pPB Peptide-Mediated siRNA-Loaded Stable ... - ACS Publications

Shanghai Engineering Research Center of Molecular Therapeutics and New Drug Development, School of Chemistry and Molecular Engineering, East China Nor...
1 downloads 6 Views 3MB Size
Download PDF
Article Cite This: Mol. Pharmaceutics XXXX, XXX, XXX−XXX

pPB Peptide-Mediated siRNA-Loaded Stable Nucleic Acid Lipid Nanoparticles on Targeting Therapy of Hepatic Fibrosis Zongxiang Jia,∇,† Yan Gong,∇,‡ Yufang Pi,† Xueying Liu,† Lipeng Gao,† Liqing Kang,† Jing Wang,† Fan Yang,† Jie Tang,† Weiyue Lu,§ Qinghua Li,∥ Wei Zhang,⊥ Zhiqiang Yan,*,† and Lei Yu*,† †

Shanghai Engineering Research Center of Molecular Therapeutics and New Drug Development, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200062, P.R. China ‡ Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai 200040, P.R. China § Department of Pharmaceutics, School of Pharmacy, Fudan University & Key Laboratory of Smart Drug Delivery, Fudan University, Ministry of Education, Shanghai 201203, P.R. China ∥ Department of Hepatology and Pancreatology, Shanghai East Hospital, Tongji University, Shanghai 200120, P.R. China ⊥ Key Laboratory of Brain Functional Genomics, Ministry of Education, Shanghai Key Laboratory of Brain Functional Genomics, School of Life Science, East China Normal University, Shanghai 200062, P.R. China ABSTRACT: Hepatic fibrosis is a necessary process in the development of liver diseases such as hepatic cirrhosis and its complications, which has become a serious threat to human health. Currently, antifibrotic drug treatment is ineffective, and one reason should be the lack of liver targeting ability. In this report, polypeptide pPB-modified stable nucleic acid lipid nanoparticles (pPB-SNALPs) were prepared to selectively deliver siRNAs against heat shock protein 47 to the liver for targeted therapy of hepatic fibrosis. First, siRNA sequences with high silencing efficiency were screened based on siRNA transfection efficacy. Then, pPB-SNALPs were prepared, which showed a narrow size distribution with a diameter in the range of 110−130 nm and a neutral z-potential of 0 mV. As evidenced by the in vitro and in vivo targeting study, compared with unmodified SNALP, pPBSNALP showed increased uptake by LX-2 cells and primary hepatic stellate cells (HSC) of mice in vitro and showed increased liver distribution and HSC uptake in vivo. In addition, pPB-SNALP also exhibited an enhanced inhibitory effect on TAA-induced hepatic fibrosis mice with high gp46 mRNA expression in vivo. In summary, our results demonstrated that pPB-SNALP is an effective liver-targeted delivery system. This study could lay a good foundation for the targeted gene therapy of hepatic fibrosis. KEYWORDS: hepatic fibrosis, stable nucleic acid lipid nanoparticles (SNALPs), siRNA, pPB, targeting therapy

1. INTRODUCTION Hepatic fibrosis refers to the pathological changes caused by a variety of chronic liver injuries, mainly including excessive deposition of extracellular matrix and fibrous connective tissue in liver.1 It is the only pathway in the development of cirrhosis, liver organ necrosis, and liver cancer from a variety of chronic liver diseases and complications.2,3 Hepatic fibrosis may be induced by viral hepatitis, alcoholic liver, fatty liver, and autoimmune diseases.2,4 It has led to a serious global health burden due to the lack of effective treatment with more than one million deaths in 2010.5 Until now, liver transplantation is the most effective therapeutic option, but it is unavailable most of the time due to the lack of proper liver sources.6 Currently, some new therapeutic approaches have been developed to reverse hepatic fibrosis.7,8 For example, it is reported that the formation of hepatic fibrosis could be suppressed by inhibiting the expression of cell-associated collagen. Heat shock protein 47 (HSP47) is a collagen-specific molecular chaperone in the endoplasmic reticulum.9 The © XXXX American Chemical Society

expression of HSP47 can be dramatically upregulated in liver fibrogenic pathophysiological conditions. Many studies have proven that HSP47 plays an essential role in the development of hepatic fibrosis. Therefore, HSP47 is a potential target for the treatment of hepatic fibrosis.10,11 RNAi is a sequence-specific manner to inhibit expression of homologous genes that results in gene silencing.12,13 The siRNA drugs have high efficiency and specificity, providing new means for the gene therapy of hepatic fibrosis. With in depth understanding of the molecular pathology of hepatic fibrosis, it becomes possible to develop siRNA drugs to reverse hepatic fibrosis.14,15 However, because of the presence of serum enzymes and high renal clearance, naked siRNA can be easily degraded in vivo.16 In addition, the gene silencing effect of Received: Revised: Accepted: Published: A

August 17, 2017 October 18, 2017 November 17, 2017 November 17, 2017 DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics

Figure 1. Design of this study. pPB peptide-modified SNALP loaded with siRNA (pPB-SNALP) for the targeted therapy of hepatic fibrosis.

the targeted gene therapy of hepatic fibrosis (Figure 1). We observed that pPB modification significantly increased the cellular uptake of SNALPs in vitro and gp46 gene silencing efficiency of siRNA in vivo.

