Letter pubs.acs.org/synthbio
Positive Feedback Genetic Circuit Incorporating a Constitutively Active Mutant Gal3 into Yeast GAL Induction System Shintaro Ryo,† Jun Ishii,‡ Toshihide Matsuno,‡ Yasuyuki Nakamura,‡ Daiki Matsubara,‡ Masahiro Tominaga,‡ and Akihiko Kondo*,†,‡ †
Department of Chemical Science and Engineering, Graduate School of Engineering, Kobe University, 1-1 Rokkodai, Nada, Kobe 657-8501, Japan ‡ Graduate School of Science, Technology and Innovation, Kobe University, 1-1 Rokkodai, Nada, Kobe 657-8501, Japan S Supporting Information *
ABSTRACT: The GAL expression system is the most frequently used induction technique in the yeast Saccharomyces cerevisiae. Here we report a simple but powerful genetic circuit for use with the GAL induction system. Briefly, an artificial positive feedback circuit was incorporated into the GAL regulatory network. We selected green fluorescent protein (GFP) as a reporter of GAL1 induction, and designed a strain that expressed a constitutively active Gal3 mutant protein (Gal3c) under control of the GAL10 promoter. In the resulting strain, GAL1 and GAL10 promoters regulate the expression of GFP and GAL3c, respectively. Because Gal3c sequesters the Gal80 repressor away from the Gal4 transcriptional activator in the same manner as the galactose-bound Gal3, the expressed Gal3c protein provokes further expression of GFP and Gal3c, yielding further enhancement of GAL induction. Thus, this GAL3c-mediated positive feedback circuit permits substantially enriched induction of a target gene at extremely low concentrations, or even in the absence, of galactose, while maintaining the strict glucose-mediated repression of the target. KEYWORDS: GAL induction system, positive feedback circuit, Gal3c, galactose, protein production, Saccharomyces cerevisiae
H
The GAL regulatory network is a well-characterized system in S. cerevisiae. The mechanism for swift transcriptional activation of the GAL genes is controlled by the regulatory genes (GAL4, GAL80 and GAL3) of the GAL regulon.10 The transcriptional activator Gal4 binds to the upstream activation sequence (UASGAL) and potentiates expression of the GAL genes, including GAL1 and GAL10. Gal3 and Gal80 are (respectively) positive and negative regulators of Gal4 transcriptional activity.11,12 In the absence of galactose, the repressor, Gal80, associates with Gal4 and inhibits Gal4’s transcriptional activity. In addition, the activity of Gal4 is strongly repressed in the presence of glucose.12,13 In contrast, the galactose sensor, Gal3, is activated in the presence of galactose, and galactose-bound Gal3 (Gal3*) sequesters Gal80 away from Gal4, relieving the inhibition of Gal4 transcriptional activity and thereby permitting induction of the expression of the GAL genes (Figure 1A).10 Here we report the development, in the yeast S. cerevisiae, of a simple but powerful genetic circuit that facilitates GAL induction in response to low levels, or even in the absence, of galactose. To amplify the galactose response of the GAL induction system, an artificial positive feedback circuit was
igh-level production of recombinant proteins is still a major concern in various aspects of biotechnology. Yeast, Saccharomyces cerevisiae, is one of the most widely used host cells for production of foreign proteins, reflecting this organism’s high multiplication rate, user-friendly genetic manipulation, and “generally recognized as safe” (GRAS) status.1−3 Moreover, yeast has an additional and important advantage for the production of proteins requiring eukaryotespecific post-translational modifications.1,2 Thus, S. cerevisiae has been successfully used to produce many recombinant proteins, including antibodies, enzymes, and receptors.1−6 The GAL expression system, which uses the GAL1−GAL10 divergent promoters, is one of the most frequently used induction techniques, and enables strictly regulated induction in S. cerevisiae.7−9 Both the GAL1 and GAL10 promoters trigger potent transcriptional activation in the presence of galactose, whereas expression from these promoters is robustly suppressed in the presence of glucose.7,8 However, the inducer, galactose, is a relatively expensive sugar compared to other carbon sources such as glucose and glycerol. This cost factor affects for industrial applications, limiting the commercial use of the GAL expression system. Therefore, techniques that decrease galactose usage while maintaining expression levels would render the GAL expression system appealing for a wider range of products. © XXXX American Chemical Society
Received: September 24, 2016 Published: March 21, 2017 A
DOI: 10.1021/acssynbio.6b00262 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Letter
ACS Synthetic Biology
Figure 1. Outline of the experimental design. (A) GAL regulatory network in wild-type yeast strain. The transcription of GAL genes, including GAL1 and GAL10, is strictly controlled by the GAL regulatory genes (GAL4, GAL80, and GAL3). In the absence of galactose (and in the presence of glucose), Gal80 acts as a repressor, interacting with the transcriptional activator Gal4 and inhibiting expression of the GAL1 and GAL10 genes. Gal3 acts as a galactose sensor and is activated in the presence of galactose; the activated Gal3 (Gal3*) sequesters Gal80 away from Gal4 to relieve the inhibition of Gal4, permitting the expression of the GAL1 and GAL10 genes. The Gal3c protein used in this study exhibits activation (in the absence of galactose) similar to that exhibited by galactose-stimulated Gal3 (Gal3*) in the wild-type GAL network. (B) Positive feedback GAL induction system with a constitutively active Gal3 mutant protein. GFP, used as a reporter for protein production, was expressed under the control of the GAL1 promoter. A constitutively active Gal3 mutant protein (Gal3c) was placed downstream of the GAL10 promoter to create an artificial positive feedback circuit for Gal4 transcriptional activation. Galactose-induced Gal4 transcriptional activation induces expression of both GFP and Gal3c; therefore, the expressed Gal3c helps to release Gal4 from Gal80, and the released Gal4 further induces expression of GFP and Gal3c. Thus, the positive feedback by GAL3c is expected to enhance protein production compared to that of the standard GAL network.
