Bioconjugate Chem. 1996, 7, 568−575
568
Preparation of Conjugates between Oligonucleotides and N-Vinylpyrrolidone/N-Acryloxysuccinimide Copolymers and Applications in Nucleic Acid Assays To Improve Sensitivity Marie-Noe¨lle Erout,† Alain Troesch,‡ Christian Pichot,† and Philippe Cros*,‡ Laboratoire des Sondes Nucle´iques BioMe´rieux, Parc d’activite´ de Moulin a` Vent Baˆt. 20, 33 rue du docteur Le´vy, 69200 Ve´nissieux, France, and UMR 103 CNRS-BioMe´rieux, ENS Lyon, 46 Alle´e d’Italie, 69364 Lyon Cedex 07, France. Received January 29, 1996X
A simple approach has been developed to prepare conjugates between oligodeoxyribonucleotides (ODNs) and linear copolymers of N-vinylpyrrolidone (NVP)/N-acryloxysuccinimide (NAS). These conjugates were of higher than expected molecular weight, as determined by light scattering. Side reactions between amino groups on heterocyclic bases, especially of cytosine, are proposed to explain the formation of aggregates. ODN-NVP/NAS conjugates used in both capture and detection steps in sandwich hybridization increased assay sensitivity. Sensitivity to 107 DNA molecules/mL was reached for a 2.3 kb PCR fragment of hepatitis B virus (HBV) genomic DNA.
INTRODUCTION
Nucleic acid detection is an analytical tool showing great potential in the diagnostic detection of infectious and genetic diseases. Most detection strategies include amplification of the target sequence and detection of the amplified product (1). These techniques are very sensitive but are difficult to control for reproducibility and require extreme care to avoid cross-contamination. In addition, these strategies are not inherently quantitative, making it difficult to correlate the amplified product to the amount of target nucleic acid sequence present in the sample. Signal amplification presents an alternative to target amplification and offers a more direct method for quantitation. One signal amplification strategy is to incorporate multiple reporter groups in oligonucleotide hybridization probes, such as biotin (2-9), fluorophores (7, 10-12), and 2,4-dinitrophenyl (13). The main problems with this strategy, however, are the control of background and an increase in sensitivity that is not very high. An alternative strategy to traditional signal amplification methods employs the use of polymers with branched oligonucleotides in combination with short hybridization probes labeled with enzyme. These branched amplification multimers contain a primary sequence complementary to the target sequence and a set of secondary sequences that bind to the enzyme-labeled oligonucleotide. The theoretical amplification factor of this system depends on the ratio of linked labeled oligonucleotide sequences to target sequence. Amplification multimers used to link the enzyme-labeled oligonucleotide are large branched oligonucleotides, which have been synthesized first by a chemical procedure (14, 15) and more recently by using a combination of solid phase chemistry and enzymatic ligation methods (16). Though versatile in clinical applications (17), the preparation of these branched multimers is difficult and tedious. We report a simple approach to the synthesis of a new class of oligonucleotide-copolymer amplification struc* Author to whom correspondence should be addressed. † ENS Lyon. ‡ Laboratoire des Sondes Nucle ´ iques BioMe´rieux. X Abstract published in Advance ACS Abstracts, August 1, 1996.