siRNA is seriously hindered by off-target effects.17 To address these problems, the delivery systems based on cationic lipids and polymers have been widely studied recently.18,19 For instance, cationic liposomes and stable nucleic acid lipid nanoparticles (SNALPs) can take advantage of a positive charge to package negatively charged siRNA, thereby increasing the entrapment and transfection efficiency and delivering siRNA safely and effectively.20,21 Currently, there have been a dozen siRNA drug delivery systems under study.22 Because the liver is the major organ of lipid metabolism, lipid delivery systems are rather suitable for siRNA delivery to the liver.23,24 Despite this, plain liposomes and SNALPs have no specific selectiveness to liver, easily causing systemic side effects. Active targeting drug delivery systems have been widely studied in cancer therapy but less so in hepatic fibrosis treatment. pPB (amino acid sequence C*SRNLIDC*), a cyclic oligopeptide, has been shown to have a strong binding affinity with platelet-derived growth factor receptor β (PDGFRβ),25−27 which is overexpressed on activated hepatic stellate cells (HSC). PDGFR-β can be markedly upregulated in fibrous tissues, and its activity increases with the degree of hepatic fibrosis.28−30 In addition, pPB has been exploited as a targeting moiety to develop PDGFR-β homing sterically stable liposomes, which showed increased uptake by activated HSC and distribution in liver and an enhanced inhibitory effect on hepatic fibrosis.31,32 Therefore, the pPB peptide is an effective targeting molecule for hepatic fibrosis. In this study, we constructed a pPB peptide-modified SNALP delivery system (pPB-SNALP) to achieve targeted therapy of hepatic fibrosis. First, we screened out one siRNA sequence, which had high silencing efficiency to gp46, the rat homologue of human HSP47. Then, pPB-SNALPs loaded with the siRNA were prepared and used as the targeting delivery system for activated HSC by specific receptor−ligand binding, achieving

2. MATERIALS AND METHODS 2.1. Materials. 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC) and cholesterol were purchased from Avanti Polar Lipids (Alabaster, AL). Mal-PEG3400-DSPE was purchased from Laysan Bio, USA. Lipofectamine TM2000 kits and Trizol were purchased from Invitrogen, USA. DMEM medium and fetal bovine serum (FBS) were purchased from Gibco Co., USA. 5-Carboxyfluorescein (FAM) and 1,1′-dioctadecyl3,3,3′,3′tetramethyl indotricarbocyanine iodide (DiR) were purchased from Hundred Ying Biotechnology Co., Ltd. (Tianjin, China). C*SRNLIDC* (pPB) was purchased from Shanghai Amoy Cape Biological Technology Co. Rat antimouse α-SMA antibody and rhodamine-conjugated goat antirat IgG-R antibody were purchased from Jackson ImmunoResearch (PA). Polyethylene glycol-dimyristolglycerol (PEG-DMG) and dilinoleylmethyl-4-dimethylaminobutyrate (DLinMC3DMA) were given by East China Normal University Professor Tang Jie ethanol group. Thioacetamide (TAA) was purchased from Macklin Biochemical Co., Ltd. (Shanghai, China). All chemicals were analytic reagent grade. All siRNAs were synthesized by Rui Bo Biological Technology Co., Ltd. (Guangzhou, China). Three siRNA sequences are as follows: siRNA1, S5′(GCAGCAAGCAACACUACAAUU); AS3′(UUCGUCGUUCGUUGUGAUGUU); siRNA2, S5′(CAGGCCUGUACAACUACUAUU); AS3′(UUGUCCGGACAUGUUGAUGAU); siRNA3, S5′(CACACUGGGAUGAGAAAUUCC); AS3′(CGGUGUGACCCUACUCUUUAA). Human hepatic stellate cells LX-2 and mouse primary HSC cells were obtained from Shanghai World Ao Biotechnology B

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics

culture medium was replaced with serum-free medium; then, the three anti-gp46 siRNAs were transfected into cells mediated by Lipofectamine TM2000 according to the manufacturer’s instructions. Forty-eight hours following transfection, the expression of mRNA was assessed by the quantitative reverse transcription-polymerase chain reaction (qRT-PCR) method. Western blotting was performed on the total protein extracts of the NIH3T3 cells after 48 h of treatment. All transfection experiments were repeated three times. 2.4.2. Quantitative Reverse Transcription (qRT)-PCR. TRIzol reagent was used for total RNA extraction. An RTPCR kit was used for the RT reaction. Quantitative analysis was performed using β-actin as an internal reference. The primers for gp46 were as follows: forward, 5′-GCATGTCTGGCAAGAAGGACC-3′; reverse, 5′-AACCCTCATAGATGGGCACAGT-3′. For β-actin: forward, 5′-ACCGTGAAAAGATGACCCAGAT-3′; reverse, 5′-AACCCTCATAGATGGGCACAGT3′. The cycling program was 95 °C for 15 s, 95 °C for 5 s, 60 °C for 30 s (40 cycles). The relative level of RNA was computed using the 2−ΔΔCt analysis method. 2.4.3. Western Blot Analysis. Western blotting was performed on the total protein extracts of the NIH3T3 cells after 48 h of treatment. For the total protein fraction, the harvested cells were washed three times with ice-cold PBS, lysed in RIPA buffer, and then centrifuged at 12000g at 4 °C for 30 min. The supernatants were collected, and the micro BCA protein assay kits were used to determine protein concentrations in the supernatants. Equal amounts of proteins (20 μg) were separated by 10% sodium dodecyl sulfate (SDS)-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes. The PVDF membrane was blocked with 5% fatfree milk in tris-buffered saline with 0.05% (v/v) Tween-20 and probed with primary antibodies (HSP47, 1:500; β-actin, 1:3000) overnight at 4 °C. Next, the membrane was incubated with peroxidase-conjugated goat-antimouse antibody at room temperature for 45 min. Reactive bands were detected using enhanced chemiluminescence reagents. 2.5. Targeting Ability Study of pPB-SNALP. 2.5.1. Cellular Uptake of pPB-SNALP. Different cells (LX-2 cells and mouse primary HSC cells) were seeded into a 6-well plate (1 × 105 cells per well) and incubated with pPB-SNALP/FAM and SNALP/FAM in culture medium for 3 h, washed twice with PBS (pH 7.4), and then fixed with 4% (w/v) formaldehyde solution in PBS (pH 7.4). After DAPI (1.5 mg/mL in PBS) staining for 10 min, the cells were examined with a confocal microscope (LEICA, Germany). Intracellular uptake of nanoparticles was also characterized by FACS analysis. Twenty-four hours prior to the experiments, cells were inoculated on a 6-well plate at a density of 2 × 105 cells per well. The cells were exposed to free pPB-SNALP/ FAM and SNALP/FAM for 2 h, respectively. Then, the cells were collected, washed with PBS (pH 7.4) three times, and resuspended in PBS. The fluorescence of each cell was analyzed with a flow cytometer (FACS Vantage, Franklin Lakes, NJ). 2.5.2. Liver Uptake of pPB-SNALP. The TAA-induced high gp46 mRNA expression model was established by intraperitoneal injection of thioacetamide (TAA) saline solution (20 mg/mL) every other day in 9-week-old male Kunming mice at a dose of 150 mg/kg body weight for 15 days. For investigating the targeting ability of pPB-SNALP, pPB-SNALP/ DiR and SNALP/DiR were intravenously injected into mice. At predetermined time points, the mice were anesthetized and detected in the whole body using an in vivo imaging system