Table 1. Yeast Strains and Plasmids strain or plasmid Strain BY4741 BY4741gal1Δ BY4741gal80Δ DG1-EG DG1-FB DGΔ80-EG DGΔ80-FB DG1-FB3 DG2-EG DG2-FB Plasmid pESC-URA pEMU1-EGFP pEMU-1EG-10G3c pEMU-1EG-3G3c
description
reference
MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 BY4741gal1Δ::kanMX4 BY4741gal80Δ::kanMX4 BY4741gal1Δ harboring pEMU1-EGFP BY4741gal1Δ harboring pEMU-1EG-10G3c BY4741gal80Δ harboring pEMU1-EGFP BY4741gal80Δ harboring pEMU-1EG-10G3c BY4741gal1Δ harboring pEMU-1EG-3G3c BY4741gal1Δ chromosomally integrating the DNA cassette at the his3Δ1 locus to express GFP gene under the control of GAL1 promoter BY4741gal1Δ chromosomally integrating the DNA cassette at the his3Δ1 locus to express GFP and GAL3c genes under the control of GAL1 and GAL10 promoters
Brachmann et al. 199815 Winzeler et al. 199916 Winzeler et al. 199916 This study This study This study This study This study This study
Multicopy yeast expression vector with GAL1−GAL10 divergent promoters EGFP expression by GAL1 promoter in pESC-URA EGFP and GAL3c expression by (respectively) GAL1 and GAL10 promoters in pESC-URA EGFP and GAL3c expression by (respectively) GAL1 and GAL3 promoters in pESC-URA
Agilent Technologies This study This study This study
This study
Gal3c, thereby, triggering a chain reaction of GAL3c-mediated positive feedback induction of the GAL regulatory network (Figure 1B). We show that the engineered yeast cells amplify the galactose response, resulting in substantial enrichment of GAL induction at lower concentrations, or even in the absence, of galactose, while retaining the strictly regulated glucose repression of the GAL system. We used yeast strain BY4741gal1Δ15,16 as the host strain; the deletion of the endogenous GAL1 (encoding galactokinase, which is involved in the first step of galactose catabolism) is known to reduce the consumption of the inducer, galactose.17 To test the positive feedback GAL expression system, we
incorporated into the GAL regulatory network. In the present study, we made green fluorescent protein (GFP) a reporter of GAL induction by placing the GFP gene downstream of the GAL1 promoter (Figure 1B). To build the artificial circuit for positive feedback of GAL induction, we further engineered the yeast to express a constitutively active Gal3 mutant protein (Gal3c)10,14 under control of the GAL10 promoter (Figure 1B). In the resulting strain, galactose-induced Gal4 transcriptional activation (by Gal3*) induces the expression of Gal3c (via the GAL10 promoter) as well as that of GFP (via the GAL1 promoter). The expressed Gal3c sequesters Gal80 away from Gal4. The released Gal4 further induces expression of GFP and B
DOI: 10.1021/acssynbio.6b00262 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Letter
ACS Synthetic Biology
Figure 2. GFP expression in recombinant gal1Δ yeast transformants grown in the presence of various concentrations of galactose. DG1-EG harboring a multicopy pEMU1-EGFP plasmid that expressed only the GFP gene under the control of GAL1 promoter was used as the conventional GAL expression strain. DG1-FB harboring a multicopy pEMU-1EG-10G3c plasmid that expresses the GFP and GAL3c genes under the respective control of the divergent GAL1 and GAL10 promoters was used as the positive feedback GAL expression strain. The recombinant yeast strains were grown in SGG selection media containing the indicated concentrations of galactose for 18 h (A), 24 h (B), and 42 h (C). The green fluorescence signal of 10 000 cells were analyzed by a FACSCanto II flow cytometer. The data shown represent the mean ± SD of three independent experiments.
