Bioconjugate Chem. 1995, 6, 135-1 38
135
TECHNICAL NOTES Preparation of Oligonucleotide-Biotin Conjugates with Cleavable Linkers Garrett A. Soukup,+Ronald L. Cerny,$ a n d L. J a m e s Maher, III*p+ The Eppley Institute for Research in Cancer and Allied Diseases and Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, 600 South 42nd Street, Omaha, Nebraska 68198-6805, and Department of Chemistry, University of Nebraska at Lincoln, Lincoln, Nebraska 68588-0362. Received September 26, 1994@
A procedure is presented for preparing an oligonucleotide-biotin conjugate that is chemically cleavable through the reduction of a disulfide bond within the linker. Conjugation involves reaction of a primary amine with an N-hydroxysulfosuccinimideester linked to biotin. The oligonucleotide can be liberated from streptavidin agarose containing immobilized conjugate under mild conditions (neutral pH, 50 mM dithiothreitol). This cleavable conjugate is useful for affinity purification applications.
The conjugation of biotin and DNA is useful for the isolation, purification, and detection of nucleic acids due to the high affinity of biotin for avidin or streptavidin (1-4). Many strategies exist for the production of biotinylated DNA. For example, biotin may be enzymatically incorporated into DNA as a nucleoside triphosphate analog ( 4 ) or chemically incorporated into synthetic oligonucleotides as a phosphoramidite (5). Separation of biotinylated DNA from avidin is difficult because the biotidavidin interaction is essentially irreversible. Synthesis of a linker that can be chemically cleaved has previously been shown to be useful in the recovery of DNA-protein complexes (3). A biotinylated thymidine analog containing a disulfide bond within the linker was used in the enzymatic production of biotinylated DNA. Nucleosomes reconstituted from histones and the biotinylated DNA were then recovered from avidin-agarose under reducing conditions. Here, we report the synthesis of a biotinylated oligonucleotide containing a disulfide bond within the linker. The oligonucleotide displays a single biotin moiety at its 3’ terminus. Duplexes constructed using a n oligonucleotide that is biotinylated in this manner provide tools for affinity purification of DNA binding proteins or other ligands. The ability to recover the DNA-ligand complex under mild conditions offers a n important advantage in affinity purification applications where specific complexes with DNA are to be separated from nonspecific complexes involving the solid support. Such problems frequently arise in affinity selection from combinatorial libraries of RNA ligands (6, 7). The duplex DNAs utilized in these studies are shown in Scheme 1A. Duplex I is nonbiotinylated (irrelevant sequence). I1 and I11 are biotinylated duplexes in which the biotin moieties are noncleavable and cleavable,
* To whom correspondence should be addressed. Tel.: 402559-8288.Fax: 402-559-4651.Internet
[email protected]. + University of Nebraska Medical Center. University of Nebraska at Lincoln. Abstract published in Advance ACS Abstracts, December 15,1994.
*
@
respectively. Scheme 1B outlines the synthesis of 111, showing the chemical structure of the cleavable linkage to biotin. Oligodeoxynucleotideswere synthesized by phosphoramidite methodology using a n Applied Biosystems Model 380B DNA synthesizer. The biotinylated strand of I1 was synthesized using BioTEG CPG (Glen Research, Sterling, VA). The 3’-amino oligonucleotideused in the production of the biotinylated strand of I11 was synthesized on 3’Amino-Modifier C7-CPG (Glen Research). The synthesis of all oligodeoxynuceotidesinvolved standard procedures using hot ammonium hydroxide for cleavage and deprotection. 3’-Amino oligonucleotide (-50 nmol) was gel purified ~ visualized by (20% acrylamide, 7.5 M urea, 0 . 5 TBE), UV-shadowing, excised, and eluted overnight a t 37 “C with agitation in 800 p L of water. The eluant was extracted with a n equal volume of pheno1:chloroform (1: l ) , and the oligonucleotide was precipitated by adjusting the solution to 100 mM NaCl and 10 mM MgC12 followed by the addition of 2.5 volumes of ethanol. Purified 3’amino oligonucleotide and 1 pmol of sulfosuccinimidyl 2-(biotinamidoethyl)-1,3-dithiopropionate(NHS-SS-Bi0 t h ; Pierce Chemical Co., Rockford, IL)were incubated in NaHC03 buffer (50 mM, pH 8.5, 400 pL) for 2 h at room temperature. Oligonucleotides were precipitated from the reaction by adjusting the solution to 100 mM NaCl and 10 mM MgClz followed by the addition of 2.5 volumes of ethanol. The product was again purified by gel electrophoresis. The biotin-SS-oligonucleotideexhibited lower gel mobility than the nonreacted 3’-amino oligonucleotide. Purified 3’-amino oligonucleotide and biotin-SS-oligonucleotide were analyzed on a Bruker BenchTOF laser desorption linear time-of-flight mass spectrometer using a nitrogen laser (337 nm). Samples (10-40 pmol) were placed on the probe tip with a matrix of 2,4,6-trihydroxyacetophenone buffered with diammonium hydrogen citrate as described by Pieles et al. (8). Analyses were performed in the negative ion mode. The spectra shown are the summed results of 50-100 laser pulses (Figure 1). The molecular weights determined for each compound were found to be in agreement with those calculated.