Limited, which were maintained in DMEM supplemented with 10% FBS and 100 U/mL of penicillin and 100 μg/mL of streptomycin at 37 °C in a 5% CO2 humidified atmosphere. Male Kunming mice 9 weeks age were purchased from Hayes Lake Laboratory Animal Co., Ltd. (Shanghai, China) and housed at 25 °C at 40−60% humidity with a 12 h light/dark cycle. All animal experiments were carried out in accordance with guidelines evaluated and approved by the Institutional Animal Care and Use Committee of East China Normal University. 2.2. Synthesis and Characterization of pPB-PEG-DSPE. pPB-PEG-DSPE was synthesized as follows: first, the linear thiolated Acm-protected pPB cyclic peptide (CC(Acm)SRNLIDC(Acm)) was synthesized by a BOC-protected solid phase peptide synthesis method.33 Then, the peptide was dissolved in PBS and covalently linked to the maleimide group of Mal-PEG-DSPE via the thiol of the unprotected cysteine. Then, the obtained product was purified by dialysis (3.5 kDa MWCO, Millipore) against distilled water. Next, by iodine oxidation reaction, the deprotection of Acm-protected thiol and formation of disulfide were accomplished. Finally, the reaction solution was dialyzed against distilled water to remove salts and lyophilized to obtain pPB-PEG-DSPE, which was characterized by 1H NMR and HPLC. 2.3. Preparation and Characterization of pPB-SNALP. 2.3.1. Preparation of pPB-SNALP. The compositions for pPBSNALPs were pPB-PEG-DSPE:DlinMC3:PEGDMG:DSPC:cholesterol in a mole percent ratio of 1:40:1:10:48, and the charge ratio of cationic lipid to siRNA was 7.60.34 The composition for unmodified SNALP did not contain pPB-PEG-DSPE, and the rest of the lipid ratio was unchanged. In brief, the SNALPs were prepared by the following procedure: lipids were dissolved in ethanol; anti-gp46 siRNA was dissolved in citrate buffer (pH 5), and citrate buffer (pH 6) was used as diluent. The lipid solution, siRNA solution, and diluent were warmed at 37 °C for 20 min. After that, they were mixed in a “T-shaped” connector34 at a volume ratio of 1:1:2 with the same speed; then, the mixture was loaded into an ultrafiltration centrifuge tube (10k) and centrifuged at 4000 rpm for 8 min. Subsequently, phosphate-buffered saline (PBS) was added to the tube to replace ethanol. 2.3.2. Characterization of pPB-SNALP. The particle sizes and polydispersity index (PDI) of both SNALPs were determined by dynamic light scattering (DLS) using a Mastersizer2000 (Malvern Instruments Inc., UK) equipped with He−Ne laser (4 mW, 633 nm) light source and 90° angle scattered-light collection configuration. The samples were diluted in PBS and completely absorbed into the surface charge test dish with pipettes. Then, the zeta potentials were tested by DLS. Transmission electron microscopy (TEM) was used to image the morphology of SNALPs and pPB-SNALPs. Briefly, a drop of SNALPs solution (0.5 mg/mL) was placed onto a copper grid coated with carbon deposits, tapped with filter paper to remove surface water, and followed by the application of 0.01 wt % phosphor tungstic acid to deposit the nanoparticles on the grid; then, the samples were air-dried before observation. The TEM test was performed with a JEM-2100 electron microscope (Hitachi, Tokyo, Japan). 2.4. Cell Transfection Study of Three siRNAs. 2.4.1. Cell Transfection. NIH3T3 cells were seeded into a 6-well plate (6 × 105 cells per well) and incubated in DMEM culture medium supplemented with 10% FBS and 1% S/P. The next day, cell C