constructed a multicopy plasmid (designated pEMU-1EG10G3c) that expresses the GFP and GAL3c genes under the respective control of the divergent GAL1 and GAL10 promoters (Table 1). For comparison, we also constructed a multicopy plasmid (designated pEMU1-EGFP) that expressed only the GFP gene under the control of GAL1 promoter (Table 1) as part of the conventional GAL expression system. pEMU1EG-10G3c and pEMU1-EGFP were introduced into the BY4741gal1Δ yeast strain, generating transformants designated DG1-FB (positive feedback strain) and DG1-EG (control EGFP strain), respectively (Table 1). After precultivation in SD glucose selection medium, the yeast transformants were inoculated and grown in glycerol selection media lacking glucose but containing galactose at various concentrations (SGG selection media). The GFP expression levels were estimated by measuring, using a flow cytometer, the green fluorescence intensities of yeast cells in each culture (Figure 2). The control yeast strain DG1-EG exhibited obvious green fluorescence in the presence of galactose at concentrations of 0.02% or higher; fluorescence was not detected in the presence of lower galactose concentrations (Figure 2A−C). When galactose was added to 2%, the mean (n = 3) fluorescence intensities of the cells reached approximately 1900 (18 h), 2900 (24 h), and 5900 (42 h) units. When galactose was added to 0.02%, mean fluorescence intensities reached approximately 900, 1300, and 3700 units at the respective time points. On the other hand, the positive feedback strain DG1-FB grown in any concentration of galactose displayed obvious green fluorescence, even in the absence of galactose (Figure 2A−C). When galactose was added to 2%, the mean fluorescence intensities were similar to those of the control DG1-EG yeast strain. When galactose was added to 0.02%, DG1-FB yielded fluorescence intensities (1300 at 18 h, 2100 at 24 h, and 5100 at 42 h) that were approximately 50% higher than those seen at the respective time points with the DG1-EG control strain. Surprisingly, even when galactose was added to only 0.0002%, the DG1-FB strain showed fluorescent intensities similar to those obtained for the same strain grown in 0.02% galactose; in contrast, in the presence of 0.002% or less galactose, the DG1-EG control strain exhibited no detectable fluorescence. Thus, the DG1-FB positive feedback strain grown in 0.0002% galactose provided higher
levels of GFP expression than seen with the conventional DG1EG strain grown in 0.02% galactose. Furthermore, the DG1-FB strain cultured in glycerol medium (0% galactose) showed green fluorescence despite the absence of galactose, although the fluorescence intensities were nominally lower than those grown in 0.0002% galactose (Figure 2A−C). These results indicated that the incorporation of the positive feedback circuit into the GAL induction network enabled substantially enriched protein production under the control of the GAL1 promoter at low levels, or even in the absence, of galactose. Thus, the positive feedback circuit provided via the GAL3c gene amplified the galactose response of the GAL induction system. Despite the appeal of enhanced expression in the absence of galactose, this system would be unsuitable for the production of toxic proteins if expression reflected leaky (poorly repressed) expression. Therefore, we further tested whether the positive feedback GAL expression system retained strictly regulated repression in the presence of glucose (with or without galactose). After precultivation in SD glucose selection medium, the DG1-FB and DG1-EG strains were inoculated and grown in the same SD medium (lacking galactose) for 6 h. Then, the cells were collected, washed, and transferred into the SGG glycerol selection media containing various concentrations of galactose, and the time courses of fluorescence intensity and optical density (cell growth) were measured (Figure 3). Both strains grew slowly in the glycerol/galactose media, although the growth rates appeared to differ slightly depending on the galactose concentration (Figure 3A−F). The DG1-EG control strain exhibited no detectable fluorescence at galactose concentrations of 0.002% or less (Figure 3A−C) but showed green fluorescence in the presence of galactose at concentration of 0.02% or higher (Figure 3D−F). Fluorescence intensities were nominally higher (at the respective time points) in 0.2% galactose compared to 0.02% galactose, but appeared to be attenuated at the highest tested inducer concentration (Figures 3D−F). Notably, fluorescence intensities peaked or even fell at later time points in these cultures (Figures 3D−F). This pattern presumably reflected full assimilation of galactose by 96−120 h, with subsequent plateauing or loss of cell growth. In contrast, the DG1-FB positive feedback strain showed green fluorescence at all of the tested galactose concentrations, C
DOI: 10.1021/acssynbio.6b00262 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Letter
ACS Synthetic Biology
Figure 3. GFP expression by recombinant gal1Δ yeast transformants after medium exchange (from glucose medium into glycerol/galactose medium). DG1-EG harboring a multicopy pEMU1-EGFP plasmid that expressed only GFP gene under the control of GAL1 promoter was used as the conventional GAL expression strain. DG1-FB harboring a multicopy pEMU-1EG-10G3c plasmid that expresses GFP and GAL3c genes under the respective control of the divergent GAL1 and GAL10 promoters was used as the positive feedback GAL expression strain. The recombinant yeast strains were grown in SD glucose selection medium for 6 h, and then transferred into SGG glycerol/galactose selection media containing galactose at 0% (A), 0.0002% (B), 0.002% (C), 0.02% (D), 0.2% (E), and 2% (F). The green fluorescence signal of 10 000 cells were analyzed by a FACSCanto II flow cytometer, and the values of OD600 (cell growth) were monitored. The data shown represent the mean ± SD of three independent experiments.
