates only a few filaments thick. Because the measured width of 15 nm was close to the nominal width of the AFM tip of 10−20 nm, we cannot provide reliable information of structures smaller than this size. Individual filaments formed at lower protein concentrations were also straight, indicating that it was probably the orientation of the monomers, not the aggregation of the filaments, that forced the straight conformation (see Figure S3, Supporting Information). Another striking feature is the well-defined angle of interaction between filaments formed from E93C-EcFtsZ, which is possible only through the presence of a contact site between monomers that is different from the head-to-tail interaction that governs the formation of longitudinal filaments 9442


Langmuir

Article

Figure 7. Atomic force microscopy analysis of E93C-EcFtsZ on DOPC/DSPE-Mal (9:1) lipid bilayer in the presence of 5 mM GTP: (a) 3.5 × 3.5 μm AFM micrograph of the protein surface after GTP addition. A network of filaments crossing at 60°/120° angles is formed. The profiles of the polymers growing in the two preferential directions are marked as I and II. The measured widths (panel aI) are close to 15 nm, measured either peak-to-peak or at half-maximum. Isolated filaments in the other direction have widths of around 30 nm (panel aII). (b) Profile of the contact point between filaments.

(Figure 7a). The crystal structure of FtsZ from Methanococcus jannaschii (MjFtsZ)12 was previously described as indicating the presence of a protein trimer, although there is no direct evidence of its biological relevance. However, there are indications that the formation of trimers is feasible. When the asymmetric unit of MjFtsZ (PDB entry 1FSZ) was entered into either the Protein Quaternary Server (PQS)44 or, alternatively, the ProtBUD program,45 the trimer shown in Figure 8a was produced. Both methods apply the crystallographic symmetry operations from the contents of the deposited coordinates to derive potential oligomeric assemblies. PQS analysis, based on assigning an empirical weighted score to different energetic contributions (size and number of buried residues in the solvent-accessible area, difference in solvation energy of folding, and number of interchain and disulfide bridges formed) suggests that the formation of trimers is energetically feasible. The presence of a preferential lateral interaction can explain the formation of some of the structures observed under similar experimental conditions.46 The restricted orientation of the monomers would expose protein surfaces involved in the formation of the trimer found in the crystal packing arrangement (Figure 8a), particularly if the protein were attached through residue 93. Experiments carried out with

analytical ultracentrifugation also indicated an increased tendency of the E93C mutant monomers to interact with each other in solution. The oriented surface attachment of the monomers would then only amplify a tendency already present in solution. Figure 8b,c illustrate how monomers preoorganized as trimers could seed the formation of filaments growing precisely at the 60°/120° observed experimentally. The fact that the E93C-EcFtsZ filaments were thinner than those formed by S255C-EcFtsZ could reflect the fact that H3 helix region, known to be relevant for lateral interactions,47 was facing the membrane surface, preventing it from forming thicker filament aggregates. The S255C mutation, located in the more flexible C-terminal subdomain,39 could make the H3 region more available to promote the formation of filament aggregates.

■

CONCLUSIONS The large polymorphism of FtsZ polymers extensively documented for polymers formed in solution also holds for polymers oriented on a surface. Previously described modulation of polymer curvature on surfaces was attributed to the presence of the flexible protein ZipA as a membrane anchor.8 The results presented here show that the protein 9443