S1043-1802(96)00046-8 CCC: $12.00
tures. These new structures were prepared by free radical polymerization of N-vinylpyrrolidone and Nacryloxysuccinimide (18) and then by covalently coupling oligonucleotides to these structures in an easy, one-step procedure (19). These new oligodeoxyribonucleotide (ODN)-copolymer conjugates were characterized, and their application in signal amplification was demonstrated for the detection of hepatitis B virus (HBV) DNA. EXPERIMENTAL PROCEDURES
Materials. N-Vinylpyrrolidone (NVP) (from Aldrich) was purified by reduced-pressure distillation. N-Acryloxysuccinimide (NAS) was obtained commercially (Kodak) and recrystallized in ethyl acetate/pentane mixture or was synthesized from N-hydroxysuccinimide and acryloyl chloride according to the method of Pollack (20). Copolymerization of NVP and NAS was performed at 60 °C in N,N-dimethylformamide with 4,4′-azobis(4cyanopentanoic acid) as initiator (19). After the reaction, copolymers were precipitated at low conversion with ethyl ether, filtered, washed several times with the same solvent, and dried under vacuum. One copolymer preparation, AZEO1, was of particular use in this study. It was prepared at the azeotropic composition of 60% NAS/40% NVP, which permitted the formation of homogeneous copolymer chains (see Figure 1 for the chemical structure). This copolymer was fully characterized in terms of composition, microstructure, and molecular weight as previously described (18). From light scattering studies, a weight-average molecular weight (Mw) of 70 000 was determined. One mole of this copolymer contained 288 equiv of NAS (Mw ) 169) and 192 equiv of NVP (Mw ) 111). ODN Synthesis. The ODNs used in this study were synthesized by β-cyanoethyl phosphoramidite chemistry on an Applied Biosystems DNA synthesizer Model 394. The 5′-aminohexyl modification was introduced using the phosphoramidite derivative of trifluoroacetylaminohexanol, Aminolink 2, from Applied Biosystems. This substitution gave a primary amino group, which allowed specific reactions of conjugation. After deprotection with aqueous ammonia, ODNs were precipitated with 0.1 volume of 3 M sodium acetate and 2 volumes of cold ethanol at -20 °C. ODNs were analyzed by ion exchange © 1996 American Chemical Society
Bioconjugate Chem., Vol. 7, No. 5, 1996 569
Conjugates of ODNs and NVP/NAS
Figure 1. Linear structure of the NVP/NAS copolymer. For AZEO1, which is prepared at the azeotropic composition, n ) 1 and m ) 1 (alternate copolymer). Table 1. Coupling of ODNs to NVP/NAS Copolymer ODNa
sequence (5′ to 3′)
ODN 1
TCATCCACCTGGCATTGGAC
ODN 2 ODN 3 ODN 4
TTTTCTTTTCCCCCCT GGTATGTTGCCCGTTTGTCCTCTA CTACTAATAGTAGTAGCGTTGCAC CTGTATTCCCATCCCATC
conjn proc
yieldb (%)
A B B B B
35 50 61 46 70
a ODN 1 and ODN 2 were used for chemical characterization. ODN 3 and ODN 4 were used for nucleic acid assays to detect HBV DNA. b Yield was measured by HPLC using eq 2 and represents the percent of coupling of ODN to the NVP/NAS copolymer AZEO1.
HPLC using a Gen Pak FAX column (Waters) and a gradient of 20-40% 1 M NaCl in 25 mM Tris-HCl, pH 8. The purity of ODNs was determined to be >80%. ODNs were quantified by measuring UV absorption at 260 nm, and concentration was determined by the equation
C)
A260 × 100 1.54nA + 0.75nC + 1.17nG + 0.92nT
(1)
where C is the concentration (nmol/mL) of the ODN at 260 nm and nA, nC, nG, and nT are the number of nucleotides A, C, G, and T, respectively, in the ODN sequence. Coupling of ODN to the NVP/NAS Copolymer. Dried ODN (15 × 10-9 mol) was dissolved in X µL of 0.1 M sodium borate buffer, pH 9.3, and then Y µL of DMF was added (see below for volumes). Twenty-five microliters of copolymer AZEO1 solution at 1 mg/mL in DMF was mixed with the ODN preparation. The coupling reaction was carried out for 2 h at 37 °C. Solvents were removed by evaporation under vacuum, and 50 µL of distilled water was added to redissolve the residue. Different coupling reaction conditions were tested. In procedure A, the more dilute condition, X ) 30 µL and Y ) 245 µL. In procedure B, X ) 10 µL and Y ) 68 µL. ODN-copolymer conjugates were purified by size exclusion chromatography (SEC). A Kontron device was equipped with an ultrahydrogel