GAL3c gene retains strictly regulated glucose repression along with the enhanced galactose response. Additionally, we performed the induction experiments by a quick galactose pulse to further assess the capability of the positive feedback circuit using GAL3c gene (Figure S1). After cultivation in SD glucose medium, DG1-EG and DG1-FB strains were washed and transferred into SRG raffinosegalactose medium or SD glucose medium for pulse induction. The cells were cultured for 2.5 h in each medium, washed again, transferred into SR raffinose medium (to avoid glucose repression) and cultured, and then the GFP expression levels were measured over time. As shown in Figure S1, DG1-FB positive feedback strain showed vibrant GFP expression after galactose pulse (SRG medium), whereas DG1-EG control strain never expressed GFP both after galactose and glucose pulse. Interestingly, DG1-FB strain also displayed the moderate
including cultures lacking galactose (Figure 3A−F). At galactose concentrations of 0.2% or less, fluorescence intensities continued to rise throughout the time course. In contrast, cultures grown in 2% galactose (Figure 3F) exhibited attenuated fluorescence compared to the same strain grown at lower inducer levels; additionally, this culture showed decreasing fluorescence at later time points, as seen with the control strain. Thus, these cultures of the positive feedback strain exhibited similar per-cell fluorescence intensities at a wide-range of galactose concentrations, extending even to growth in the absence of galactose (Figure 3A). Moreover, the DG1-FB strain did not exhibit leaky GFP expression, as demonstrated by the lack of detectable fluorescence at the 0-h time point, that is, at the time of medium exchange (from +glucose −galactose medium) (Figure 3A−F). These results suggested that the positive feedback circuit incorporating the D
DOI: 10.1021/acssynbio.6b00262 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Letter
ACS Synthetic Biology
Figure 4. GFP expression by recombinant gal1Δ yeast transformants in glucose/galactose (0.5% glucose and various concentrations of galactose) mixed medium without medium exchange. DG1-EG harboring a multicopy pEMU1-EGFP plasmid that expressed only GFP gene under the control of GAL1 promoter was used as the conventional GAL expression strain. DG1-FB harboring a multicopy pEMU-1EG-10G3c plasmid that expresses GFP and GAL3c genes under the respective control of the divergent GAL1 and GAL10 promoters was used as the positive feedback GAL expression strain. The recombinant yeast strains were grown in SDG2 selection media containing 0.5% glucose and galactose at 0% (A), 0.0002% (B), 0.002% (C), 0.02% (D), 0.2% (E), and 2% (F). The green fluorescence signal of 10 000 cells were analyzed by a FACSCanto II flow cytometer, and the values of OD600 (cell growth) were monitored. The data shown represent the mean ± SD of three independent experiments.
GFP expression after glucose pulse (SD medium). This indicates that our positive feedback circuit using GAL3c gene can trigger the induction initiation in the absence of glucose and automatically accelerate the positive-loop of target gene transcription activation (Figure S1). We further tested gal80Δ yeast strain to compare the induction level with the positive feedback strain using GAL3c gene. The deletion of Gal80 repressor invokes the constitutive induction of Gal4 transcriptional activity in the absence of galactose. It has reported that the gal80Δstrain showed approximately 100-fold induction ratio of the protein expression upon removal of glucose.18 After precultivation in SD glucose medium, DGΔ80-EG and DGΔ80-FB strains (generated by transforming BY4741gal80Δ yeast with pEMU1EGFP and pEMU-1EG-10G3c) (Table 1) were grown in glycerol selection medium lacking galactose (SGly medium) and the GFP expression levels were measured (Figure S2). The
induction ratios of DGΔ80-EG and DGΔ80-FB were respectively 157- and 162-fold (Figure S2), whereas DG1-FB positive feedback strain using GAL3c (BY4741gal1Δ harboring pEMU-1EG-10G3c) showed much higher induction ratio (405fold) in the same medium (Figure 3A). Subsequently, we tested the replacement of the GAL10 promoter with GAL3 promoter to express the GAL3c gene, because the GAL3 promoter has been known to allow fast and efficient induction kinetics in response to galactose.19 After precultivation in SD glucose medium, DG1-FB3 strain (generated by transforming BY4741gal1Δ yeast with pEMU1EG-3G3c) (Table 1) was grown in glycerol media containing galactose at several concentrations (SGG selection media) and the GFP expression levels were measured (Figure S3). However, we could not find the improvement owing to the faster and efficient induction kinetics of GAL3 promoter in this culture condition (Figure S3 and Figure 3). E