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics (Bruker, Germany) equipped with IR820 filter sets (excitation/ emission, 730/790 nm). Fluorescence and X-ray images were fused together with Kodak Molecular Imaging Systems software v5.0.1. 2.5.3. Targeting Ability of pPB-SNALP to HSC in Vivo. Immunofluorescence staining analysis was used to study the targeting ability of pPB-SNALP to HSCs in vivo. The pPBSNALP/FAM and SNALP/FAM were intravenously injected into the model mice via the tail vein, respectively. At 2 h postinjection, the mice were anesthetized and killed, and the liver tissues were taken and embedded in OCT and then frozen sectioned. The slides were incubated with rat antimouse αSMA and then rhodamine-conjugated goat antirat IgG-R to label the HSC cells. After incubation with DAPI, the slides were imaged under a laser scanning confocal microscope (LEICA, Germany) to determine the tissue localization of FAM-labeled pPB-SNALP in fibrotic liver tissue. 2.6. Pharmacodynamic Study of pPB-SNALP. The pathogenesis of TAA-induced high gp46 mRNA expression model was assessed by H&E and Masson’s trichrome staining. The paraffin-embedded tissues were cut into sections of 5 μm thickness, deparaffinized, and hydrated in water. Serial sections were then performed with H&E and Masson’s trichrome staining according to standard protocols. The stained sections were examined and photoimaged with a bright field microscope (Eclipse E800, Nikon, Japan). The TAA-induced high gp46 mRNA expression model was developed by injecting TAA every other day for 15 days. From 24 h after the last injection of TAA, mice received intravenous injections of PBS, SNALP, or pPB-SNALP at a dose of 0.023 mg/kg of siRNA every other day for 2 weeks. Liver and serum were collected 48 h after the last injection. Liver was used for qRT-PCR and Western blot analysis, and serum was used for alanine transaminase (ALT) and aspartate transaminase (AST) analysis. 2.7. Biochemical Analysis of Serum Samples. Blood samples were collected intravenously. After centrifugation at 300g for 20 min, the serum samples were separated and stored in a deep freezer before use. The serum levels of ALT and AST were determined with ALT and AST kits, respectively. 2.8. Western Blot Analysis. For Western blot analysis, the frozen liver samples were minced in suitable lysis buffer and homogenized on an ice bath with a mortar. The homogenized lysate was left on ice for 30 min and centrifuged at 12000g and 4 °C for 30 min. The following steps were consistent with 2.4.2. The primary antibodies were α-SMA (1:500) and β-actin (1:3000). 2.9. Statistical Analysis. All experiments were replicated more than three times, and the resulting data were statistically analyzed by one-way analysis of variance (ANOVA) followed by LSD multiple comparison using the commercially available software of GraphPad Prism v6.02. Values marked with an asterisk are significantly different (*p < 0.05, **p < 0.01, ***p < 0.001).

Figure 2. NMR (A) and HPLC (B) spectra of Mal-PEG-DSPE (b) and pPB-PEG-DSPE (a). Mal-PEG-DSPE (A-b) presented a sharp peak of maleimide at 6.7 ppm, which disappeared in that of pPB-PEGDSPE (A-a). The retention time of mal-PEG-DSPE was 27.5 min (Bb), and that of pPB-PEG-DSPE was advanced to 20.4 min (B-a). Both NMR and HPC spectra suggested the successful synthesis of pPBPEG-DSPE.

reacted with the thiol group of pPB. The NMR result indicated the successful synthesis of pPB-PEG-DSPE. The HPLC result (Figure 2B) shows an illustrative chromatogram of Mal-PEG-DSPE and pPB-PEG-DSPE. The retention time of mal-PEG-DSPE was 27.5 min, and that of pPB-PEG-DSPE was advanced to 20.4 min. The shorten retention time should be caused by the introduction of the hydrophilic pPB peptides to mal-PEG-DSPE, suggesting the successful synthesis of pPB-PEG-DSPE. 3.2. Characterization of pPB-SNALP. The SNALP with or without pPB modification showed similar vesicle sizes, polydispersity indexes, and zeta potentials, indicating that the incorporation of pPB-PEG-DSPE into SNALP had no significant influence on the physical properties of nanoparticles. The particle had a small diameter for passing through the fenestrae (110−130 nm) in the sinusoidal endothelium of the liver,35 revealing that SNALP can be taken up by the liver effectively and avoid being engulfed by macrophages during systemic circulation. For the morphology of SNALPs to be observed, the particles were subjected to negative staining with phosphotungstic acid and then observed by TEM (Figure 3C). Both SNALPs and pPB-SNALPs showed well-defined spherical morphologies with particle sizes of around 50 nm, which were smaller than those determined by the DLS method. This should result from the particle size determined by DLS representing their hydrodynamic diameter and that obtained by TEM representing the collapsed nanoparticles after water evaporation. This result is also consistent with previous reports.25

3. RESULTS 3.1. Characterization of pPB-PEG-DSPE. The NMR spectrum of Mal-PEG-DSPE (Figure 2) showed the solvent peak of CDCl3 at 7.26 ppm, multiple peaks of methylene protons of DSPE at 1.26 ppm, and the characteristic peak of the Mal group at 6.7 ppm. However, the Mal peak disappeared in the spectrum of pPB -PEG-DSPE, whereas other peaks remained unchanged, indicating that the Mal group had D

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics

percentage of FAM-positive cells in LX-2 cells increased from 16.13 to 56.5%, the percentage increased from 25.9 to 61.5% in mouse primary HSC cells. These results indicated an active targeting role of pPB in pPB-SNALP uptake by LX-2 cells and mouse primary HSC cells in vitro. 3.5. Biodistribution of DiR-Labeled pPB-SNALP in Vivo. As shown in Figure 6A, the particles preferentially accumulated in the liver, and there was significantly more pPBSNALP/DiR localized in liver than SNALP/DiR at different time points in vivo. The pharmacokinetic profile of DiR in the liver tissue was drawn based on the semiquantitative ROI analysis of the in vivo fluorescent signal (Figure 6B). These results were consistent with the ex vivo dissected tissue image at 48 h postinjection (Figure 6C). It was credible that the modification of pPB can significantly increase the uptake of SNALP in liver, indicating that pPB has the effect of active targeting in hepatic fibrosis. Another interesting result ex vivo was that, at 48 h postinjection, the spleen had relatively strong fluorescence in both groups. The credible explanation is that particles were taken up by macrophages in spleen by passive targeting. 3.6. Targeting Ability of pPB-SNALP to HSCs in Vivo. The targeting ability of pPB-SNALP to HSCs in vivo was studied by immunofluorescence staining analysis of fibrotic liver tissue sections. In Figure 7, red fluorescence indicated positive staining of α-SMA (a marker of HSC activation), green fluorescence indicated the loaded FAM in nanoparticles, and blue fluorescence indicated the nucleus. The images showed that, in the pPB-SNALP group, the green fluorescence tends to be distributed near the red fluorescence, suggesting the uptake of pPB-SNALP by HSC. By contrast, in the SNALP group, there is little green fluorescence distributed near the red fluorescence, suggesting that the unmodified SNALP almost cannot be taken up by HSC. The results indicated that the pPB modification gives pPB-SNALP targeting ability to HSCs. 3.7. Pharmacodynamic Study of pPB-SNALPs. Normal liver tissue staining showed normal lobular architecture and hepatic cell structure with central veins and radiating hepatic cords (Figure 8C and D). In contrast, neutrophilic infiltration, severe centrilobular congestion (Figure 8A), and welldeveloped hyperplasia in fibrous connective tissue (Figure 8B) were observed in the TAA-induced group, which demonstrates the successfully established TAA-induced high gp46 mRNA expression model. In addition, it was also determined by QPCR that expression of the gp46 gene in the TAA-induced group was 2.85-times that of the normal group.