column (UH 500, Waters, 30 cm × 7.6 mm) having a porosity of 5 × 102 Å. The column buffer was 0.1 M sodium phosphate at pH 6.8, and a flow rate of 0.5 mL/min was used. Detection of products was performed by absorption at 260 nm. Purified conjugates were dialyzed against distilled water. Conjugates were stable and could be stored at -20 °C for months. The conjugates used in this study are described in Table 1. Characterization of the ODN-Copolymer Conjugate. Coupling Yield. The yield of coupling between ODN and copolymer was analyzed by SEC (19) as previously described. In addition, the following method was used. The NVP/NAS copolymer AZEO1 was labeled with the fluorescent dye fluorescein hydrazide, and the ODN was
coupled to the labeled copolymer. The amount of coupled ODN was determined by absorption at 260 nm and the amount of copolymer by fluorescence. AZEO1 [120 mg; 1.71 × 10-6 mol of copolymer or 4.94 × 10-4 mol of NAS (420 equiv)] was dissolved in 10 mL of DMF (Aldrich). Then 100 µL of triethylamine (Aldrich) and 100 µL of an aqueous solution of fluorescein hydrazide (6 mg/mL; 1.20 × 10-6 mol or 1 equiv; Molecular Probes) were added. The reaction mixture was stirred at room temperature for 2 h. Labeled copolymer was precipitated with ethyl ether, filtered, washed with water to remove excess fluorescein, and dried under vacuum. Labeled copolymer (0.9 mg) was dissolved in 3 mL of DMF/water (85/15 v/v). The intensity of fluorescence was measured (λex ) 506 nm, λem ) 526 nm) using a LS50 device (Perkin-Elmer) against a standard curve of dye in DMF/water. The procedure for coupling ODN to the labeled copolymer and the purification of the conjugate were as described in procedure A above. The intensity of fluorescein was remeasured against a standard curve of dye in water, the ODN-copolymer solvent. Under these conditions, λex ) 493 nm and λem ) 513 nm. ODN concentration was determined as described above (eq 1). Determination of Molecular Weights by SEC-LS. After filtration (0.22 µm filter, Millipore), 5 µL of the ODNcopolymer conjugate solution was analyzed by SEC using the UH500 ultrahydrogel column method. Detection was performed by refractometry (DR 410, Waters) and by light scattering using a multiangle detector (DawnF, Wyatt Technology). Detection of HBV DNA. Targets. Two HBV DNA targets were used in the experiments described here. The first target was a single-stranded oligonucleotide (synthetic target: 5′ GAT GGG ATG GGA ATA CAG GTG CTA GAG GAC AAA CGG GCA ACA TAC C 3′) with complementarity to the HBV capture and detection probes in the sandwich hybridization assay. The second target was a PCR product of HBV DNA, subtype ayw (21), cloned into pBR322. This clone was a generous gift of Pr. Tre´po (Inserm U271, Lyon, France). The sequences of the oligonucleotide primers used in PCR were (5′ to 3′) TGG AGA ACA TCA CAT CAG GA (158177) and TAA AGC CCA GTA AAG TTC CC (24772496), giving a product of 2339 bp. These sequences are strongly conserved in all known HBV DNAs. PCR was carried out on 20 ng of HBV plasmid in a 100 µL reaction containing 50 mM KCl, 10 mM Tris, pH 8.3, 1.5 mM MgCl2, 0.01% gelatin, 0.3 µM of each primer, 200 µM of each of the four deoxynucleotide triphosphates, and 1.5 units of Taq polymerase (Ampli Taq, PerkinElmer). The reaction was carried out in a Perkin-Elmer 9600 thermal cycler with cycling conditions at 94 °C for 1 min, 55 °C for 2 min, and 72 °C for 2 min for 40 cycles. PCR reaction products were analyzed by agarose gel electrophoresis, and the identity of the amplified band was confirmed by Southern blot analysis using a nonradioactive HBV DNA probe, 5′ GCA CCT GTA TTC CCA TCC CAT C 3′ (positions 595-616). The amplified PCR product was purified by agarose gel electrophoresis and electroelution. Sample Treatment. HBV DNA targets amplified by PCR were diluted in sample buffer (0.1 M sodium phosphate, pH 7, 0.5 M NaCl, 0.65% Tween, 0.14 mg/ mL salmon sperm DNA, 2% PEG 4000). Samples were denatured in 0.2 M NaOH (5 min at room temperature) and neutralized at 0.2 M acetic acid. HBV DNA Detection on the Vidas. Three different systems for detection of HBV DNA were defined on
570 Bioconjugate Chem., Vol. 7, No. 5, 1996
Erout et al.