DOI: 10.1021/acssynbio.6b00262 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Letter
ACS Synthetic Biology Further, we tested the chromosomal integration for GFP gene and/or GAL3c gene. The expression cassettes to express only the GFP gene (under the control of the GAL1 promoter) and both the GFP and GAL3c genes (under the respective control of the divergent GAL1 and GAL10 promoters) were respectively integrated into the his3Δ1 locus of BY4741gal1Δ, generating DG2-EG (control EGFP) and DG2-FB (positive feedback) yeast strains (Table 1). After precultivation in YPD glucose medium, DG2-EG and DG2-FB were grown in the YPGG glycerol media containing various concentrations of galactose and the GFP expression levels were measured (Figure S4). DG2-FB positive feedback strain successfully displayed higher GFP expressions than DG2-EG control strain in the presence of 0.002% or less galactose in the YP rich glycerol media, although DG2-FB showed lower GFP expressions than DG2-EG in the presence of 0.2% or higher galactose. Because the DG2-FB positive feedback strain exhibited enigmatic growth improvements in the presence of 0.002−0.2% galactose, this unclear phenotype (might be arising from the chromosomal integration of Gal3c expression cassette) has the possibility to have engaged with the plateaued GFP expressions in the DG2-FB strain under the presence of the higher concentrations of galactose. When comparing with the plasmid retaining DG1EG and DG1-FB strains (Figure 3), chromosomal integrating DG2-EG and DG2-FB strains showed moderately lower levels of GFP expressions (Figure S4), although DG2-EG and DG2FB displayed higher uniformities regarding to the heterogeneities of GFP expressions in cell ensembles than DG1-EG and DG1-FB (Figure S5A and S5B). Finally, we tested whether the positive feedback circuit worked in the glucose/galactose mixed media to simplify the cultivation and induction procedures. After precultivation in SD glucose medium, DG1-EG and DG1-FB (plasmid retaining) strains (Table 1) were grown in SDG1 and SDG2 selection media respectively containing 2% glucose and 0.5% glucose with various concentrations of galactose, and the time courses of fluorescence intensity and optical density (cell growth) were measured (Figure S6 and Figure 4). The strains grew well both in the mixed media containing 2% and 0.5% glucose. The growth rates were much higher when compared to the SGG glycerol media (Figure 3). Whereas both DG1-EG and DG1FB cells grown in SDG1 (2% glucose) media hardly exhibited GFP expressions in any galactose concentrations (Figure S6), both cells grown in SDG2 (0.5% glucose) media displayed of the GFP expressions (Figure 4). The changes in fluorescence intensities over time were almost similar to the SGG glycerol media (Figure 3 and Figure 4). Thus, the positive feedback circuit using GAL3c gene also worked in the glucose/galactose mixed media. Since the cultivations using SDG2 media containing 0.5% glucose never required the medium exchanges, this cultivation procedure could make it easy for the GAL induction using the positive feedback of Gal3c expression. In conclusion, we established the GAL expression system with a positive feedback loop using the constitutively active Gal3 mutant protein, Gal3c. The placement of the GAL3c gene downstream of the GAL10 promoter successfully amplified the galactose response of the GAL induction system and drastically enriched the expression level of the target GFP gene under the control of the GAL1 promoter. This simple but powerful genetic circuit enables the substantial induction of the target gene at extremely low levels, or even in the absence, of the galactose inducer, while maintaining the strictly regulated glucose repression. This GAL3c-mediated positive feedback
GAL expression system is expected to be of use in industrial applications requiring high-level recombinant protein production.