Figure 3. Properties of SNALPs with or without pPB modification, whereby both particle sizes were between 110 and 130 nm, at PDI < 0.3 (A) and electrically neutral (B). Both SNALPs and pPB-SNALPs showed well-defined spherical morphology (C), which was consistent with the DLS results.

3.3. Transfection Efficiency of Three Anti-gp46 siRNAs. The qPCR results (Figure 4) from 2−ΔΔCt analysis showed that the knockdown percentages of the three anti-gp46 siRNAs were 15.6, 65.5, and 64.6%, respectively. Moreover, HSP47 protein expression in NIH3T3 cells was investigated by Western blot testing. The protein levels of HSP47 in the NIH3T3 cells were both obviously downregulated after transfection with siRNA2 and siRNA3, respectively, whereas siRNA1 showed no differences compared to the control group. siRNA2 and siRNA3 show similar knockdown ability, which is consistent with the qPCR result. siRNA2 had the best transfectability overall with nearly 70% knockdown of the gp46 gene in NIH3T3 cells, which was selected for the following study. 3.4. Cellular Uptake of pPB-SNALP. The results of cellular uptake are displayed qualitatively by fluorescent images and quantitatively as a percentage of FAM-positive cells (Figure 5). The pPB-SNALP/FAM was internalized by two different cells more efficiently than SNALP/FAM as shown by the green fluorescent images. Moreover, with the pPB modification, the

Figure 4. Knockdown percentages of the three anti-gp46 siRNAs were 15.6, 65.5, and 64.6%, respectively (A). The HSP47 level in NIH3T3 cells was analyzed by Western blotting (B), and gray analysis of the WB photograph (C) was also performed. siRNA2 had the best transfectability overall with nearly 70% knockdown of the gp46 gene. E

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics

Figure 5. Cellular uptake of pPB-SNALP/FAM (A-F, M-R) and SNALP/FAM (G-L, S-X) by LX-2 cells (upper), and mouse primary HSC cells (lower) were examined by confocal microscopy and flow cytometry. From left to right, they are a bright field, Hoechst blue light, FAM green light, the overlap of blue and green light, an enlarged view, and flow cytometry chart. Compared with SNALP/FAM (G-L, V-X), significantly more pPBSNALP/FAM (D-F, P-R) were internalized by LX-2 cells and mouse primary HSC cells. Numbers shown in the inset indicate mean fluorescence intensity.

liver disease was generally controlled at 70−200 nm to pass through the fenestrae in the sinusoidal endothelium of the liver. In our study, the SNALP we prepared had a narrow size distribution with a diameter in the range of 110−130 nm, which should be attributed to the reasonably used preparation materials and method. Among the materials, Dlin-MC3 had been proven in many reports to be the preferred cationic lipid in the preparation of SNALP because the positively charged Dlin-MC3 can effectively interact with negatively charged siRNA molecules via electrostatic interaction to form nanoscale particles.39 In addition, PEGylated phospholipids of PEG-DMG can form a layer of hydration film structure during systemic circulation, thus improving hydrodynamic stability and protecting their siRNA cargo from nuclease degradation.40 Moreover, the fusogenic lipid components such as DOPE and DSPC might also facilitate the cellular entry and subsequent endosomal escape of the complexes.41 In the aspect of surface charge, electrically neutral nanoparticles would not trigger the immune responses during the systemic circulation.42 In this study, we prepared SNALPs showing a neutral z-potential of 0 mV, which is desirable for siRNA delivery. Moreover, we used here the ethanol dilution method to prepare nanoparticles. In this process, lipid organic solution and nucleic acid aqueous solution were mixed up in the buffer to form SNALPs to ensure that the nanoparticles are homogeneous and stable and reduce leakage of siRNA, thus making siRNA delivery safe and efficient. Because siRNAs can specifically suppress disease-associated gene expression, they have become potential therapeutic agents

The biochemical analysis for ALT and AST revealed significant improvement of fibrotic symptoms in TAA-induced mice. At 2 weeks postinjection of SNALPs, serum levels of ALT and AST in the pPB-SNALP group were significantly reduced compared with those of the SNALP group (p < 0.01). The levels of ALT and AST in TAA-induced mice nearly returned to normal by pPB-SNALP treatment (Figure 9B and C). Apart from this, quantitative evaluation of α-SMA intensity in Western blot analysis also showed that the pPB-SNALP group had a more significant decrease in the production of αSMA in the liver compared to that of the SNALP group (Figure 10A and B). Furthermore, the results from qPCR of the liver were consistent with the above findings, showing that the expression of anti-gp46 mRNA in the pPB-SNALP and SNALP groups reached 37 and 12%, respectively (Figure 9A). It is confirmed that pPB-SNALP played a more enhanced gene silencing effect than that of SNALP.