bioMe´rieux’s Vidas immunoanalysis system. These tests were based on the sandwich hybridization format (22, 23) using specific probes, complementary to highly conserved regions of the HBV DNA sequence, for capture and detection. The capture probe ODN 3 consisted of the HBV specific sequence from position 460 to position 483 (Table 1). The detection probe ODN 4 contained the HBV specific sequence from position 595 to position 616 at its 3′ end (Table 1) and a non-HBV sequence at its 5′ end, which was complementary to a covalently linked alkaline phosphatase (AP) probe (24). The capture probe ODN 3 was coated by passive adsorption on the inside of a pipet tip-like disposable, the Vidas solid phase receptacle (SPR), which served as the solid phase capture support and as the pipettor receptacle in the assay. SPRs were coated in 150 nM ODN 3, in 4× phosphate-buffered saline (PBS) buffer (10× PBS is 1.37 M NaCl, 27 mM KCl, 43 mM Na2HPO4, and 14 mM KH2PO4) for 1 h at 37 °C, on the Vidas instrument. In the sandwich hybridization assay, wells of a disposable polypropylene strip were appropriately filled with hybridization buffer (sample buffer containing 20% of deionized formamide), washing buffer (1× PBS made 0.5% in Tween 20), detection probe ODN 4 at 15 nM in hybridization buffer, AP-labeled probe at 15 nM in hybridization buffer, and the detection substrate 4-methylumbelliferyl phosphate (4-MUP). Pretreated sample was introduced into the sample well of the prefilled Vidas strip (200 µL per test), and the strip was placed into the retaining tracks of the instrument. All reaction steps were performed automatically on the Vidas at 37 °C over a 3 h period during which the following occurred: capture of the target by ODN 3, washes, incubation with the detection probe ODN 4, washes, incubation with the AP-labeled probe, washes, and conversion of the AP substrate to a detectable fluorescent signal. The Vidas detector expresses the measured fluorescent signal in relative fluorescence values (RFV). This Vidas protocol was identical for the three HBV DNA assays, described in Figure 4: (A) classical sandwich hybridization without amplification (capture and detection of the target performed using the HBV capture ODN 3 and detection probe ODN 4 not conjugated to the NVP/NAS copolymer); (B) sandwich hybridization with signal amplification (detection probe ODN 4 used in conjugated form to the NVP/NAS copolymer); and (C) sandwich hybridization with capture and signal amplification (capture probe ODN 3 and detection probe ODN 4 used in forms conjugated to the NVP/NAS copolymer). RESULTS AND DISCUSSION
Coupling of ODN to NVP/NAS Copolymer. Figure 2 shows an example of SEC analysis for the coupling of ODN 1 to the NVP/NAS copolymer AZEO1. In SEC, the ODN-copolymer conjugate and the free ODN are separable since they exhibit a large discrepancy in molecular weights and consequently various hydrodynamic volumes. The coupling yield R is determined from the peaks of free ODN and ODN-copolymer conjugate using the equation
R)
IP (ODN-copolymer) × 100 IP (ODN-copolymer) + IP (free ODN)
(2)
where IP is the integrated peak. This calculation assumes that the absorbance at 260 nm of the ODN-copolymer conjugate is due to the ODN
Figure 2. Analysis of the grafting reaction of ODN 1 to the NVP/NAS copolymer AZEO1 by size exclusion chromatography (coupling procedure B). 1, ODN-copolymer conjugate; 2, free ODN; 3, NHS.
and that the molar extinction coefficient of this ODN form is the same as that for the free ODN; that is, this calculation does not consider the copolymer concentration. In Figure 2, R is 50% according to this determination. Equation 2 can also be used to determine the yield from solution capillary electrophoresis by which the ODN-copolymer and free ODN are separated by charge. These two methods of determination are in good agreement (19). To discount the possibility of physical adsorption of the ODN-copolymer conjugate to the column, especially when considering the high molecular weight of the conjugate which will be discussed later, coupling yield was verified by fluorescence. This was done by covalently attaching the fluorophore fluorescein hydrazide to the NVP/NAS copolymer prior to the coupling reaction. We estimated that 1 signifies a positive result. (A) Whole results; (B) enlargement of part A for the low values range, which was used to estimate the sensitivity of the different systems.