■
METHODS Culture Media. YPD medium contained 1% yeast extract (Nacalai Tesque, Kyoto, Japan), 2% Bacto peptone (BD Biosciences, San Jose, CA, USA), and 2% glucose. SD selection medium contained 0.67% yeast nitrogen base without amino acids (YNB) (BD Biosciences) and 2% glucose. SR selection medium contained 0.67% YNB and 2% raffinose. SRG selection medium contained 0.67% YNB, 2% raffinose and 2% galactose. SGly selection medium contained 0.67% YNB and 2% glycerol. SGG selection media contained 0.67% YNB, 2% glycerol, and the indicated concentrations of galactose. SDG1 selection media contained 0.67% YNB, 2% glucose, and the indicated concentrations of galactose. SDG2 selection media contained 0.67% YNB, 0.5% glucose, and the indicated concentrations of galactose. The selection media were supplemented with amino acids and nucleotide (20 mg/L histidine, 60 mg/L leucine, and 20 mg/L methionine; without uracil) to provide complementation of the relevant auxotrophies. YPGG media contained 1% yeast extract, 2% Bacto peptone, 2% glycerol, and the indicated concentrations of galactose. Plasmid Construction. All plasmids used in this study are summarized in Table 1. The DNA fragment encoding the EGFP gene was amplified from pGK426-EGFP20 with oligonucleotides (5′-ttttggatccatggtgagcaagggcgaggagctgt-3′ and 5′-ccccaagcttttacttgtacagctcgtccatgccg-3′), and was inserted between the BamHI and HindIII sites of multiple cloning site 2 (MCS2) (downstream of the GAL1 promoter) of pESC-URA (Agilent Technologies, Santa Clara, CA, USA), yielding pEMU1-EGFP. The DNA fragment GAL3c gene was amplified from pBlue-GAL3c21 with oligonucleotides (5′-ggggagcggccgcatgaatacaaacgttccaat-3′ and 5′-ggggggagctcttattgttcgtacaaacaag-3′), and was inserted between the NotI and SacI sites of MCS1 (downstream of the GAL10 promoter) of pEMU1EGFP, yielding pEMU-1EG-10G3c. The DNA fragment containing ADH1 terminator and GAL10/GAL1 divergent promoters, EGFP gene and CYC1 terminator was amplified from pEMU1-EGFP with oligonucleotides (5′-gggcctcttcgctattacgccagctgaattggagcgacctcatgctatacc-3′ and 5′-attttacagattttatgtttagatcgatcttcgagcgtcccaaaaccttc-3′). The DNA fragment containing GAL3 promoter, GAL3c gene and GAL3 terminator was amplified by overlap PCR from BY4741 genomic DNA with oligonucleotide pairs (5′-gaaggttttgggacgctcgaagatcgatctaaacataaaatctgtaaaat-3′ and 5′-ccaaggcaggcttcgGaactataattgcgt3′, and 5′-acgcaattatagttCcgaagcctgccttgg-3′ and 5′-cgttggccgattcattaatgcagctggcgtagtcactattagtaataccaa-3′). These two fragments were simultaneously linked and inserted into the PvuII-digested pEMU1-EGFP vector using In-fusion HD Cloning Kit (Takara Bio, Shiga, Japan), yielding pEMU-1EG3G3c. The DNA fragment containing GAL3c gene, GAL10/ GAL1 divergent promoters and EGFP gene was prepared by digestion of pEMU-1EG-10G3c with SacI and SalI, and was inserted between the same sites of pGAL1pt-EGFP,21 yielding yGAL1pt-EG-10p-G3c. The DNA fragment GAL10 terminator was amplified from BY4741 genomic DNA with oligonucleotides (5′-aagggggagctctttgccagcttactatcctt-3′ and 5′-ggggaagagctccccgggttaaggaaaatgacagaaaa-3′), and was inserted into the SacI site of yGAL1pt-EG-10p-G3c, yielding pGAL1pt-EG-10ptG3c. F
DOI: 10.1021/acssynbio.6b00262 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Letter
ACS Synthetic Biology
(OD600 = 0.1) and were grown for 3.5 h at 30 °C with shaking at 150 rpm. The cells were collected, washed twice, and transferred into 20 mL of YPGG media containing the indicated concentrations of galactose and were grown at 30 °C with shaking at 150 rpm. Aliquots of cells were collected at the indicated time points through 168 h and assessed for cell growth (OD600) and GFP expression. For cultures in glucose/ galactose mixed media, precultivated cells in SD selection medium were inoculated into 20 mL of SDG1 (2% glucose) or SDG2 (0.5% glucose) selection media containing the indicated concentrations of galactose to give an initial optical density of 0.1 at 600 nm (OD600 = 0.1) and were grown at 30 °C with shaking at 150 rpm. Aliquots of cells were collected at the indicated time points through 192 h and assessed for cell growth (OD600) and GFP expression. GFP Measurements. The measurement of GFP fluorescence intensity followed the previously published procedure.23 In brief, collected cells were suspended in 1 mL of sheath solution, and GFP fluorescence was analyzed by the BD FACSCanto II flow cytometer equipped with a 488 nm blue laser (BD Biosciences). The GFP fluorescence signal was collected through a 530/30 nm band-pass filter and the fluorescence intensity was defined as the GFP-A mean of 10 000 cells. The data were analyzed using the BD FACSDiva software v5.0 (BD Biosciences) and the FlowJo software version 7.2.2 (Treestar, Inc., San Carlos, CA, USA).