4. DISCUSSION AND CONCLUSIONS In this study, pPB was conjugated to SNALP to target hepatic fibrosis. The results showed that pPB-conjugated SNALP exhibited good targeting ability to LX-2 cells and mouse primary HSC cells in vitro and liver tissue in vivo in TAAinduced high gp46 mRNA expression mice based on pPB mediation. pPB modification further significantly enhanced the inhibition effect of siRNA-loaded SNALP on hepatic fibrosis. The physicochemical properties of SNALP had a major influence on the delivery of siRNA to the liver, such as vesicle size and surface charge.36−38 The ideal nanoparticle size for F

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics

Figure 6. Biodistribution of DiR-labeled SNALP and pPB-SNALP in high gp46 mRNA expression Kunming mice at different time points in vivo following i.v. injection (A). There was significantly more pPB-SNALP distribution in the liver tissue than SNALP. The pharmacokinetic profile of DiR based on the semiquantitative ROI analysis of in vivo fluorescent images showed that the AUC of pPB-SNALP reached 2.37-fold that of SNALP (B). Ex vivo fluorescence images of dissected tissues at 48 h postinjection (C).

Figure 7. Targeting ability of pPB-SNALPs to HSCs in vivo as evidenced by the immunofluorescence staining analysis of fibrotic liver tissue sections. pPB-SNALPs (A) tend to be taken up by HSCs, whereas SNALPs (B) are not. Red fluorescence indicated positive staining of α-SMA; green fluorescence indicated the loaded FAM in nanoparticles, and blue fluorescence indicated the nucleus.

for the treatment of various diseases.43−45 However, the inadequate target specificity of siRNA to treat hepatic fibrosis has limited their suitability for clinical use. We used a twopronged strategy to solve the above problem. First, we detected collagen-specific chaperone molecule (gp46) overexpression in the fibrotic livers of mice treated with TAA; accordingly, gp46

served as a therapeutic target. Second, we delivered siRNA specifically to collagen-producing liver cells through pPB binding to PDGFR-β. The results confirmed that pPBSNALP showed significant gene silencing efficacy and antifibrotic effects in vivo. After pPB-SNALP treatment, serum ALT and AST levels and the expression of α-SMA G

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics

Figure 8. Histological analyses of dissected liver tissues after intraperitoneal injection of TAA (A, B) and saline (C, D) to mice for 15 days. The arrows show neutrophilic, infiltration severe centrilobular congestion (A) and well-developed hyperplasia in fibrous connective tissue (B).

Figure 9. Anti-gp46 mRNA expression effect of SNALP after systemic delivery to TAA-induced mice treated with PBS, SNALP, or pPB-SNALP was assessed by the percentage of gp46 mRNA knockdown by qPCR (A), ALT (B), and AST (C) levels in the serum. The data are shown as mean ± SD.

Figure 10. Western blot analyses of dissected fibrotic liver tissues after systemic treatment with PBS, SNALP, or pPB-SNALP at 0.023 mg/kg of siRNA every other day for 2 weeks; the results confirmed the α-SMA protein reduction due to the silencing of gp46 mRNA. The data are the mean values ± SD, *p < 0.05, **p < 0.01.

protein nearly complete normalized in fibrotic liver. Furthermore, the results from qPCR of the liver showed that gp46

gene silencing efficiency was 37%. Consistent with the in vivo results, specific uptake of pPB-SNALP by LX-2 cells and mouse H