1043-1802/95/2906-0135$09.00/0 0 1995 American Chemical Society
136 Roconjugate Chem., Vol. 6,No. 1, 1995
A
Soukup et al. 01I
HzN*
mass calculated: 7392 found: 7387
fl
0-r-0I
(M-H) 7387 500
--400
1
(M-2H) -2 3697
200
lo0
0
A.
MOO
M O O
4000
,A,
Bow
7000
B
R/l
mass calculated: 7781 0
found: 7776
0
0
It
0-P-0-
I
0 --f3'-GTC
2 T 4CT3CT 5C 2T 2CG-5'1
(M-H) 7776 BOO
700
600
500 400
300 200 loo
0 MOO
1000
MOO
6000
7000
BOO0
Figure 1. Mass spectra. (A) Purified 3'-amino oligonucleotide. (B)Purified biotin-SS-oligonucleotide.
Biotin-SS-oligonucleotide (3.3 nmol) was annealed to complement oligonucleotide (4.9 nmol) in a 300 p L reaction in the presence of sodium chloride (200 d) by heating to 95 "C and cooling to room temperature to produce 111. I11 (3.3 nmol, 5.28 pg) was immobilized on streptavidin agarose beads containing -1.3 nmol of streptavidin (Pierce Chemical Co.) by incubation for 2 h at room temperature in phosphate buffered saline (PBS, 528 pL). Preparation of immobilized I1 from purified oligonucleotides was performed in a similar manner. Duplex I was prepared by annealing a 1:1 ratio of purified oligonucleotides. The ability of dithiothreitol (DTT) to cleave immobilized I11 from streptavidin agarose was investigated under various conditions relevant to an affinity purification application. Figure 2A shows that fluorescence of ethidium bromide (EB)-DNA complexes under ultraviolet light is localized to the agarose support when the duplex is immobilized (Figure 2A, column 3, top, middle, and bottom rows). When DNA is not immobilized, the fluorescence is dispersed diffusely in the solution (Figure
2A, column 2, top, middle, and bottom rows). Figure 2A shows the pH-dependent DTT cleavage of I11 from the support. Streptavidin agarose combined with duplex I (0.3 pug) and streptavidin agarose linked to I11 (0.3 pg) were incubated in a 10 p L solution containing 50 mM DTT, 6 mM magnesium chloride, 2 mM spermidine trihydrochloride, and either 40 mM sodium acetate pH 5.0, 40 mM Tris acetate pH 6.5, or 40 mM Tris hydrochloride pH 7.4. Solutions were incubated at 42 "C for the indicated times (Figure 2A, columns 1-9). Streptavidin agarose (no linked duplex DNA) was incubated in PBS (Figure 2A, column 1). Reactions were transferred to ice, combined with EB (10 ng, 2 pL), and illuminated as a single droplet on a UV transilluminator. Samples containing duplex I demonstrate the diffise fluorescence indicative of nonimmobilized EB-DNA complexes (Figure 2A, column 2). Efficient reduction of disulfide bonds by DTT required neutral pH conditions (Figure 2A, columns 3-9, compare top, middle, and bottom rows). Linker cleavage becomes considerably less efficient a t pH 6.5
BioconjugafeChem., Vol. 6, No. 1, 1995 137
Technical Notes
Scheme 1. (A) Structure of DNA Duplexes" and (B) General Scheme for Production of IIIn
A
5'-GATCTGAGAAAGGAGAGAAAAAGGGGCGGGGCATGCATTG ACTCTTTCCTCTCTTTTTCCCCGCCCCGTACGTAACCTAG-5' GCAGGAAAAGAAAGAAAAAGGAAGC -3' Biotin-CGTCCTTTTCTTTCTTTTTCCTTCG-5' GCAGGAAAAGAAAGAAAAAGGAAGC -3'
Biotin-S-S-GTCCTTTTCTTTCTTTTTCCTTCG-5'
I 11
111
OH
HzN-?
r-1
0-P-0-
L, +Y-GTC 2T4 CT3CT gC 2T2CG-5'1
Ib
t
111 Duplex I contains no DNA modifications. I1 is modified by conjugation to a noncleavable biotin moiety. I11 incorporates biotin via a cleavable linkage. Key: (a) incubation with NHS-SS-Biotin in aqueous buffer, pH 8.5; (b) incubation with oligonucleotide complementary to biotin-SS-oligonucleotide.