Langmuir

Article

indicate, however, that the polymer curvature is sensitive to the way in which the protein is attached to and oriented on the surface. These results are more consistent with a picture of the FtsZ monomer containing regions of different flexibility whose relative motions could modulate filament curvature.39 It is difficult to extrapolate the significance of the behavior of FtsZ filaments in vitro to their role in vivo. However, it has generally been accepted that the polymerization behavior and assembly capacity described in reconstituted systems containing a few of the elements present in the cell reveal important traits that support the behavior in the more complex living cell.9,57 Although the results described in this work belong to this category of artificially reconstituted systems, it is likely that the main observation indicating the importance of surface attachment in determining filament curvature and aggregation could point to the biological relevance of modulating these two elements to control the function of FtsZ on the cell membrane. Interestingly, most of the FtsZ-binding proteins that are known to play an important role in its membrane attachment, mainly FtsA and ZipA, bind to the conserved segment of the Cterminal domain that follows a flexible variable spacer region.58,59 It could be that this flexible attachment opens the possibility of using the orientation of surface attachment to further tune filament curvature and aggregation state. The existence of other nonessential proteins that bind FtsZ polymers such as ZapA, ZapB, ZapC, and ZapD has been described recently.60−62 They are thought to play a role in stabilizing the formation of the functional polymeric structure. The cross-linking and guided stabilization of the filaments could contribute to the promotion of the right orientation on the surface to facilitate their function. These proteins, as well as the localized membrane lipid charges,63 could influence the lateral aggregation, curvature, and stiffness of the polymers, all issues with a strong impact on its force generating function. Surface attachment also facilitates filament branching at welldefined orientations, indicating that monomer regions different from those involved in head-to-tail interactions favored by the presence of GTP are strong enough to affect the shape of the filament aggregates. This effect is stronger on filaments formed by the E93C mutant. Biochemical characterization indicated that this mutant has decreased GTPase activity and an increased monomer−monomer interaction that stabilizes dimers and trimers formed in the presence of GDP. In vivo experiments also indicated that its overexpression was toxic to the cell. This higher tendency to branch would then reflect not only the orientation on the surface but also some additional and not well-defined effect of the cysteine mutant. The picture that emerges is that monomer flexibility and oriented membrane anchoring could be subtle ways to further modulate the shape and possibly the force exerting mechanism of the FtsZ filaments on the surface.

Figure 8. Models of possible filament formations formed by E93CEcFtsZ and S255C-EcFtsZ on the suface of a planar lipid bilayer. (a) Trimeric oligomeric state derived from the MjFtsZ monomer (PDB entry 1FSZ) using the Protein Quaternary Server. The residues labeled as 93 and 255 represent the cysteines of the EcFtsZ mutants. The H0 and H3 helices and GDP nucleotides (in spherical representation) are also highlighted. (b,c) Three-way junctions of filaments (crossing at a 60°/120° angle) growing from (b) all monomers of the trimeric entity or (c) two of them. In the latter case, the magenta monomer is in steric conflict with the blue monomer and does not have free surfaces to polymerize. Three MjFtsZ dimers (PDB entry 1W5A) have been used to show the polymer formation. The polymerization directions are indicated by the appropriately colored arrows.

■

monomer itself has an inbuilt capacity to modulate its curvature and aggregate shape depending on its orientation with respect to a nearby surface. The localization of the anchoring element on the protein surface can affect the extent of lateral aggregation and the degree of curvature, two traits that have been repeatedly pointed out as relevant in determining the force generation mechanism.48−56 Some models have assumed that filament curvature is fixed and well-defined and that it guides the sense of membrane deformation to be either concave or convex depending on whether the polymers are anchored through the N- or C-terminal end of the protein.9 Our results