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics

(9) Huang, J. Q.; Tao, R.; Li, L.; Ma, K.; Xu, L.; Ai, G.; Fan, X. X.; Jiao, Y. T.; Ning, Q. Involvement of heat shock protein 47 in Schistosoma japonicum-induced hepatic fibrosis in mice. Int. J. Parasitol. 2014, 44 (1), 23−35. (10) Yasuda, K.; Hirayoshi, K.; Hirata, H.; Kubota, H.; Hosokawa, N.; Nagata, K. The Kruppel-like factor Zf9 and proteins in the Sp1 family regulate the expression of HSP47, a collagen-specific molecular chaperone. J. Biol. Chem. 2002, 277 (47), 44613−22. (11) Hirotoshi Ishiwatari, Y. S. Treatment of pancreatic fibrosis with siRNA against a collagen-specific chaperone in vitamin A-coupled liposomes. Pancreas 2012, 1328−1339. (12) Baigude, H.; McCarroll, J.; Yang, C.-s.; Swain, P. M.; Rana, T. M. Design and Creation of New Nanomaterials for Therapeutic RNAi. ACS Chem. Biol. 2007, 2, 237−241. (13) Singh, Y.; Tomar, S.; Khan, S.; Meher, J. G.; Pawar, V. K.; Raval, K.; Sharma, K.; Singh, P. K.; Chaurasia, M.; Surendar Reddy, B.; Chourasia, M. K. Bridging small interfering RNA with giant therapeutic outcomes using nanometric liposomes. J. Controlled Release 2015, 220 (Pt A), 368−87. (14) Kim, S. H.; Mok, H.; Jeong, J. H.; Kim, S. W.; Park, T. G. Comparative Evaluation of Target-Specific GFP Gene Silencing Efficiencies for Antisense ODN, Synthetic siRNA, and siRNA Plasmid Complexed with PEI-PEG-FOL Conjugate. Bioconjugate Chem. 2006, 17, 241−244. (15) Sato, Y.; Murase, K.; Kato, J.; Kobune, M.; Sato, T.; Kawano, Y.; Takimoto, R.; Takada, K.; Miyanishi, K.; Matsunaga, T.; Takayama, T.; Niitsu, Y. Resolution of liver cirrhosis using vitamin A-coupled liposomes to deliver siRNA against a collagen-specific chaperone. Nat. Biotechnol. 2008, 26 (4), 431−42. (16) Matsui, K.; Horiuchi, S.; Sando, S.; Sera, T.; Aoyama, Y. RNAi Silencing of Exogenous and Endogenous Reporter Genes Using a Macrocyclic Octaamine as a “Compact” siRNA Carrier. Studies on the Nonsilenced Residual Activit. Bioconjugate Chem. 2006, 17, 132−138. (17) Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids. J. Controlled Release 2005, 107 (2), 276−87. (18) Li, C.; Wang, Y.; Zhang, X.; Deng, L.; Zhang, Y.; Chen, Z. Tumor-targeted liposomal drug delivery mediated by a diseleno bondstabilized cyclic peptide. Int. J. Nanomed. 2013, 8, 1051−62. (19) Wu, J.; Jiang, H.; Bi, Q.; Luo, Q.; Li, J.; Zhang, Y.; Chen, Z.; Li, C. Apamin-mediated actively targeted drug delivery for treatment of spinal cord injury: more than just a concept. Mol. Pharmaceutics 2014, 11 (9), 3210−22. (20) Wolfgang Mehnert, K. M. Solid lipid nanoparticles Production, characterization and applications. Adv. Drug Delivery Rev. 2001, 47, 165−196. (21) Mussi, S. V.; Torchilin, V. P. Recent trends in the use of lipidic nanoparticles as pharmaceutical carriers for cancer therapy and diagnostics. J. Mater. Chem. B 2013, 1 (39), 5201. (22) Tam, Y. Y.; Chen, S.; Cullis, P. R. Advances in Lipid Nanoparticles for siRNA Delivery. Pharmaceutics 2013, 5 (3), 498− 507. (23) Kong, W. H.; Park, K.; Lee, M. Y.; Lee, H.; Sung, D. K.; Hahn, S. K. Cationic solid lipid nanoparticles derived from apolipoproteinfree LDLs for target specific systemic treatment of liver fibrosis. Biomaterials 2013, 34 (2), 542−51. (24) Guo, S.; Huang, L. Nanoparticles containing insoluble drug for cancer therapy. Biotechnol. Adv. 2014, 32 (4), 778−88. (25) Borkham-Kamphorst, E.; Herrmann, J.; Stoll, D.; Treptau, J.; Gressner, A. M.; Weiskirchen, R. Dominant-negative soluble PDGFbeta receptor inhibits hepatic stellate cell activation and attenuates liver fibrosis. Lab. Invest. 2004, 84 (6), 766−77. (26) Zhou, W. C.; Zhang, Q. B.; Qiao, L. Pathogenesis of liver cirrhosis. World journal of gastroenterology 2014, 20 (23), 7312−24. (27) Li, L.; Wu, T.; Huang, J.; Ma, K.; Xu, L.; Wang, H.; Fan, X.; Tao, R.; Ai, G.; Ning, Q. Expression of heat shock protein 47, transforming growth factor-beta 1, and connective tissue growth factor in liver tissue of patients with Schistosoma japonicum-induced hepatic fibrosis. Parasitology 2015, 142 (2), 341−51.

primary HSCs after binding to PDGFR-β was shown in in vitro studies, and organ distribution of DiR-labeled pPB-SNALP was also compatible with the notion that pPB-SNALP was specifically taken up into HSCs by PDGFR-β receptor. Therefore, our delivery system actually reverses hepatic fibrosis both histologically and functionally, which underscores its promise for clinical translation to treat hepatic fibrosis. In summary, we constructed pPB-mediated stable siRNA lipid nano delivery systems against hepatic fibrosis. pPBSNALPs were proven to be able to target hepatic fibrosis in vitro and in vivo. In addition, pPB-SNALPs showed an enhanced inhibitory effect on hepatic fibrosis compared with that of unconjugated SNALPs. Our results suggest that pPBSNALPs are an effective drug delivery system for the targeted therapy of hepatic fibrosis.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. ORCID

Lipeng Gao: 0000-0002-5680-6789 Weiyue Lu: 0000-0001-8003-2675 Zhiqiang Yan: 0000-0002-3176-5757 Author Contributions ∇

Z.J. and Y.G. contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Basic Research Program of China (2013CB932500), National Natural Science Foundation of China (81470861, 60976004), The National Key Technology R&D Program (No. 2015BAK45B00), Shanghai Science and Technology Council (No 16DZ2280100), “985” grants of East China Normal University (ECNU), and Zhejiang Provincial Natural Science Foundation (LY14H300002).

■

REFERENCES

(1) Lee, Y. A.; Wallace, M. C.; Friedman, S. L. Pathobiology of liver fibrosis: a translational success story. Gut 2015, 64 (5), 830−41. (2) Makvandi, M. Update on occult hepatitis B virus infection. World journal of gastroenterology 2016, 22 (39), 8720−8734. (3) Qureshi, K.; Patel, S.; Meillier, A. The Use of Thrombopoietin Receptor Agonists for Correction of Thrombocytopenia prior to Elective Procedures in Chronic Liver Diseases: Review of Current Evidence. Int. J. Hepatol. 2016, 2016, 1802932. (4) Gressner, O. A.; Weiskirchen, R.; Gressner, A. M. Evolving concepts of liver fibrogenesis provide new diagnostic and therapeutic options. Comp. Hepatol. 2007, 6, 7. (5) Mokdad, A. A.; Lopez, A. D. Liver cirrhosis mortality in 187 countries between 1980 and 2010: a systematic analysis. BMC Med. 2014, 12, 1741−7015. (6) Atta, H. M. Reversibility and heritability of liver fibrosis: Implications for research and therapy. World journal of gastroenterology 2015, 21 (17), 5138−48. (7) Friedman, S. L. Mechanisms of hepatic fibrogenesis. Gastroenterology 2008, 134 (6), 1655−69. (8) Huang, L.; Xie, J.; Bi, Q.; Li, Z.; Liu, S.; Shen, Q.; Li, C. Highly Selective Targeting of Hepatic Stellate Cells for Liver Fibrosis Treatment Using a d-Enantiomeric Peptide Ligand of Fn14 Identified by Mirror-Image mRNA Display. Mol. Pharmaceutics 2017, 14 (5), 1742−1753. I