ness avoids the problem of reannealing after sample denaturation, as would occur for the double-stranded target. To explain the increase in sensitivity, we believe that capture amplification may work by increasing the accessibility of the capture oligonucleotides which are removed, thereby reducing steric hindrance on the solid support and presenting more flexible capture probes. This explanation is supported by the observation that capture amplification resulted in increased sensitivity for the long double-stranded target but not for the short singlestranded target. Increased sensitivity with signal amplification can be explained by an effective increase in the number of AP molecules hybridized to the detection ODN-copolymer. A similar principle based on the effective increase of AP molecules has been described by Urdea et al. (34), who developed the branched DNA (bDNA) signal amplification system. However, the structures of our and Urdea’s signal amplification systems differ in three respects: (i) our capture and detection oligonucleotides are covalently linked to an NVP/NAS copolymer by a direct and simple conjugation procedure, whereas in the bDNA test, the branched DNA structure is synthesized by a combination of solid phase chemistry and enzymatic ligation methods (17); (ii) in our signal amplification system, the HBV specific detection oligonucleotide is directly conjugated to the signal amplification NVP/NAS copolymer, whereas in the bDNA system the detection oligonucleotide is used to link the bDNA amplifier by a complementary sequence; (iii) our system also incorporates a capture amplification step with NVP/NAS-conjugated oligonucle-
otides adsorbed to the solid phase, whereas the bDNA system uses adsorbed oligonucleotides. The sensitivity of the bDNA test for HBV manufactured by Chiron Corp. (Quantiplex HBV assay) has been reported to range from 7 × 105 to 1 × 106 DNA molecules/ mL using cloned HBV DNA (35, 36). The higher sensitivity of the Quantiplex HBV assay to our assay (we detect 3.5 × 107 DNA molecules/mL of the 2339 bp HBV double-stranded target) might be explained by the use of a pool of multiple-site HBV detection oligonucleotides to link the bDNA amplifier; in the latter, 12 sequences are used in capture and 36 sequences in detection (34), whereas our system makes use of only 1 sequence in capture and 1 sequence in detection. Furthermore, the bDNA system uses a chemiluminescent substrate (dioxetane) in detection, which is known to be more sensitive than the fluorescent substrate (4-MUP) used in our Vidas assay. CONCLUSIONS
ODN-NVP/NAS copolymer conjugates have been prepared using a simple, one-step reaction procedure. These conjugates were characterized by SEC-LS and were shown to have a higher than expected molecular weight. Aggregate formation has been proposed to explain this, and the involvement of side reactions from heterocyclic base amino groups, especially of cytosine, has been implicated in this formation. The structure of these conjugates is currently under investigation using neutron scattering to confirm our hypothesis. Our ODN-NVP/NAS copolymer conjugates were tested in nucleic acid detection and were shown to improve
574 Bioconjugate Chem., Vol. 7, No. 5, 1996
assay sensitivity in both capture and signal efficiencies for a long double-stranded DNA. The main advantages of our technology are ease of preparation and sensitivity. We have demonstrated sensitivity to 3.5 × 107 molecules/mL for HBV DNA and are now testing our system in other application, e.g., in ribosomal RNA detection. Because of the observed sensitivity (∼107 molecules/mL), the ODN-NVP/NAS copolymer technology should be suited to the direct detection of nucleic acid in assays requiring a sensitivity of 106 DNA molecules/mL, without the need for target sequence amplification. ACKNOWLEDGMENT