ASSOCIATED CONTENT

S Supporting Information *

Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. 9444


Langmuir

Article

Present Address

(14) Erickson, H. P. Evolution of the cytoskeleton. BioEssays 2007, 29 (7), 668−677. (15) Vriend, G. WHAT IF: A molecular modeling and drug design program. J. Mol. Graph. 1990, 8, 52−56. (16) Weiner, M. P.; Costa, G. L.; Schoettlin, W.; Cline, J.; Mathur, E.; Bauer, J. C. Site-directed mutagenesis of double-stranded DNA by the polymerase chain reaction. Gene 1994, 151, 119−123. (17) Rivas, G.; López, A.; Mingorance, J.; Ferrándiz, M. J.; Zorrilla, S.; Minton, A. P.; Vicente, M.; Andreu, J. M. Magnesium-induced linear self-association of the FtsZ bacterial cell division protein monomer. The primary steps for FtsZ assembly. J. Biol. Chem. 2000, 275, 11740−11749. (18) Miroux, B.; Walker, J. E. Over-production of proteins in Escherichia coli: Mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J. Mol. Biol. 1996, 260, 289−98. (19) Love, C. A.; Lilley, P. E.; Dixon, N. E. Stable high-copy-number bacteriophage lambda promoter vectors for overproduction of proteins in Escherichia coli. Gene 1996, 176, 49−53. (20) Hoenig, M.; Lee, R. J.; Ferguson, D. C. A microtiter plate assay for inorganic phosphate. J. Biochem. Biophys. Methods 1989, 19, 249− 252. (21) Lanzetta, P. A.; Alvarez, L. J.; Reinach, P. S.; Candia, O. A. An improved assay for nanomole amounts of inorganic phosphate. Anal. Biochem. 1979, 100, 95−97. (22) Lebowitz, J.; Lewis, M. S.; Schuck, P. Modern analytical ultracentrifugation in protein science: A tutorial review. Protein Sci. 2002, 11 (9), 2067−2079. (23) Fürste, J. P.; Pansegrau, W.; Frank, R.; Blocker, H.; Scholz, P.; Bagdasarian, M.; Lanka, E. Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene 1986, 48, 119−131. (24) Ward, J. E.; Lutkenhaus, J. Overproduction of FtsZ induces minicell formation in E. coli. Cell 1985, 42, 941−949. (25) Pla, J.; Sánchez, M.; Palacios, P.; Vicente, M.; Aldea, M. Preferential cytoplasmic location of FtsZ, a protein essential for Escherichia coli septation. Mol. Microbiol. 1991, 5, 1681−1686. (26) Torrance, L.; Ziegler, A.; Pittman, H.; Paterson, M.; Toth, R.; Eggleston, I. Oriented immobilisation of engineered single-chain antibodies to develop biosensors for virus detection. J. Virol. Methods 2006, 134, 164−170. (27) Mukherjee, A.; L, J. Analysis of FtsZ assembly by light scattering and determination of the role of divalent metal cations. J. Bacteriol. 1999, 181, 823−832. (28) Tadros, M.; González, J. M.; Rivas, G.; Vicente, M.; Mingorance, J. Activation of the Escherichia coli cell division protein FtsZ by a lowaffinity interaction with monovalent cations. FEBS Lett. 2006, 580 (20), 4941−4946. (29) Mendieta, J.; Rico, A. I.; López-Viñas, E.; Vicente, M.; Mingorance, J.; Gómez-Puertas, P. Structural and functional model for ionic (K+/Na+) and pH dependence of GTPase activity and polymerization of FtsZ, the prokaryotic ortholog of tubulin. J. Mol. Biol. 2009, 390 (1), 17−25. (30) Nozawa, A.; N., H.; Miyata, T.; Linka, N.; Endo, Y.; Weber, A. P. M.; Tozawa, Y. A cell-free translation and proteoliposome reconstitution system for functional analysis of plant solute transporters. Plant Cell Physiol. 2007, 48 (12), 1815−1820. (31) Moreno-Herrero, F.; de Pablo, P. J.; Fernández-Sánchez, R.; Colchero, J.; Gómez-Herrero, J.; Baró, A. M. Scanning force microscopy jumping and tapping modes in liquids. Appl. Phys. Lett. 2002, 81, 2620−2622. (32) Shahinian, S.; Silvius, J. R. A novel strategy affords high-yield coupling of antibody Fab′ fragments to liposomes. Biochim. Biophys. Acta: Biomembr. 1995, 1239 (2), 157−167. (33) Luan, N. M.; Teramura, Y.; Iwata, H. Layer-by-layer coimmobilization of soluble complement receptor 1 and heparin on islets. Biomaterials 2011, 32 (27), 6487−6492.