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics (28) Beljaars, L.; Weert, B.; Geerts, A.; Meijer, D. K. F.; Poelstra, K. The preferential homing of a platelet derived growth factor receptorrecognizing macromolecule to fibroblast-like cells in fibrotic tissue. Biochem. Pharmacol. 2003, 66 (7), 1307−1317. (29) Bansal, R.; Prakash, J.; de Ruijter, M.; Beljaars, L.; Poelstra, K. Peptide-modified albumin carrier explored as a novel strategy for a cell-specific delivery of interferon gamma to treat liver fibrosis. Mol. Pharmaceutics 2011, 8 (5), 1899−909. (30) Chen, Q.; Chen, L.; Kong, D.; Shao, J.; Wu, L.; Zheng, S. Dihydroartemisinin alleviates bile duct ligation-induced liver fibrosis and hepatic stellate cell activation by interfering with the PDGFbetaR/ERK signaling pathway. Int. Immunopharmacol. 2016, 34, 250− 8. (31) Li, F.; Li, Q. H.; Wang, J. Y.; Zhan, C. Y.; Xie, C.; Lu, W. Y. Effects of interferon-gamma liposomes targeted to platelet-derived growth factor receptor-beta on hepatic fibrosis in rats. J. Controlled Release 2012, 159 (2), 261−70. (32) Li, Q.; Yan, Z.; Li, F.; Lu, W.; Wang, J.; Guo, C. The improving effects on hepatic fibrosis of interferon-gamma liposomes targeted to hepatic stellate cells. Nanotechnology 2012, 23 (26), 265101. (33) Yan, Z.; Wang, F.; Wen, Z.; Zhan, C.; Feng, L.; Liu, Y.; Wei, X.; Xie, C.; Lu, W. LyP-1-conjugated PEGylated liposomes: a carrier system for targeted therapy of lymphatic metastatic tumor. J. Controlled Release 2012, 157 (1), 118−25. (34) Bao, Y.; Jin, Y.; Chivukula, P.; Zhang, J.; Liu, Y.; Liu, J.; Clamme, J. P.; Mahato, R. I.; Ng, D.; Ying, W.; Wang, Y.; Yu, L. Effect of PEGylation on biodistribution and gene silencing of siRNA/lipid nanoparticle complexes. Pharm. Res. 2013, 30 (2), 342−51. (35) Liu, C.; Zhao, G.; Liu, J.; Ma, N.; Chivukula, P.; Perelman, L.; Okada, K.; Chen, Z.; Gough, D.; Yu, L. Novel biodegradable lipid nano complex for siRNA delivery significantly improving the chemosensitivity of human colon cancer stem cells to paclitaxel. J. Controlled Release 2009, 140 (3), 277−83. (36) Tseng, Y. C.; Mozumdar, S.; Huang, L. Lipid-based systemic delivery of siRNA. Adv. Drug Delivery Rev. 2009, 61 (9), 721−31. (37) Lin, X.; Gao, R.; Zhang, Y.; Qi, N.; Zhang, Y.; Zhang, K.; He, H.; Tang, X. Lipid nanoparticles for chemotherapeutic applications strategies to improve anticancer efficacy. Expert Opin. Drug Delivery 2012, 9, 767−781. (38) Suzuki, Y.; Hyodo, K.; Tanaka, Y.; Ishihara, H. siRNA-lipid nanoparticles with long-term storage stability facilitate potent genesilencing in vivo. J. Controlled Release 2015, 220 (Pt A), 44−50. (39) Wan, C.; Allen, T. M.; Cullis, P. R. Lipid nanoparticle delivery systems for siRNA-based therapeutics. Drug Delivery Transl. Res. 2014, 4 (1), 74−83. (40) Peerada, Y.; Andrew D Miller, M. M. Enzyme-triggered PEGylated siRNA-nanoparticles for controlled release of siRNA. Journal of RNAi and Gene Silencing 2014, 490−499. (41) Zhang, S.; Zhao, B.; Jiang, H.; Wang, B.; Ma, B. Cationic lipids and polymers mediated vectors for delivery of siRNA. J. Controlled Release 2007, 123 (1), 1−10. (42) Akinc, A.; Goldberg, M.; Qin, J.; Dorkin, J. R.; Gamba-Vitalo, C.; Maier, M.; Jayaprakash, K. N.; Jayaraman, M.; Rajeev, K. G.; Manoharan, M.; Koteliansky, V.; Rohl, I.; Leshchiner, E. S.; Langer, R.; Anderson, D. G. Development of lipidoid-siRNA formulations for systemic delivery to the liver. Mol. Ther. 2009, 17 (5), 872−9. (43) Park, K.; Lee, M. Y.; Kim, K. S.; Hahn, S. K. Target specific tumor treatment by VEGF siRNA complexed with reducible polyethyleneimine-hyaluronic acid conjugate. Biomaterials 2010, 31 (19), 5258−65. (44) Malhotra, M.; Tomaro-Duchesneau, C.; Prakash, S. Synthesis of TAT peptide-tagged PEGylated chitosan nanoparticles for siRNA delivery targeting neurodegenerative diseases. Biomaterials 2013, 34 (4), 1270−80. (45) Sung, D. K.; Kong, W. H.; Park, K.; Kim, J. H.; Kim, M. Y.; Kim, H.; Hahn, S. K. Noncovalenly PEGylated CTGF siRNA/PDMAEMA complex for pulmonary treatment of bleomycin-induced lung fibrosis. Biomaterials 2013, 34 (4), 1261−9.

J

DOI: 10.1021/acs.molpharmaceut.7b00709 Mol. Pharmaceutics XXXX, XXX, XXX−XXX