We thank P. Levasseur for critical reading of the manuscript and for helpful comments. We also thank our Nucleic Acid Synthesis Group for making the ODNs used in this study; T. Delair, A. Laayoun, M. H. Charles, R. Kurfu¨rst, and A. Elaissari for valuable discussions; and A. Domard for making available the light scattering detector. We gratefully acknowledge B. Mandrand for support of this project. LITERATURE CITED (1) Abramson, R. D., and Myers, T. W. (1993) Nucleic acid amplification technologies. Curr. Opin. Biotechnol. 4, 41-47. (2) Nelson, P. S., Sherman-Gold, R., and Leon, R. (1989) A new and versatile reagent for incorporating multiple primary aliphatic amines into synthetic oligonucleotides. Nucleic Acids Res. 17 (18), 7179-7186. (3) Pieles, U., Sproat, B. S., and Lamm, G. M. (1990) A protected biotin containing deoxycytidine building block for solid phase synthesis of biotinylated oligonucleotides. Nucleic Acids Res. 18 (15), 4355-4360. (4) Misiura, K., Durrant, I., Evans, M. E., and Gait, M. R. (1990) Biotinyl and phosphotyronisyl phosphoramidite derivatives useful in the incorporation of multiple reporter groups on synthetic oligonucleotides. Nucleic Acids Res. 18 (15), 43454354. (5) Roget, A., Bazin, H., and Teoule, R. (1989) Synthesis and use of labelled nucleoside phosphoramidite building blocks bearing a reporter group: biotinyl, dinitrophenyl, pyrenyl and dansyl. Nucleic Acids Res. 17 (19), 7643-7651. (6) Pierlot, C., and Sergheraert, C. (1992) Solid phase synthesis of 5′ nonradioactive multiple labelled oligodeoxyribonucleotides. Bioorg. Med. Chem. Lett. 2 (3), 267-270. (7) Haralambidis, J., Angus, K., Pownall, S., Duncan, L., Chai, M., and Tregear, G. W. (1990) The preparation of polyamideoligonucleotide probes containing multiple non-radioactive labels. Nucleic Acids Res. 18 (3), 501-505. (8) De Vos, M. J., Van Elsen, A., and Bollen, A. (1994) New non nucleosidic phosphoramidites for the solid phase multilabelling of oligonucleotides: comb- and multifork-like structures. Nucleosides Nucleotides 13 (10), 2245-2265. (9) Teigelkamp, S., Ebel, S., Will, D. W., Brown T., and Beggs, J. D. (1993) Branched poly-labelled oligonucleotides: enhanced specificity of fork-shaped biotinylated oligoribonucleotides for antisense affinity selection. Nucleic Acids Res. 21 (19), 4651-4652. (10) Conway, N. E., and McLaughlin, L. W. (1991) The covalent attachment of multiple fluorophores to DNA containing phosphorothioate diesters results in highly sensitive detection of single stranded DNA. Bioconjugate Chem. 2, 452-457. (11) Sund, C., Ylikoski, J., Hurskainen, P., and Kwiatkowski, M. (1988) Construction of europium (Eu3+)-labelled oligo DNA hybridization probes. Nucleosides Nucleotides 7 (5 and 6), 655-659. (12) Pachmann, K., Reinecke, K., Emmerich, B., and Thiel, E. (1991) Highly fluorochrome labeled gene probes for quantitative tracing of RNA in individual cells by in situ hybridization. Bioconjugate Chem. 2, 19-25.
Erout et al. (13) Grzybowski, J., Will, D. W., Randall, R. E., Smith, C. A., and Brown, T. (1993) Synthesis and antibody-mediated detection of oligonucleotides containing multiple 2,4-dinitrophenyl reporter groups. Nucleic Acids Res. 21 (8), 1705-1712. (14) Horn, T., Warner, B. D., Running, J. A., Downing, K., Clyne, J., and Urdea, M. S. (1989) The synthesis of branched oligonucleotides as signal amplification multimers for use in nucleic acid assays. Nucleosides Nucleotides 8 (5 and 6), 875877. (15) Horn, T., and Urdea, M. S. (1989) Forks and combs DNA: the synthesis of branched oligodeoxynucleotides. Nucleic Acids Res. 17 (17), 6959-6967. (16) Urdea, M. S., Horn, T., Fultz, T., Anderson, M., Running, J., and Hamren, S. (1991) Branched DNA amplification multimers for the sensitive direct detection of human hepatitis viruses. Nucleic Acid Res. Symp. Ser. No. 24, 197-200. (17) Urdea, M. S. (1993) Synthesis