‡

Instituto de Microelectrónica de Madrid, CSIC, Isaac Newton 8 (PTM), Tres Cantos 28760 Madrid, Spain. Author Contributions §

Both M.E. and A.V.K. contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors acknowledge Miguel Vicente, Jesús Mingorance, and Germán Rivas for useful discussions and the following sources of funding: COMBACT S-BIO-0260/2006 (Comunidad de Madrid to M.V.), NOBIMAT-M S2OO9/MAT·1507 (Comunidad de Madrid to M.V.), DIVINOCELL FP7 HEALTH-F3-2009-223431 (European Commission to M.V.), Plan Nacional BIO2008-04478-C03-00 (Ministerio de Ciencia e Innovación, Madrid, Spain, to M.V.), and CONSOLIDER INGENIO 2010 CSD2007-00010 (Ministerio de Ciencia e Innovación to M.V.). A.V.K. was supported by a fellowship from the Spanish Government (Ref SB97-BL 0332192), M.K. was a Ph.D. fellow of the La Caixa Foundation International Fellowship Programme (La Caixa/CNB), and S.C. acknowĺ (CSIC), edges Consejo Superior de Investigaciones Cientificas Madrid, Spain, for JAE-intro grants.

■

REFERENCES

(1) Rueda, S.; Vicente, M.; Mingorance, J. Concentration and assembly of the division ring proteins FtsZ, FtsA, and ZipA during the Escherichia coli cell cycle. J. Bacteriol. 2003, 185 (11), 3344−3351. (2) Vicente, M.; Rico, A. I.; Martínez-Arteaga, R.; Mingorance, J. Septum enlightenment: Assembly of bacterial division proteins. J. Bacteriol. 2006, 188 (No.1), 19−27. (3) Mingorance, J.; Rivas, G.; Vélez, M.; Gómez-Puertas, P.; Vicente, M. Strong FtsZ is with the force: Mechanisms to constrict bacteria. Trends Microbiol. 2010, 18 (8), 348−356. (4) Osawa, M.; Anderson, D. E.; Erickson, H. P. Reconstitution of contractile FtsZ rings in liposomes. Science 2008, 320 (5877), 792− 794. (5) Erickson, H. P.; Taylor, D. W.; Taylor, K. A.; Bramhill, D. Bacterial cell division protein FtsZ assembles into protofilament sheets and minirings, structural homologs of tubulin polymers. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 519−523. (6) Popp, D.; Iwasa, M.; Erickson, H. P.; Narita, A.; Maéda, Y.; Robinson, R. C. Suprastructures and dynamic properties of Mycobacterium tuberculosis FtsZ. J. Biol. Chem. 2010, 285 (15), 11281−11289. (7) Popp, D.; Iwasa, M.; Narita, A.; Erickson, H. P.; Maéda, Y. FtsZ condensates: An in vitro electron microscopy study. Biopolymers 2009, 91 (5), 340−350. (8) Mateos-Gil, P.; Márquez, I.; López-Navajas, P.; Jiménez, M.; Vicente, M.; Mingorance, J.; Rivas, G.; Vélez, M. FtsZ polymers bound to lipid bilayers through ZipA form dynamic two dimensional networks. Biochim. Biophys. Acta: Biomembr. 2012, 1818 (3), 806−813. (9) Osawa, M.; Anderson, D. E.; Erickson, H. P. Curved FtsZ protofilaments generate bending forces on liposome membranes. EMBO J. 2009, 28 (22), 3476−3484. (10) Qing-Ming, Y.; Lutkenhaus, J. The nucleotide sequence of the essential cell-division gene ftsZ of Escherichia coli. Gene 1985, 36 (3), 241−247. (11) Aiyar, A. The use of CLUSTAL W and CLUSTAL X for multiple sequence alignment. Methods Mol. Biol. 2000, 132, 221−41. (12) Lowe, J.; Amos, L. A. Crystal structure of the bacterial celldivision protein FtsZ. Nature 1998, 391 (6663), 203−206. (13) Nogales, E.; Wolf, S. G.; Downing, K. H. Structure of the αβ tubulin dimer by electron crystallography. Nature 1998, 393, 199−203. 9445