Yeast Strain and Transformants. Yeast strain BY4741gal1Δ and BY4741gal80Δ (Table 1), which were used as the parental strains, were obtained from the Saccharomyces Genome Deletion Project.16 The transformation procedures followed the lithium acetate method.22 The BY4741gal1Δ transformants harboring pEMU1-EGFP, pEMU-1EG-10G3c and pEMU1EG-3G3c were designated DG1-EG, DG1-FB and DG1FB3, respectively (Table 1). The BY4741gal80Δ transformants harboring pEMU1-EGFP and pEMU-1EG-10G3c were designated DGΔ80-EG and DGΔ80-FB, respectively (Table 1). The DNA cassette to express the GFP gene under the control of GAL1 promoter was amplified from pGAL1pt-EGFP with oligonucleotides (5′-agtatcatactgttcgtatacatacttactgacattcataggtatacatatatacacatgtatatatatcgtatgctgcagctttaaataatcggtgtcaacatggcattaccaccatatacata-3′ and 5′-attggcattatcacataatgaattatacattatataaagtaatgtgatttcttcgaagaatatactaaaaaatgagcaggcaagataaacgaaggcaaagttcgaaccgaaagatcttctctatg-3′), and transformed BY4741gal1Δ to chromosomally integrate it into the his3Δ1 locus using URA3 marker, yielding DG2-EG yeast strain (Table 1). The DNA cassette to express the GFP and GAL3c genes under the respective control of the divergent GAL1 and GAL10 promoters was amplified from pGAL1ptEG-10pt-G3c with oligonucleotides (5′-agtatcatactgttcgtatacatacttactgacattcataggtatacatatatacacatgtatatatatcgtatgctgcagctttaaataatcggtgtcattaaggaaaatgacagaaaatatat-3′ and 5′-attggcattatcacataatgaattatacattatataaagtaatgtgatttcttcgaagaatatactaaaaaatgagcaggcaagataaacgaaggcaaagttcgaaccgaaagatcttctctatg-3′), and transformed BY4741gal1Δ to chromosomally integrate it into the his3Δ1 locus using URA3 marker, yielding DG2-FB yeast strain (Table 1). Culture Conditions. For cultures without medium exchange, precultivated cells in SD selection medium were inoculated into 3 mL of SGG selection media containing the indicated concentrations of galactose to give an initial optical density of 0.1 at 600 nm (OD600 = 0.1) and were grown at 30 °C with shaking at 150 rpm. Cells were collected at 18, 24, and 42 h to evaluate GFP expression. For cultures with medium exchange, precultivated cells in SD selection medium were inoculated into 20 mL of SD selection medium to give an initial optical density of 0.1 at 600 nm (OD600 = 0.1) and were grown for 6 h at 30 °C with shaking at 150 rpm. The cells were collected, washed twice, and transferred into 20 mL of SGG media containing the indicated concentrations of galactose and were grown at 30 °C with shaking at 150 rpm. Aliquots of cells were collected at the indicated time points through 168 h and assessed for cell growth (OD600) and GFP expression. For quick pulse induction experiments, precultivated cells in SD selection medium were inoculated into 5 mL of fresh SD selection medium to give an initial optical density of 0.1 at 600 nm (OD600 = 0.1) and were grown for 8 h at 30 °C with shaking at 150 rpm. Then, the cells were collected, washed twice, resuspended with 1 mL of distilled water, and 500 μL of cell suspensions were transferred into 5 mL of SRG raffinosegalactose or SD glucose selection media and were grown for 2.5 h for pulse induction. The cells were collected again, washed twice, resuspended with 1 mL of distilled water, and the total amounts of cell suspensions were transferred into 20 mL of SR selection medium and were grown at 30 °C with shaking at 150 rpm. Aliquots of cells were collected at the indicated time points throughout the experiment and assessed for GFP expression. For chromosomally integrated strains, precultivated cells in YPD medium were inoculated into 20 mL of YPD medium to give an initial optical density of 0.1 at 600 nm
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.6b00262. Figures S1−S6 (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*Fax: +81 78 803 6196. Tel: +81 78 803 6196. E-mail:
[email protected]. ORCID
Akihiko Kondo: 0000-0003-1527-5288 Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by the Special Coordination Funds for Promoting Science and Technology, Creation of Innovation Centers for Advanced Interdisciplinary Research Areas (Innovative Bioproduction Kobe; iBioK) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT); and, in part, by the Commission for Development of Artificial Gene Synthesis Technology for Creating Innovative Biomaterials from the Ministry of Economy, Trade and Industry (METI), Japan.
■
ABBREVIATIONS
Gal3*, galactose-bound Gal3; Gal3c, constitutively active Gal3 mutant protein; GFP, green fluorescent protein; GRAS, generally recognized as safe; MCS, multiple cloning site; UAS, upstream activation sequence G
DOI: 10.1021/acssynbio.6b00262 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Letter
ACS Synthetic Biology
■
(20) Ishii, J., Izawa, K., Matsumura, S., Wakamura, K., Tanino, T., Tanaka, T., Ogino, C., Fukuda, H., and Kondo, A. (2009) A simple and immediate method for simultaneously evaluating expression level and plasmid maintenance in yeast. J. Biochem. 145, 701−708. (21) Ryo, S., Ishii, J., Iguchi, Y., Fukuda, N., and Kondo, A. (2012) Transplantation of the GAL regulon into G-protein signaling circuitry in yeast. Anal. Biochem. 424, 27−31. (22) Gietz, D., St, Jean, A., Woods, R. A., and Schiestl, R. H. (1992) Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20, 1425. (23) Ishii, J., Yoshimoto, N., Tatematsu, K., Kuroda, S., Ogino, C., Fukuda, H., and Kondo, A. (2012) Cell wall trapping of autocrine peptides for human G-protein-coupled receptors on the yeast cell surface. PLoS One 7, e37136.