and characterization of branched DNA (bDNA) for the direct and quantitative detection of CMV, HBV, HCV, HIV. Clin. Chem. 39 (4), 725-726. (18) Erout, M. N., Elaissari, A., Pichot, C., and Llauro, M. F. (1996) Radical initiated copolymers of N-vinylpyrrolidone and N-acryloxysuccinimide. Polymer 37 (7), 1157-1165. (19) Erout, M. N., Elaissari, A., Pichot, C., Cros, P., and Kurfurst, K. (1996) Characterization of the coupling reaction between oligodeoxyribonucleotides and N-vinylpyrrolidone/ N-acryloxysuccinimide copolymers by size exclusion chromatography and free solution capillary electrophoresis. Int. J. Polym. Anal. Charact. 2, 253-269. (20) Pollak, A., Blumenfeld, H., Wax, M., Baughn, R. L., and Whitesides, G. M. (1980) Enzyme immobilization by condensation copolymerization into crosslinked polyacrylamide gels. J. Am. Chem. Soc. 102, 6324-6336. (21) Galibert, F., Mandart, E., Fitoussi, F., Tiollais, P., and Charnay, P. (1979) Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 281, 646-650. (22) Allibert, P., Cros, P., and Mandrand, B. (1992) Automated detection of nucleic acid sequences of HPV16, 18 and 6/11. Eur. J. Biomed. Technol. 14, 152-155. (23) Mabilat, C., Desvarenne, S., Panteix, G., Machabert, N., Bernillon, M. H., Guardiola, G., and Cros, P. (1994). Routine identification of Mycobacterium tuberculosis complex isolates by automated hybridization. J. Clin. Microbiol. 32 (11), 27022705. (24) Jablonsky, E., Moomaw, E. W., Tullis, R. H., and Ruth, J. L. (1986) Preparation of oligonucleotide-alkaline phosphatase conjugates and their use as hybridization probes. Nucleic Acids Res. 14, 6115-6128. (25) J. Brandrup and E. H. Immergut, Eds. (1989) Polymer Handbook, Wiley, New York. (26) Ladaviere, C. (1995) personal communication. (27) Brown, T., and Brown, D. J. S. (1991) Modern machine aided methods in oligodeoxy ribonucleotides synthesis, in Oligonucleotides and Analogs, a Practical Approach (F. Eckstein, Ed.) p 1-23, IRL Press, Oxford, U.K.. (28) Erout, M. N. Doctorate thesis, Universite´ Claude Bernard, Lyon, 1994. (29) Connolly, B. A. (1987) The synthesis of oligonucleotides containing a primary amino group at the 5′-terminus. Nucleic Acids Res. 15 (7), 3131-3139. (30) Jones, R. A. (1984) Preparation of protected deoxyribonucleosides, in Oligonucleotide Synthesis, a Practical Approach (M. J. Gait, Ed.) pp 23-34, IRL Press, Oxford, U.K. (31) Bonino, F., Hoyer, B., Nelson, J., Engle, R., Verme, G., and Gerin, J. (1981) Hepatitis B virus DNA in the sera of HBsAg carriers: a marker of active hepatitis B virus replication in the liver. Hepatology 1, 386-391. (32) Zaaijer, H. L., Terborg, F., Cuypers, H. T. M., Hermus, M. C. A. H., and Lelie, P. N. (1994) Comparison of methods for detection of hepatitis B virus DNA. J. Clin. Microbiol. 32, 2088-2091. (33) Valentine-Thon, E. (1995) Evaluation of SHARP signal system for enzymatic detection of amplified hepatitis B virus DNA. J. Clin. Microbiol. 33, 477-480. (34) Urdea, M. S., Running, J. A., Horn, T., Clyne, J., Ku, L., and Warner, B. D. (1987) A novel method for the rapid detection of specific nucleotide sequences in crude biological
Bioconjugate Chem., Vol. 7, No. 5, 1996 575
Conjugates of ODNs and NVP/NAS samples without blotting or radioactivity; its application to the analysis of hepatitis B virus in human serum. Gene 61, 253-264. (35) Chen, C. H., Wang, J. T., Lee, C. Z., Sheu, J. C., Wang, T. H., and Chen, D. S. (1995) Quantitative detection of hepatitis B virus DNA in human sera by branched-DNA signal amplification. J. Virol. Methods 53, 131-137.
(36) Hendricks, D. A., Stowe, B. J., Hoo, B. S., Kolberg, J., Irvine, B. D., Neuwald, P. D., Urdea, M. S., and Perrillo, R. P. (1995) Quantitation of HBV DNA in human serum using a branched DNA (bDNA) signal amplification assay. Am. J. Clin. Pathol. 104 (5), 537-546.
BC960046A