Langmuir

Article

(34) Huwyler, J.; Wu, D.; Pardridge, W. M. Brain drug delivery of small molecules using immunoliposomes. Proc. Natl. Acad. Sci. U.S.A. 1996, 93 (24), 14164−14169. (35) Oliva, M. A.; Cordell, S. C.; Lowe, J. Structural insights into FtsZ protofilament formation. Nat. Struct. Mol. Biol. 2004, 11 (12), 1243−1250. (36) Díaz-Espinoza, R.; Garcés, A. P.; Arbildua, J. J.; Montecinos, F.; Brunet, J. E.; Lagos, R.; Monasterio, O. Domain folding and flexibility of Escherichia coli FtsZ determined by tryptophan site-directed mutagenesis. Protein Sci. 2007, 16 (8), 1543−1556. (37) Shin, J. Y.; Vollmer, W.; Lagos, R.; Monasterio, O. Glutamate 83 and arginine 85 of helix H3 bend are key residues for FtsZ polymerization, GTPase activity and cellular viability of Escherichia coli: Lateral mutations affect FtsZ polymerization and E. coli viability. BMC Microbiol. 2013, 13 (1), 26. (38) Tamm, L. K.; McConnell, H. M. Supported phospholipid bilayers. Biophys. J. 1985, 47 (1), 105−113. (39) Martín-Galiano, A. J.; Buey, R. M.; Cabezas, M.; Andreu, J. M. Mapping flexibility and the assembly switch of cell division protein FtsZ by computational and mutational approaches. J. Biol. Chem. 2010, 285 (29), 22554−22565. (40) Chen, Y.; Erickson, H. P. Conformational changes of FtsZ reported by tryptophan mutants. Biochemistry 2011, 50 (21), 4675− 4684. (41) Mingorance, J.; Tadros, M.; Vicente, M.; Gonzalez, J. M.; Rivas, G.; Vélez, M. Visualization of single Escherichia coli FtsZ filament dynamics with atomic force microscopy. J. Biol. Chem. 2005, 280 (21), 20909−20914. (42) Mateos-Gil, P.; Paez, A.; Hörger, I.; Rivas, G.; Vicente, M.; Tarazona, P.; Vélez, M. Depolymerization dynamics of individual filaments of bacterial cytoskeletal protein FtsZ. Proc. Natl. Acad. Sci. U.S.A. 2012, 109 (21), 8133−8138. (43) Martín-García, F.; Salvarelli, E.; Mendieta-Moreno, J. I.; Vicente, M.; Mingorance, J. M., J.; Gómez-Puertas, P. Molecular dynamics simulation of GTPase activity in polymers of the cell division protein FtsZ. FEBS Lett. 2012, 586, 1236−1239. (44) Henrick, K.; Thornton, J. M. PQS: A protein quaternary structure file server. Trends Biochem. Sci. 1998, 23, 358−361. (45) Xu, Q.; Canutescu, A.; Obradovic, Z.; Dunbrack, R. L. ProtBuD: A database of biological unit structures of protein families and superfamilies. Bioinformatics 2006, 22, 2876−2882. (46) Gonzalez de Prado Salas, P.; Encinar, M.; Vélez, M.; Tarazona, P. Structure of FtsZ protein filaments anchored on bilayer membranes. Soft Matter 2013, 9, 6072. (47) Lu, C.; Stricker, J.; Erickson, H. Site-specific mutations of FtsZ: Effects on GTPase and in vitro assembly. BMC Microbiol. 2001, 1 (1), 7. (48) Shlomovitz, R.; Gov, N. S. Membrane-mediated interactions drive the condensation and coalescence of FtsZ rings. Phys. Biol. 2009, 6 (4), 046017. (49) Paez, A.; Mateos-Gil, P.; Horger, I.; Mingorance, J.; Rivas, G.; Vicente, M.; Velez, M.; Tarazona, P. Simple modeling of FtsZ polymers on flat and curved surfaces: Correlation with experimental in vitro observations. PMC Biophysics 2009, 2 (1), 8. (50) Erickson, H. P. Modeling the physics of FtsZ assembly and force generation. Proc. Natl. Acad. Sci. U.S.A. 2009, 106 (23), 9238−9243. (51) Allard, J. F.; Cytrynbaum, E. N. Force generation by a dynamic Z-ring in Escherichia coli cell division. Proc. Natl. Acad. Sci. U.S.A. 2009, 106 (1), 145−150. (52) Lan, G.; Daniels, B. R.; Dobrowsky, T. M.; Wirtz, D.; Sun, S. X. Condensation of FtsZ filaments can drive bacterial cell division. Proc. Natl. Acad. Sci. U.S.A. 2009, 106 (1), 121−126. (53) Fischer-Friedrich, E.; Gov, N. Modeling FtsZ ring formation in the bacterial cellAnisotropic aggregation via mutual interactions of polymer rods. Phys. Biol. 2011, 8, 026007. (54) Fischer-Friedrich, E.; Friedrich, B. M.; Gov, N. S. FtsZ rings and helices: Physical mechanisms for the dynamic alignment of biopolymers in rod-shaped bacteria. Phys. Biol. 2012, 9, 016009.