A
-
DNA duplex I Time(min) 60 60
111 0
b
10 20
30
40
50
60
6
7
8
9
pH 5.0 pH 6.5 pH 7.4
1
2
3
4
5
B Time(min) 10 25
1
2
40 55 70
3
4
5
Figure 2. Linker cleavage under mild conditions. (A) pHdependent D?T cleavage of duplex I11 from streptavidin agarose support. (B) Linker-dependent cleavage of duplex from streptavidin agarose support.
relative to pH 7.4 and is undetectable at pH 5.0 over this time course. Figure 2B shows that DTT cleavage of I11 from the support is due to its modified linker. Streptavidin
agarose presenting 0.3 pg of noncleavable I1 (Figure 2B, columns 1-5, top row) or cleavable I11 (Figure 2B, columns 1-5, bottom row) was incubated with 50 mM DTT in PBS (10 pL) a t room temperature for the indicated times. Reactions were combined with EB, and duplex DNA was visualized as described above. I1 remains bound to the support throughout DTT treatment (Figure 2B, columns 1-5, top row). In contrast, I11 is efficiently cleaved from the support (Figure 2B, columns 1-5, bottom row). In summary, we present a simple method for producing biotinylated duplex DNA that can be immobilized on an avidin- or streptavidin-based support and liberated under mild reducing conditions. In our laboratory, this conjugate has proven to facilitate experiments requiring affinity selection and isolation of RNAs that bind to duplex DNA, using a combinatorial RNA library. Similar methods might be applied to affinity purification of DNA binding proteins if exposure to mild reducing conditions is not detrimental to the structure and function of the desired protein. ACKNOWLEDGMENT
We thank D. Eicher for oligonucleotide synthesis and T. Smithgall for helpful comments on the manuscript. This work was supported by grants from the Nebraska Cancer and Smoking Disease Research Program, the National Institutes of Health, the National Cancer Institute, and an Institutional Research Grant from the
Soukup et al.
138 Sioconjugafe Chem., Vol. 6, No. 1, 1995
American Cancer Society. The Midwest Center for Mass Spectrometry is partially supported by National Science Foundation Grant DIR9017262. L.J.M. is a recipient of a Junior Faculty Research Award from the American Cancer Society and a Young Investigator’s Award from Abbott Laboratories. LITERATURE CITED (1) Takabatake, T., Asada, K., Uchimura, Y., Ohdate, M., and Kusukawa, N. (1992) The use of purine-rich oligonucleotides in triplex-mediated DNA isolation and generation of unidirectional deletions. Nucleic Acids Res. 20, 5853-5854. (2) Bock, L. C., Griffin, L. C., Latham, J. A,, Vermass, E. H., and Toole, J. J. (1992) Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564-566. (3) Shimkus, M., Levy, J., and Herman, T. (1985)A chemically cleavable biotinylated nucleotide: Usefulness in the recovery of protein-DNA complexes from avidin affinity columns. Proc. Natl. Acad. Sci. U.S.A.82, 2593-2597.
(4) Klevan, L., and Gebeyehu,G. (1990) Biotinylated nucleotides for labeling and detecting DNA. Methods Enzymol. 184,561577. (5) Misiura, R,Durrant, I., Evans, M. R., and Gait, M. J. (1990) Biotinyl and phosphotyrosinyl derivatives useful in the incorporation of multiple reporter groups on synthetic oligonucleotides. Nucleic Acids Res. 18, 4345-4354. ( 6 ) Pei, D., Ulrich, H. D., and Schultz, P. G. (1991) A combinatorial approach toward DNA recognition. Science 253, 1408- 141 1. (7) Tuerk, C., MacDougal, S., and Gold, L. (1992) RNA pseudoknots that inhibit human immunodeficiency virus type 1 reverse transcriptase. Proc. Natl. Acad. Sci. U.S.A. 89, 6988-6992. (8) Pieles, U., Zurcher, W., Schar, M., and Moser, H. E. (1993) Matrix-assisted laser desorption ionization time-of-flightmass spectrometry: a powerful tool for the mass and sequence analysis of natural and modified oligonucleotides. Nucleic Acids Res. 21, 3191-3196. BC940092F