REFERENCES
(1) Celik, E., and Calık, P. (2012) Production of recombinant proteins by yeast cells. Biotechnol. Adv. 30, 1108−1118. (2) Young, C. L., and Robinson, A. S. (2014) Protein folding and secretion: mechanistic insights advancing recombinant protein production in S. cerevisiae. Curr. Opin. Biotechnol. 30, 168−177. (3) Hasunuma, T., Ishii, J., and Kondo, A. (2015) Rational design and evolutional fine tuning of Saccharomyces cerevisiae for biomass breakdown. Curr. Opin. Chem. Biol. 29, 1−9. (4) de Ruijter, J. C., Koskela, E. V., and Frey, A. D. (2016) Enhancing antibody folding and secretion by tailoring the Saccharomyces cerevisiae endoplasmic reticulum. Microb. Cell Fact. 15, 87. (5) Hou, J., Tyo, K., Liu, Z., Petranovic, D., and Nielsen, J. (2012) Engineering of vesicle trafficking improves heterologous protein secretion in Saccharomyces cerevisiae. Metab. Eng. 14, 120−127. (6) Sugiyama, K., Niki, T. P., Inokuchi, K., Teranishi, Y., Ueda, M., and Tanaka, A. (2004) Heterologous expression of metabotropic glutamate receptor subtype 1 in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 64, 531−536. (7) de Ruijter, J. C., and Frey, A. D. (2015) Analysis of antibody production in Saccharomyces cerevisiae: effects of ER protein quality control disruption. Appl. Microbiol. Biotechnol. 99, 9061−9071. (8) Ahn, J., Park, K. M., Lee, H., Son, Y. J., and Choi, E. S. (2013) GAL promoter-driven heterologous gene expression in Saccharomyces cerevisiae Δ strain at anaerobic alcoholic fermentation. FEMS Yeast Res. 13, 140−142. (9) Park, M. A., Kim, H. J., and Kim, H. J. (2008) Optimum conditions for production and purification of human papillomavirus type 16 L1 protein from Saccharomyces cerevisiae. Protein Expression Purif. 59, 175−181. (10) Diep, C. Q., Tao, X., Pilauri, V., Losiewicz, M., Blank, T. E., and Hopper, J. E. (2008) Genetic evidence for sites of interaction between the Gal3 and Gal80 proteins of the Saccharomyces cerevisiae GAL gene switch. Genetics 178, 725−736. (11) Ramsey, S. A., Smith, J. J., Orrell, D., Marelli, M., Petersen, T. W., de Atauri, P., Bolouri, H., and Aitchison, J. D. (2006) Dual feedback loops in the GAL regulon suppress cellular heterogeneity in yeast. Nat. Genet. 38, 1082−1087. (12) Yang, R., Lenaghan, S. C., Wikswo, J. P., and Zhang, M. (2011) External control of the GAL network in S. cerevisiae: a view from control theory. PLoS One 6, e19353. (13) Prasad, V., and Venkatesh, K. V. (2008) Stochastic analysis of the GAL genetic switch in Saccharomyces cerevisiae: modeling and experiments reveal hierarchy in glucose repression. BMC Syst. Biol. 2, 97. (14) Blank, T. E., Woods, M. P., Lebo, C. M., Xin, P., and Hopper, J. E. (1997) Novel Gal3 proteins showing altered Gal80p binding cause constitutive transcription of Gal4p-activated genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 17, 2566−1575. (15) Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P., and Boeke, J. D. (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14, 115−132. (16) Winzeler, E. A., et al. (1999) Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285, 901−906. (17) Kim, M. D., Lee, T. H., Lim, H. K., and Seo, J. H. (2004) Production of antithrombotic hirudin in GAL1-disrupted Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 65, 259−262. (18) Johnston, M., Flick, J. S., and Pexton, T. (1994) Multiple mechanisms provide rapid and stringent glucose repression of GAL gene expression in Saccharomyces cerevisiae. Mol. Cell. Biol. 14, 3834− 3841. (19) Hsu, C., Scherrer, S., Buetti-Dinh, A., Ratna, P., Pizzolato, J., Jaquet, V., and Becskei, A. (2012) Stochastic signalling rewires the interaction map of a multiple feedback network during yeast evolution. Nat. Commun. 21, 682. H
DOI: 10.1021/acssynbio.6b00262 ACS Synth. Biol. XXXX, XXX, XXX−XXX