(55) Ghosh, B.; Sain, A. Origin of contractile force during cell division of bacteria. Phys. Rev. Lett. 2008, 101 (17), 178101. (56) Ghosh, B.; Sain, A. Force generation in bacteria without nucleotide-dependent bending of cytoskeletal filaments. Phys. Rev. E 2011, 83 (5), 051924. (57) Loose, M.; Fischer-Friedrich, E.; Ries, J.; Kruse, K.; Schwille, P. Spatial regulators for bacterial cell division self-organize into surface waves in vitro. Science 2008, 320 (5877), 789−792. (58) Ma, X.; Margolin, W. Genetic and functional analyses of the conserved C-terminal core domain of Escherichia coli FtsZ. J. Bacteriol. 1999, 181 (24), 7531−7544. (59) Mosyak, L.; Zhang, Y.; Glasfeld, E.; Haney, S.; Stahl, M.; Seehra, J.; Somers, W. S. The bacterial cell-division protein ZipA and its interaction with an FtsZ fragment revealed by X-ray crystallography. EMBO J. 2000, 19 (13), 3179−3191. (60) Galli, E.; Gerdes, K. FtsZ-ZapA-ZapB interactome of Escherichia coli. J. Bacteriol. 2012, 194 (2), 292−302. (61) Hale, C. A.; Shiomi, D.; Liu, B.; Bernhardt, T. G.; Margolin, W.; Niki, H.; de Boer, P. A. J. Identification of Escherichia coli ZapC (YcbW) as a component of the division apparatus that binds and bundles FtsZ polymers. J. Bacteriol. 2011, 193 (6), 1393−1404. (62) Durand-Heredia, J.; Rivkin, E.; Fan, G.; Morales, J.; Janakiraman, A. Identification of ZapD as a cell division factor that promotes the assembly of FtsZ in Escherichia coli. J. Bacteriol. 2012, 194 (12), 3189−3198. (63) Mileykovskaya, E.; D, W. Role of membrane lipids in bacterial division-site selection. Curr. Opin. Microbiol. 2005, 8 (2), 135−42.

9446


Polymorphism of FtsZ Filaments on Lipid Surfaces: Role of Monomer

Recommend Documents